| Glycobiology | Pages |
Control of metastasis by Asn-linked, [beta]1-6 branched oligosaccharides in mouse mammary cancer cells
Introduction
Results
Discussion
Materials and methods
Acknowledgments
Abbreviations
References
Control of metastasis by Asn-linked, [beta]1-6 branched oligosaccharides in mouse mammary cancer cells
Key words: [beta]1-6 branched oligosaccharides/GlcNAcT-V/ transfection/metastasis
Introduction
The trimannosyl core of Asn-linked oligosaccharides may contain [beta]1-6(GlcNAc[beta]1-6Man[alpha]1-6Man[beta]1-) in tri- and tetra-antennary branches, which is regulated by the expression of UDP-GlcNAc:[alpha]-d-mannoside [beta]1,6N-acetylglucosaminyltransferase, i.e., GlcNAcT-V (EC 2.4.1.155) (Cummings et al., 1982). [beta]1-6 structures can be detected by L-PHA, a plant lectin which binds with high specificity and affinity to [beta]1-6 branching structures containing galactose on Asn-linked oligosaccharides (Cummings et al., 1982).
A common observation upon neoplastic and malignant transformation is an increase in [beta]1-6 branching on complex, Asn-linked carbohydrates (Hebert and Monsigny, 1993). Human malignant tumors, including invading esophageal carcinomas (Takano et al., 1990), metastasis of human breast cancer (Dennis et al., 1989b; Hiraizumi et al., 1992), the progression of colon and breast cancer (Fernandes et al., 1991), and malignant cells isolated from patients with Sezarry syndrome and colon cancer (Wojciechowicz et al., 1995; Derappe et al., 1996) have been shown to express increased levels of [beta]1-6 branching. A positive correlation between K-ras, increased [beta]1-6 branching, and increased ras GTP-level has been shown in pancreatic cancer cell lines (Schwarz et al., 1996). Baby hamster kidney cells transformed with Rous sarcoma virus or polyoma virus express higher levels of [beta]1-6 branching on Asn-linked oligosaccharides than untransformed cells (Takasaki et al., 1980; Yamashita et al., 1985; Pierce et al., 1986). Rat fibroblasts transfected with the cytoplasmic tyrosine kinase v-fps/fes and the activated GTPase T24 H-ras expressed increased [beta]1-6 branching which was associated with metastatic potential (Dennis et al., 1989a). Transfection with activated or proto-Ha-ras oncogenes in NIH3T3 fibroblasts was associated with an increase in [beta]1-6 branching and increased levels of GlcNAcT-V (Lu and Chaney, 1993).
The association between the expression of the malignant phenotype and elevated [beta]1-6 branched oligosaccharides has also been examined experimentally. Mutant cell lines which are reduced in levels of GlcNAcT-V and [beta]1-6 branching are reduced in the ability to form lung colonies following i.v. injection, but are not reduced in tumorigenic potential (Lu et al., 1994; Lu et al., unpublished observations). Cell lines with increased sensitivity to L-PHA and increased expression of sialylated tri- and tetra-antennary complex-type carbohydrates were enhanced in the metastatic potential of cells to form liver nodules following intravenous injection (Dennis et al., 1986). Similarly, cells treated with inhibitors of Asn-linked carbohydrate formation are reduced in metastatic potential, but not in tumorigenicity (Dennis, 1986b). These studies correlate the level of [beta]1-6 branching on complex oligosaccharides with metastatic potential.
Human trophoblast cells treated with swainsonine, a mannosidase II inhibitor that blocks complex carbohydrate formation, have a reduced ability to invade basement membranes (Yagel et al., 1990). Expression of GlcNAcT-V in an immortalized lung epithelial cell line resulted in loss of contact-inhibition of cell growth, a 50% increase in the incidence of benign tumors following injection into nude mice, and less adhesion on fibronectin- and collagen type IV-coated surfaces (Demetriou et al., 1995). Transfection of the highly metastatic cell line B16-hm with the gene encoding [beta]-1,4-N-acetylglucosaminyltransferase (GnT-III) decreased the level of [beta]1-6 branching through competition for substrate between GnT-V and exogenous GnT-III (Yoshimura et al., 1995). The selected clones with decreased binding to L-PHA were significantly decreased in the ability to form lung nodules in the experimental lung metastasis assay. These clones were also decreased in the ability to invade matrigel and attach to collagen and laminin.
In the present experiments, mouse mammary cancer cells were cotransfected with the cDNA for mouse GlcNAcT-V and pRSVneo. Geneticin-resistant cell lines with increased sensitivity to L-PHA were analyzed by serial lectin-affinity chromatography of biosynthetically labeled oligosaccharides and by Western blot analysis. Cell lines with increased [beta]1-6 branching and control cell lines were injected into the tail vein of syngenic Balb/c mice and metastatic potential ascertained. These cell lines were further analyzed for in vitro growth and extension of the [beta]1-6 branch.
Results
Derivation of transfected and control transfected cells
Three different mouse mammary carcinoma cell lines-168.1, 66.1, and 410.4 were transfected with the plasmid pCD1-GNT-V and/or pRSVneo using polybrene and DMSO. The first plasmid contained the murine cDNA for GlcNAcT-V, and the second plasmid contained the gene for resistance to neomycin. Cells transfected with both plasmids were selected for resistance to G-418 and then screened for increased sensitivity to L-PHA-mediated cytotoxicity. Three cell lines were isolated-168.1-TV.24, 66.1-TV.18, and 410.4-TV.84-which were increased in sensitivity to L-PHA. The TV designation designates these cell lines. Control cells were transfected with pRSVneo alone and were isolated for resistance to G-418. The control cell lines were designated 168.1-C1, 66.1-C2, and 410.4-C6 and also were analyzed for increased sensitivity to L-PHA.
Lectin-mediated cytotoxicity
Increases in the sensitivity to L-PHA-mediated cytotoxicity were observed in three pCD1-GNT-V transfected cells lines when compared with their control transfected counterparts (Table I). These values show relative changes but are only qualitative. No changes were observed in the sensitivity to Con-A, RIC, or WGA mediated cytotoxicity, supporting the conclusion that the increase in sensitivity to L-PHA mediated cytotoxicity is due to an elevation of [beta]1-6 branches on Asn-linked oligosaccharides in the transfected cell lines 168.1-TV.24, 66.1-TV.18, and 410.4-TV.84 and not an increased sensitivity to lectin-mediated cytotoxicity.
Table I.
| Cell line | L-PHA | Con-A | Ric | WGA |
| 168.1-C1* | 12.5-25 | 50 | 6-1.25 | 6.25 |
| 168.1-TV.24 | 6.25 | 50 | 1.25 | 6.25 |
| 66.1-C2* | 100 | 50 | 1.25 | 6.25 |
| 66.1-TV.18 | 25 | 50 | 1.25 | 6.25 |
| 410.4-C6* | >200 | 50 | 1.25-2.5 | 3.12 |
| 410.4-TV.84 | 50-100 | 50 | 1.25-2.5 | 3.12 |
PCR analysis of cell lines
In order to rule out the possibility that the isolated L-PHA sensitive cell lines were naturally arising variants derived from the parental cell line, the transfected cell lines were screened for the presence of the transfected plasmid containing the murine GlcNAcT-V cDNA. PCR analysis of transfected cell lines was performed in order to demonstrate that the increase in [beta]1-6 branched structures on Asn-linked oligosaccharides was the result of insertion of the murine GlcNAcT-V cDNA into genomic DNA.
Primers specific for the transfected plasmid cDNA were designed and PCR analysis of transfected and control cell lines was performed. Using the PCR primers described in Materials and methods, the predicted fragment of 328 bp was observed in the transfected cell lines while it was absent in the control transfected cell lines (Figure
Figure 1. PCR analysis of transfected and control cell lines. PCR was performed using genomic DNA from transfected and control cell lines,as described in Materials and methods. Reactions were analyzed on a 1% agarose gel. Lanes: 1, 1 kb ladder; 2, 1 ng plasmid control, pCD1-mGNT-V; 3, 168.1C*; 4, 168.1-TV.24; 5, 66.1C2*; 6, 66.1-TV.18; 7, 410.4-C6*; 8, 410.4-TV.84. * Indicates control cell lines
Figure 2. Northern blots of transfected and control cell lines. Poly(A)+ RNA was prepared from transfected and control cell lines and was probed with a fragment of murine GlcNAcT-V (Blot A) and [beta]-actin (Blot B) cDNA, as described in Materials and methods. Lanes: 1, 168.-C1*; 2, 168.1-TV.24; 3, 66.1-C2*; 4, 66.1-TV.18; 5, 410.4-C6*; 6, 410.4-TV.84. * Indicates control transfected cell lines. Northern blot analysis
To determine if the increase in [beta]1-6 branching is the result of an increase in GlcNAcT-V produced by the transcription of the transfected GlcNAcT-V expression vector, Northern blot analysis was performed. Poly(A)+RNA was isolated from cells and probed with a fragment of the murine GlcNAcT-V cDNA to analyze expression of GlcNAcT-V from the transfected L-PHA sensitive cell lines relative to control transfected cell lines. Cell lines transfected with the cDNA for GlcNAcT-V have a transcript at approximately 4.2 kb, the expected size of the exogenous transcript (Figure Serial lectin-affinity column chromatography
Because the values for lectin-mediated cytoxicity reported above are not quantitative determinants, the transfected and control cell lines were further characterized by lectin-affinity column chroma-tographic analysis of cellular oligosaccharides. The percent change of [beta]1-6 branching on Asn-linked oligosaccharides was determined by metabolically labeling cells, purifying oligosaccharides from membrane proteins, and determining the percent of each fraction as a percent of the total radioactivity.
Oligosaccharides were labeled metabolically with 3H-glucosamine and analyzed by sequentially loading on lectin-affinity chromatography using immobilized Con-A, PL, and L-PHA bound to Sepharose. The percent of each type of bound oligosaccharide between the L-PHA sensitive cell lines, 168.1-TV.24, 66.1-TV.18, and 410.4-TV.84, was compared to the control transfected cell lines, 168.1-C1, 66.1-C2, and 410.4-C6 (Table II).
An increase from 25.4% to 43.2% of the total [beta]1-6 branched oligosaccharides in the cell lines 168.1-C1 and 168.1-TV.24 was seen. This represents an increase of 70% in the L-PHA sensitive cell line, 168.1-TV.24. A 40% increase in the amount of [beta]1-6 branching between 66.1-TV.18 and 66.1C2 was observed. The cell line 410.4-TV.84 was increased in [beta]1-6 branching by 90% over that of its control cell line, 410.4-C6, as determined by lectin-affinity chromatography. Thus the cell lines increased in L-PHA cytotoxicity were increased 40-90% in the amount of [beta]1-6 branching on Asn-linked oligosaccharides, as determined by lectin-affinity column chromatography. Western blots
One possible explanation for the observed increase in L-PHA cytotoxicity is an increase in the expression of only a few glycoproteins containing [beta]1-6 branched, Asn-linked oligosaccharides. To determine whether the amount of specific glycoproteins was increased, or whether a general increase in the amount of [beta]1-6 branching or other carbohydrate structure occurred on all membrane glycoproteins, membrane glycoproteins were analyzed.
Membrane proteins were isolated and purified by SDS-PAGE, electrotransferred to Immobilon, and probed with either biotinylated L-PHA, DSA, or WGA (Figure
Membrane proteins were probed with DSA and WGA, lectins specific for sialic acid and repeating lactosamine units, respectively (Figure Experimental metastasis assay
To test the hypothesis that an increase in [beta]1-6 branching will increase metastatic potential, transfected and control transfected cell lines were injected into the tail vein of mice. Mice were sacrificed after 3 weeks, and lung nodules were counted. An increase in lung nodule formation was observed in transfected cell lines with increased [beta]1-6 branching in comparison with control transfected cell lines (Table III). In two independent experiments a 4- to 40-fold increase in lung tumors was observed in the cells expressing elevated [beta]1-6 branched oligosaccharides compared to their control transfected counterparts.
Discussion
Metastasis is a multistep process involving increased growth, changes in adhesion, invasion, blood-born survival, extravasation, angiogenesis, and other phenotypes for the successful dissemination of the primary tumor to secondary organ sites (Fidler, 1990). Previous studies have shown a direct correlation between [beta]1-6 branching and the ability to metastasize in experimental assay systems (Dennis et al., 1987), as well as increased expression of [beta]1-6 branching associated with human tumor progression and oncogenic transformation of cells (Takasaki et al., 1980; Fernandes et al., 1991). These experiments have not directly demonstrated that an increase in [beta]1-6 branching alone results in increased metastatic potential.
a
![]() |
b
![]() |
c
![]() |
Figure 3. Lectin blots of prepared membranes from transfected and controlcell lines. Fifty micrograms of prepared membranes was used in a 5-14% polyacrylaminde reducing gel, transferred to Immobilon, and probed with biotinylated lectins, as described in Materials and methods. (A) L-PHA, (B) WGA, and (C) DSA. Lanes: 1, 168.1-C1*; 2, 168.1-TV.24; 3, 66.1-C2*; 4, 66.1-TV.18; 5, 410.4-C6*; 6, 410.4-TV.84. * Indicates control cell lines.
Table II.
| Cell line | 168.1-C1* | TV.24 | 66.1-C2* | TV.18 | 1.80-C6* | TV.84 |
| Column peak | ||||||
| Con-A-BdI | 10.1 | 16.2 | 19.9 | 3.7 | 21.6 | 0.4 |
| Con-A-BdII | 19.0 | 11.8 | 11.9 | 4.7 | 19.2 | 1.2 |
| PL | 0 | 0 | 4.2 | 1.7 | 0 | 0.7 |
| L-PHAt | 45.0 | 28.8 | 46.9 | 61.9 | 47.6 | 76.1 |
| L-PHAr | 25.9 | 43.2 | 17.1 | 27.9 | 11.6 | 21.1 |
| %[beta]1-6 structures | 25.4 | 43.2 | 21.3 | 29.8 | 11.6 | 21.8 |
The present experiments show that an increase in [beta]1-6 branching by transfection of an expression vector containing GlcNAc-T V cDNA into metastatic and transformed cells directly increases metastatic potential. This increase has been shown in three different cell lines syngenic to Balb/c mice with increases of 4- to 40-fold in metastatic potential relative to control transfected cell lines.
These transfected cell lines with increased [beta]1-6 branching are not cell lines which were cloned and then found to be increased in [beta]1-6 structures. PCR analysis, which uses a 3[prime] primer to the T7 promoter of the GlcNAcT-V cDNA, shows the 328 bp product specific for the transfected plasmid only in the transfected cell lines (Figure
The transfected and control cell lines were tested for changes in in vitro growth rate, but no difference was seen (data not shown). This result is consistent with other reports in which no changes in in vitro growth rates were observed in cells expressing increased [beta]1-6 branching (Yoshimura et al., 1995; Derappe et al., 1996). There may be differences in in vivo growth rates or responsiveness to conditioned media, however (Vander Elst and Dennis, 1991).
One putative effect of increased [beta]1-6 branching of cell-surface Asn-linked carbohydrates on cells is adhesion (Olden, 1993). Both first trimester human trophoblasts and metastatic, oncogene transfected cells treated with swainsonine, which inhibits the formation of [beta]1-6 branching and other complex oligosaccharides, were less adhesive to amnion membranes (Yagel et al., 1990, 1989). Mv1Lu cells transfected with an expression construct for GlcNAcT-V and expressing increased [beta]1-6 structures were less adhesive to fibronectin- and collagen type IV-coated plastic (Demetriou et al., 1995).
In experiments performed in our laboratory (results not shown), transfected cells were tested for the ability to adhere to laminin-, collagen IV-, and fibronectin-coated plastic. No significant difference nor trend in the ability of cells expressing increased amounts of [beta]1-6 structures vs. control cells was found at any concentration or time for adherence to these molecules. These results suggest that the increase in experimental metastasis is not the result of changes in adhesion to fibronectin, collagen IV, or laminin.
A frequent change associated with increased [beta]1-6 branching is increased polylactosamine and sialic acid content. Both of these changes have been implicated in the transformation and metastasis of cells (Dennis, 1986; Pierce and Arango, 1986; Yousefi et al., 1991). In human breast cancer, tri- and tetra-antennary branching structures from normal mammary gland, primary carcinoma, and axillary lymph node metastasis were shown to contain both [beta]1-6 branches with increased and unchanged amounts of N-acetylglucosamine repeating units on the metastases (Hiraizumi et al., 1992).
Figure
| Cell line | Tumors | Average tumor number |
| First experiment | ||
| 168.1-C1* | 1, 0, 0, 1, 2, 3, 2, 2 | 1 ± 1 |
| 168.1-TV.24 | 95, 103, 74, 68, 88, 121, 136, 117 | 100 ± 37# |
| 66.1-C2* | 74, 1, 37, 36, 20, 29, 23, 44 | 33 ± 21 |
| 66.1-TV.18 | 135, 143, 154, 78, 86, 110, 162, 98 | 121 ± 32# |
| 410.4-C6* | 8, 1, 2, 5, 2, 4, 2, 3 | 4 ± 2 |
| 410.4-TV.84 | 130, 164, 182, 193, 151, 142, 194, 138 | 182 ± 25# |
| Second experiment | ||
| 168.1-C1* | 2, 1, 0, 2, 1, 0, 0 | 1 ± 1 |
| 168.1-TV.24 | 111, 28, 65, 60, 50, 33, 21 | 53 ± 31# |
| 66.1-C2* | 30, 28, 41, 32, 26, 33, 36, 29 | 32 ± 5 |
| 66.1-TV18 | 136, 125, 129, 96, 89, 123, 135 | 119 ± 19# |
| 410.4-C6* | 4, 3, 1, 2, 3, 1, 4, 5 | 3 ± 1.5 |
| 410.4-TV.84 | 96, 93, 107, 81, 106, 92, 80, 82 | 92 ± 11# |
Experiments with glycosylation inhibitors and mutant cell lines have shown a relationship between Asn-linked carbohydrates and invasive potential. Treatment with nontoxic concentrations of swainsonine of first trimester human trophoblasts and metastatic melanoma cells inhibited basement membrane invasion (Seftor et al., 1991; Korczak and Dennis, 1993). At the level of gene expression, glycosylation mutants and cells treated with swainsonine are increased in the transcription of tissue inhibitor of metallo-proteinases (TIMP).
Changes in invasion were observed, though not highly significant, in in vitro invasion assays (data not shown). Of the three transfected cell lines, two-66.1-TV.18 and 410.4-TV.84-were derived from in vivo invasive cell lines. Both showed an increase in in vitro invasive potential relative to control cell lines, with the largest increase in invasion in cell line 410.4-TV.84 (p < 0.08). This cell line also has the largest relative increase in [beta]1-6 branching and increases in extension of polylactosamine units. This result suggests that increased [beta]1-6 branching increases invasive potential in already invasive cells. The large increase in metastasis of the noninvasive cell line 168.1-TV.24 would support the conclusion that the increase in metastatic potential in this cell line is the result of other mechanisms rather than an increase in invasive ability as measured by in vitro assays.
The results presented demonstrate that specific increases in [beta]1-6 branched Asn-linked oligosaccharide structures will increase experimental metastasis in transformed mouse mammary adenocarcinoma cells. However, the mechanism by which altering [beta]1-6 branched oligosaccharide levels can affect the metastatic potential of these cells is not clear. This increase does not appear to be the result of a single in vitro increase in (1) invasiveness; (2) adhesion to fibronectin, laminin, or collagen IV; (3) growth rate; or (4) polylactosamine expression. Further work will be required to understand the mechanism by which changes in [beta]1-6 branching structures effect the metastatic potential of cells.
Materials and methods
Cell lines, lectins, animals, culture media, and plasmids
Mouse mammary cancer cell lines were obtained from G. Heppner (Karamanos Cancer Foundation, Detroit, MI) (Dexter et al., 1978). The lectins concanavalin (Con-A), wheat germ agglutinin (WGA), Ricinus communis agglutinin II (Ric), Datura stramonium lectin (DSA), and Phaseolus vulgaris agglutinin (L-PHA), as well as lectin-conjugated to agarose, were purchased from Vector Laboratories, Inc. (Burlingame, CA). Female Balb/C mice were purchased from Charles River (Wilmington, MA). Waymouth's media was purchased from Life Technologies Laboratories (Gaithersburg, MS). Calf bovine serum was purchased from Hyclone Laboratories, Inc. (Logan, UT).
The murine cDNA for GlcNAcT-V in pCD1-mGNT-V was kindly provided by N. Fregien (University of Miami, Miami, FL). This plasmid contains the 2.3 kb ORF of murine cDNA for GlcNAcT-V and ~1.0 kb of untranslated message in the eukaryotic expression vector pCDNA1 (Invitrogen, San Diego, CA). A second polyA+ tail is 3[prime] of the GlcNAcT-V insert, with expression driven by the CMV promoter.
All plasmids were purified by large scale purification from transformed DH5[alpha]-sur cells using Tip-500 columns and standard procedures (Qiagen, Inc. Chatsworth, CA). Mouse mammary cancer cell lines were obtained following transfection using the polybrene/DMSO shock method (Chaney et al., 1986) and selection in 1 mg/ml G-418 (Life Technologies, Gaithersburg, MD).
Lectin-mediated cytotoxicity assay
Sensitivity to plant lectins was performed as described previously (Stanley, 1983). Cells were trypsinized, washed, resuspended, counted, and plated at 4 × 103 cells/well in 96-well plates in 0.1 ml of Waymouth's media containing 10% bovine calf serum and 1% penicillin G, 1% streptomycin, and 1% glutamine (Life Technologies, Gaithersburg, MD). Cells were incubated overnight at 37°C and increasing concentrations of lectins were added in 0.1 ml of media. The cells were grown until control wells receiving no lectin were confluent and the cells were stained with 0.2% methylene blue in 50% methanol. The concentration of lectin which gave 10% survival of cells was then determined. The stability of the lectin mediated cytotoxicity profile of cell lines was confirmed throughout the course of this study.
PCR analysis
Genomic DNA was prepared from confluent cell cultures. Cells were lysed and placed in a rotating oven at 55°C for 2 h in 1 ml of 0.1 M NaCl, 0.05 M Tris, pH 7.5, 25 mM EDTA, pH 7.5, 1.0% SDS, and 0.5 mg Proteinase K (Life Technologies, Gaithersburg, MD). Genomic DNA was extracted with phenol/chloroform, ethanol precipitated, dried, and resuspended in TE (10 mM Tris-CL, 1 mM EDTA, pH 7.4) and 10 mM NaCl. Concentrations were determined by agarose gel electrophoresis and spectrophotometrically at an absorbency of 260 nm.
PCR reactions were performed in 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2 mM MgCl2 using 2 µg of genomic DNA or 1 ng of pCD1-mGNT-V, 50 pmol of primers, and 2.5 U of Taq polymerase (Life Technologies, Gaithersburg, MD). PCR was performed with 35 cycles at 94°C, 1 min, 50°C, 1 min, and 72°C, 1.5 min, following 94°C, 5 min and ending with a final extension time of 10 min, 72°C and a 4°C soak.
The 5[prime]-primer TAATACGACTCACTATAGGGCG corresponds to the T7 primer site of pCDNA1 (Invitrogen Corporation, San Diego, CA). The 3[prime]-primer GGCGAGCGTTTTCTTCAGATCAT (IDT, Inc., Coralville, IA) corresponds to the nucleotide 239 bp 3[prime] of the ATG start codon of the mouse GlcNAcT-V cDNA. Reactions were analyzed on a 1% agarose gel using 10 µl of reaction product.
Serial lectin-affinity column chromatography
Asn-linked oligosaccharides were labeled by the addition of Waymouth's media containing 100 µCi [3H]glucosamine (ICN Biochemical, Cosat, CA) and 10% dialyzed fetal calf serum to cell lines at 30% confluence. The cells were grown until 90% confluent and washed three times with 0.02 M phosphate, 0.15 M NaCl, pH 7.2 (PBS) buffer, lysed with 1% Triton-X-100, and centrifuged for 5 min at 650 × g. The supernatant was adjusted to 50 mM Tris-HCl and 1 mg/ml pronase (Boehringer Mannheim Corp., Indianapolis, IN). The pH was adjusted to 8.5, two drops of toluene were added, and the digestion was incubated at 55°C for 24 h. A second aliquot of pronase was added to 1 mg/ml for a second 24 h incubation.
The sample was heated for 10 min at 100°C and then centrifuged for 10 min at 650 × g. The supernatant fraction was collected, desalted on a Bio-gel P2 column (1.5-30 cm), and the peak fraction was saved, lyophilized, and resuspended in Con-A buffer (0.1 M NaAcetate, 1.0 M NaCl, 0.01 M McCl2, 0.01 M CaCl2, 0.01 M MnCl2, 0.02% NaN3). The glycoconjugates were applied to a column of Con-A-agarose (1 × 10cm) and washed with Con-A buffer (Con-A-T). The bound glycoconjugates were eluted with 10 mM [alpha]-methylglucoside in Con-A buffer (Con-A-B(I)) followed by 200 mM [alpha]-methylmannoside in ConA buffer (Con-A-B(II)). The ConA-T fractions were applied to a PL-agarose column (1 × 10cm) and washed with Con-A buffer (Con-A-T/PL-T) and bound materials eluted with 200 mM [alpha]-methylmannoside in Con-A buffer (Con-A-T/PL-B). The Con-A-T/PL-T glycoconjugates were desalted on a P2 column and loaded on to a column of L-PHA-agarose (1.2 × 15cm) in PBS buffer and eluted with PBS buffer to give Con-A-T/PL-T/L-PHA-T and Con-A-T/PL-T/L-PHA-B (Pierce and Arango, 1986).
Northern blot analysis
Total RNA was isolated from confluent cells using Triazol Reagent (Chomczynski and Sacchi, 1987). Five micrograms of polyA+ RNA (Collaborative Research, Inc., Lexington, MA) was subjected to electrophoresis in a 1.2% agarose, 6% formaldehyde gel and blotted to GeneScreen membrane (NEN Research Products, Boston, MA). A HindIII-XhoI fragment of a plasmid containing the murine GlcNAcT-V cDNA and a KpnI-XbaI fragment from the murine [beta]-actin cDNA (Ambion, Inc., Austin, TX) were radiolabeled using the random primer method (Amersham, Arlington, IL) and used as probes. The blot was hybridized at 55°C for 2 days in Church hybridization buffer (Church and Gilbert, 1984) washed twice at 45°C in 1 × SSC, 1% SDS, and developed for 9 days on a phosphoimager (Molecular Dynamics, Menlo Park, CA).
Western blot protocol
Cell membrane preparations were prepared according to the method of Massague and Czech (Massague and Czech, 1982) and the concentration determined using a Micro BCA Protein Assay Reagent Kit (Pierce, Rockford, IL). The 50 µg of membrane proteins were heated to 95°C for 5 min and placed on a reducing, 5-14% polyacrylamide gradient gel (Laemmli, 1970). Following electrophoresis, proteins were transferred to Immobilon (Millipore, Bedford, MA) by electrotransfer. The Immobilon blot was blocked with 5% BSA in TBS (50 mM Tris, 0.1% BSA, 0.025% Tween-20) and probed with biotinylated L-PHA (Vector Laboratories, Inc., Burlingame, CA) at a dilution of 1:500 in TBT for 2 h The blot was washed with TBT and developed with 0.006% NBT and 0.003% BCIP in 0.1 M NaHCO3. Similar blots were also probed with WGA (1:1000) and DSA (1:500).
Experimental metastasis assay
Transfected and control cells were isolated as described above. Cells (2.5 × 105 cells of 168.1-TV.24 and 168.1-C1 and 1.0 × 105 cells of 66.1-TV.18, 66.1-C2, 410.4-TV.84, and 410.4-C6) were resuspended in 0.1 ml PBS and injected into the tail veins of 8-10 week old female Balb/c mice. The mice were sacrificed after 3 weeks, the lungs were removed and fixed in Bouin's solution, and the surface tumors counted visually.
Acknowledgments
This research was supported by NIH Grant CA47980, the State of Nebraska, the Bessie Parker Fund, and the generous gift of the GlcNAcT-V expression vector from Nevis Fregien.
Abbreviations
GlcNAcT-V, N-acetylglucosaminyltransferase V, L-PHA, Phaseolus vulgaris agglutinin, Ric, Ricinus communisagglutinin II, Con-A, concanavalin A, WGA, wheat germ agglutinin, DSA, Datura stramonium lectin, PL, Pisum sativum lectin, PBS, phosphate-buffered saline, PCR, polymerase chain reaction.
References
1To whom correspondence should be addressed
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 19 Feb 1999
Copyright©Oxford University Press, 1999.
This article has been cited by other articles:
![]() |
Y. Zhao, T. Nakagawa, S. Itoh, K.-i. Inamori, T. Isaji, Y. Kariya, A. Kondo, E. Miyoshi, K. Miyazaki, N. Kawasaki, et al. N-Acetylglucosaminyltransferase III Antagonizes the Effect of N-Acetylglucosaminyltransferase V on {alpha}3beta1 Integrin-mediated Cell Migration J. Biol. Chem., October 27, 2006; 281(43): 32122 - 32130. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-B. Guo, I. Lee, M. Kamar, and M. Pierce N-Acetylglucosaminyltransferase V Expression Levels Regulate Cadherin-associated Homotypic Cell-Cell Adhesion and Intracellular Signaling Pathways J. Biol. Chem., December 26, 2003; 278(52): 52412 - 52424. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-B. Guo, I. Lee, M. Kamar, S. K. Akiyama, and M. Pierce Aberrant N-Glycosylation of {beta}1 Integrin Causes Reduced {alpha}5{beta}1 Integrin Clustering and Stimulates Cell Migration Cancer Res., December 1, 2002; 62(23): 6837 - 6845. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ihara, E. Miyoshi, J. H. Ko, K. Murata, S. Nakahara, K. Honke, R. B. Dickson, C.-Y. Lin, and N. Taniguchi Prometastatic Effect of N-Acetylglucosaminyltransferase V Is Due to Modification and Stabilization of Active Matriptase by Adding beta 1-6 GlcNAc Branching J. Biol. Chem., May 3, 2002; 277(19): 16960 - 16967. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Skinner and A. G. Wildeman Suppression of Tumor-related Glycosylation of Cell Surface Receptors by the 16-kDa Membrane Subunit of Vacuolar H+-ATPase J. Biol. Chem., December 14, 2001; 276(51): 48451 - 48457. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Murata, E. Miyoshi, M. Kameyama, O. Ishikawa, T. Kabuto, Y. Sasaki, M. Hiratsuka, H. Ohigashi, S. Ishiguro, S. Ito, et al. Expression of N-Acetylglucosaminyltransferase V in Colorectal Cancer Correlates with Metastasis and Poor Prognosis Clin. Cancer Res., May 1, 2000; 6(5): 1772 - 1777. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sasai, Y. Ikeda, T. Tsuda, H. Ihara, H. Korekane, K. Shiota, and N. Taniguchi The Critical Role of the Stem Region as a Functional Domain Responsible for the Oligomerization and Golgi Localization of N-Acetylglucosaminyltransferase V. THE INVOLVEMENT OF A DOMAIN HOMOPHILIC INTERACTION J. Biol. Chem., January 5, 2001; 276(1): 759 - 765. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





