Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Seberger, P. J.
Right arrow Articles by Chaney, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seberger, P. J.
Right arrow Articles by Chaney, W. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology Pages 235-241  


Control of metastasis by Asn-linked, [beta]1-6 branched oligosaccharides in mouse mammary cancer cells
Introduction
Results
Discussion
Materials and methods
Acknowledgments
Abbreviations
References


Control of metastasis by Asn-linked, [beta]1-6 branched oligosaccharides in mouse mammary cancer cells

Control of metastasis by Asn-linked, [beta]1-6 branched oligosaccharides in mouse mammary cancer cells

P. James Seberger and William G. Chaney1

Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68198-4525, USA

Received on April 6, 1998; revised on August 4, 1998; accepted on August 4, 1998

Studies in cell lines and malignant human tissues have shown that increased cell-surface Asn-linked [beta]1-6(GlcNAc[beta]1-6Man) branching is associated with increased tumorigenic and metastatic properties. In this study, three mouse mammary cancer cell lines were transfected with an expression vector containing the mouse cDNA for N-acetylglucosaminyltransferase V (GlcNAcT-V EC 2.4.1.155), the glycosyltransferase responsible for initiating [beta]1-6 branching on Asn-linked carbohydrates. The cell lines were screened for increased cytotoxicity to L-PHA, a lectin specific for [beta]1-6 branching structures. Cell lines exhibiting increased L-PHA cytotoxicity expressed increased levels of [beta]1-6 branching structures. Northern blots detected the presence of GlcNAcT-V transcribed from the expression vector in the L-PHA sensitive cell lines. After injection into the tail veins of mice, transfected cell lines with increased [beta]1-6 branching on the cell surface formed elevated levels of lung tumors relative to control transfected cell lines (P < 0.002). Western blots of membrane proteins from GlcNAcT-V transfected and control cells probed with the lectins DSA and WGA did not show an increase in polyN-acetyllactosamine and sialic acid content in the transfected cell lines. These results demonstrate that a specific increase in [beta]1-6 branching due to an elevation in GlcNAcT-V expression increases metastatic potential.

Key words: [beta]1-6 branched oligosaccharides/GlcNAcT-V/ transfection/metastasis

Introduction

The trimannosyl core of Asn-linked oligosaccharides may contain [beta]1-6(GlcNAc[beta]1-6Man[alpha]1-6Man[beta]1-) in tri- and tetra-antennary branches, which is regulated by the expression of UDP-GlcNAc:[alpha]-d-mannoside [beta]1,6N-acetylglucosaminyltransferase, i.e., GlcNAcT-V (EC 2.4.1.155) (Cummings et al., 1982). [beta]1-6 structures can be detected by L-PHA, a plant lectin which binds with high specificity and affinity to [beta]1-6 branching structures containing galactose on Asn-linked oligosaccharides (Cummings et al., 1982).

A common observation upon neoplastic and malignant transformation is an increase in [beta]1-6 branching on complex, Asn-linked carbohydrates (Hebert and Monsigny, 1993). Human malignant tumors, including invading esophageal carcinomas (Takano et al., 1990), metastasis of human breast cancer (Dennis et al., 1989b; Hiraizumi et al., 1992), the progression of colon and breast cancer (Fernandes et al., 1991), and malignant cells isolated from patients with Sezarry syndrome and colon cancer (Wojciechowicz et al., 1995; Derappe et al., 1996) have been shown to express increased levels of [beta]1-6 branching. A positive correlation between K-ras, increased [beta]1-6 branching, and increased ras GTP-level has been shown in pancreatic cancer cell lines (Schwarz et al., 1996). Baby hamster kidney cells transformed with Rous sarcoma virus or polyoma virus express higher levels of [beta]1-6 branching on Asn-linked oligosaccharides than untransformed cells (Takasaki et al., 1980; Yamashita et al., 1985; Pierce et al., 1986). Rat fibroblasts transfected with the cytoplasmic tyrosine kinase v-fps/fes and the activated GTPase T24 H-ras expressed increased [beta]1-6 branching which was associated with metastatic potential (Dennis et al., 1989a). Transfection with activated or proto-Ha-ras oncogenes in NIH3T3 fibroblasts was associated with an increase in [beta]1-6 branching and increased levels of GlcNAcT-V (Lu and Chaney, 1993).

The association between the expression of the malignant phenotype and elevated [beta]1-6 branched oligosaccharides has also been examined experimentally. Mutant cell lines which are reduced in levels of GlcNAcT-V and [beta]1-6 branching are reduced in the ability to form lung colonies following i.v. injection, but are not reduced in tumorigenic potential (Lu et al., 1994; Lu et al., unpublished observations). Cell lines with increased sensitivity to L-PHA and increased expression of sialylated tri- and tetra-antennary complex-type carbohydrates were enhanced in the metastatic potential of cells to form liver nodules following intravenous injection (Dennis et al., 1986). Similarly, cells treated with inhibitors of Asn-linked carbohydrate formation are reduced in metastatic potential, but not in tumorigenicity (Dennis, 1986b). These studies correlate the level of [beta]1-6 branching on complex oligosaccharides with metastatic potential.

Human trophoblast cells treated with swainsonine, a mannosidase II inhibitor that blocks complex carbohydrate formation, have a reduced ability to invade basement membranes (Yagel et al., 1990). Expression of GlcNAcT-V in an immortalized lung epithelial cell line resulted in loss of contact-inhibition of cell growth, a 50% increase in the incidence of benign tumors following injection into nude mice, and less adhesion on fibronectin- and collagen type IV-coated surfaces (Demetriou et al., 1995). Transfection of the highly metastatic cell line B16-hm with the gene encoding [beta]-1,4-N-acetylglucosaminyltransferase (GnT-III) decreased the level of [beta]1-6 branching through competition for substrate between GnT-V and exogenous GnT-III (Yoshimura et al., 1995). The selected clones with decreased binding to L-PHA were significantly decreased in the ability to form lung nodules in the experimental lung metastasis assay. These clones were also decreased in the ability to invade matrigel and attach to collagen and laminin.

In the present experiments, mouse mammary cancer cells were cotransfected with the cDNA for mouse GlcNAcT-V and pRSVneo. Geneticin-resistant cell lines with increased sensitivity to L-PHA were analyzed by serial lectin-affinity chromatography of biosynthetically labeled oligosaccharides and by Western blot analysis. Cell lines with increased [beta]1-6 branching and control cell lines were injected into the tail vein of syngenic Balb/c mice and metastatic potential ascertained. These cell lines were further analyzed for in vitro growth and extension of the [beta]1-6 branch.

Results

Derivation of transfected and control transfected cells

Three different mouse mammary carcinoma cell lines-168.1, 66.1, and 410.4 were transfected with the plasmid pCD1-GNT-V and/or pRSVneo using polybrene and DMSO. The first plasmid contained the murine cDNA for GlcNAcT-V, and the second plasmid contained the gene for resistance to neomycin. Cells transfected with both plasmids were selected for resistance to G-418 and then screened for increased sensitivity to L-PHA-mediated cytotoxicity. Three cell lines were isolated-168.1-TV.24, 66.1-TV.18, and 410.4-TV.84-which were increased in sensitivity to L-PHA. The TV designation designates these cell lines. Control cells were transfected with pRSVneo alone and were isolated for resistance to G-418. The control cell lines were designated 168.1-C1, 66.1-C2, and 410.4-C6 and also were analyzed for increased sensitivity to L-PHA.

Lectin-mediated cytotoxicity

Increases in the sensitivity to L-PHA-mediated cytotoxicity were observed in three pCD1-GNT-V transfected cells lines when compared with their control transfected counterparts (Table I). These values show relative changes but are only qualitative. No changes were observed in the sensitivity to Con-A, RIC, or WGA mediated cytotoxicity, supporting the conclusion that the increase in sensitivity to L-PHA mediated cytotoxicity is due to an elevation of [beta]1-6 branches on Asn-linked oligosaccharides in the transfected cell lines 168.1-TV.24, 66.1-TV.18, and 410.4-TV.84 and not an increased sensitivity to lectin-mediated cytotoxicity.

Table I. xperimental metastasis assay of transfected and control cell lines
Cell line L-PHA Con-A Ric WGA
168.1-C1* 12.5-25 50 6-1.25 6.25
168.1-TV.24 6.25 50 1.25 6.25
66.1-C2* 100 50 1.25 6.25
66.1-TV.18 25 50 1.25 6.25
410.4-C6* >200 50 1.25-2.5 3.12
410.4-TV.84 50-100 50 1.25-2.5 3.12
Cells growing in 96-well plates were incubated with serial dilutions of lectins and the concentration in µg/ml in which 10% of cells survived was determined. * Indicates control transfected cell lines. Theseexperiments were repeated in quadruplicate.

PCR analysis of cell lines

In order to rule out the possibility that the isolated L-PHA sensitive cell lines were naturally arising variants derived from the parental cell line, the transfected cell lines were screened for the presence of the transfected plasmid containing the murine GlcNAcT-V cDNA. PCR analysis of transfected cell lines was performed in order to demonstrate that the increase in [beta]1-6 branched structures on Asn-linked oligosaccharides was the result of insertion of the murine GlcNAcT-V cDNA into genomic DNA.

Primers specific for the transfected plasmid cDNA were designed and PCR analysis of transfected and control cell lines was performed. Using the PCR primers described in Materials and methods, the predicted fragment of 328 bp was observed in the transfected cell lines while it was absent in the control transfected cell lines (Figure 1). This indicated the presence of the exogenous murine GlcNAcT-V cDNA in the cell line genomes of 168.1-TV.24, 66.1-TV.18, and 410.4-TV.84, supporting the conclusion that the increase in [beta]1-6 branching was the result of the transcription of the murine GlcNAcT-V expression vector.


Figure 1. PCR analysis of transfected and control cell lines. PCR was performed using genomic DNA from transfected and control cell lines,as described in Materials and methods. Reactions were analyzed on a 1% agarose gel. Lanes: 1, 1 kb ladder; 2, 1 ng plasmid control, pCD1-mGNT-V; 3, 168.1C*; 4, 168.1-TV.24; 5, 66.1C2*; 6, 66.1-TV.18; 7, 410.4-C6*; 8, 410.4-TV.84. * Indicates control cell lines


Figure 2. Northern blots of transfected and control cell lines. Poly(A)+ RNA was prepared from transfected and control cell lines and was probed with a fragment of murine GlcNAcT-V (Blot A) and [beta]-actin (Blot B) cDNA, as described in Materials and methods. Lanes: 1, 168.-C1*; 2, 168.1-TV.24; 3, 66.1-C2*; 4, 66.1-TV.18; 5, 410.4-C6*; 6, 410.4-TV.84. * Indicates control transfected cell lines.

Northern blot analysis

To determine if the increase in [beta]1-6 branching is the result of an increase in GlcNAcT-V produced by the transcription of the transfected GlcNAcT-V expression vector, Northern blot analysis was performed. Poly(A)+RNA was isolated from cells and probed with a fragment of the murine GlcNAcT-V cDNA to analyze expression of GlcNAcT-V from the transfected L-PHA sensitive cell lines relative to control transfected cell lines. Cell lines transfected with the cDNA for GlcNAcT-V have a transcript at approximately 4.2 kb, the expected size of the exogenous transcript (Figure 2), though the exact sizes of endogenous murine transcripts are not known. Control transfected cell lines show no indication of this signal, even after lengthy exposure on the phosphoimager and adjustment of the background. These results indicated an increase of GlcNAcT-V message from the transfected expression vector is present, the result of which is increased [beta]1-6 branching.

Serial lectin-affinity column chromatography

Because the values for lectin-mediated cytoxicity reported above are not quantitative determinants, the transfected and control cell lines were further characterized by lectin-affinity column chroma-tographic analysis of cellular oligosaccharides. The percent change of [beta]1-6 branching on Asn-linked oligosaccharides was determined by metabolically labeling cells, purifying oligosaccharides from membrane proteins, and determining the percent of each fraction as a percent of the total radioactivity.

Oligosaccharides were labeled metabolically with 3H-glucosamine and analyzed by sequentially loading on lectin-affinity chromatography using immobilized Con-A, PL, and L-PHA bound to Sepharose. The percent of each type of bound oligosaccharide between the L-PHA sensitive cell lines, 168.1-TV.24, 66.1-TV.18, and 410.4-TV.84, was compared to the control transfected cell lines, 168.1-C1, 66.1-C2, and 410.4-C6 (Table II).

An increase from 25.4% to 43.2% of the total [beta]1-6 branched oligosaccharides in the cell lines 168.1-C1 and 168.1-TV.24 was seen. This represents an increase of 70% in the L-PHA sensitive cell line, 168.1-TV.24. A 40% increase in the amount of [beta]1-6 branching between 66.1-TV.18 and 66.1C2 was observed. The cell line 410.4-TV.84 was increased in [beta]1-6 branching by 90% over that of its control cell line, 410.4-C6, as determined by lectin-affinity chromatography. Thus the cell lines increased in L-PHA cytotoxicity were increased 40-90% in the amount of [beta]1-6 branching on Asn-linked oligosaccharides, as determined by lectin-affinity column chromatography.

Western blots

One possible explanation for the observed increase in L-PHA cytotoxicity is an increase in the expression of only a few glycoproteins containing [beta]1-6 branched, Asn-linked oligosaccharides. To determine whether the amount of specific glycoproteins was increased, or whether a general increase in the amount of [beta]1-6 branching or other carbohydrate structure occurred on all membrane glycoproteins, membrane glycoproteins were analyzed.

Membrane proteins were isolated and purified by SDS-PAGE, electrotransferred to Immobilon, and probed with either biotinylated L-PHA, DSA, or WGA (Figure 3a-c). The results show a general increase in binding of biotinylated L-PHA to membrane protein in the transfected L-PHA sensitive cell lines 168.1-TV.24, 66.1-TV.18, and 410.4-TV.84 relative to control transfected cell lines 168.1-C1, 66.1-C2, and 410.4-C6.

Membrane proteins were probed with DSA and WGA, lectins specific for sialic acid and repeating lactosamine units, respectively (Figure 3b-c). Unlike the increase in L-PHA binding in all transfected, L-PHA sensitive cell lines, DSA and WGA binding was not specifically increased in transfected cell lines relative to control transfected cell lines, though there is an increase in DSA and WGA binding in 410.4-TV.84 relative to its control, 410.4-C6. This suggests an increase in sialylation and polyN-acetyllactosamine extension in 410.4-TV.84, results consistent with increased [beta]1-6 branching.

Experimental metastasis assay

To test the hypothesis that an increase in [beta]1-6 branching will increase metastatic potential, transfected and control transfected cell lines were injected into the tail vein of mice. Mice were sacrificed after 3 weeks, and lung nodules were counted. An increase in lung nodule formation was observed in transfected cell lines with increased [beta]1-6 branching in comparison with control transfected cell lines (Table III). In two independent experiments a 4- to 40-fold increase in lung tumors was observed in the cells expressing elevated [beta]1-6 branched oligosaccharides compared to their control transfected counterparts.

Discussion

Metastasis is a multistep process involving increased growth, changes in adhesion, invasion, blood-born survival, extravasation, angiogenesis, and other phenotypes for the successful dissemination of the primary tumor to secondary organ sites (Fidler, 1990). Previous studies have shown a direct correlation between [beta]1-6 branching and the ability to metastasize in experimental assay systems (Dennis et al., 1987), as well as increased expression of [beta]1-6 branching associated with human tumor progression and oncogenic transformation of cells (Takasaki et al., 1980; Fernandes et al., 1991). These experiments have not directly demonstrated that an increase in [beta]1-6 branching alone results in increased metastatic potential.

   a
   b
   c

Figure 3. Lectin blots of prepared membranes from transfected and controlcell lines. Fifty micrograms of prepared membranes was used in a 5-14% polyacrylaminde reducing gel, transferred to Immobilon, and probed with biotinylated lectins, as described in Materials and methods. (A) L-PHA, (B) WGA, and (C) DSA. Lanes: 1, 168.1-C1*; 2, 168.1-TV.24; 3, 66.1-C2*; 4, 66.1-TV.18; 5, 410.4-C6*; 6, 410.4-TV.84. * Indicates control cell lines.

Table II. Relative kinetic parameters of nine I-CeuI variant enzymes synthesized in vitro
Cell line 168.1-C1* TV.24 66.1-C2* TV.18 1.80-C6* TV.84
Column peak            
Con-A-BdI 10.1 16.2 19.9 3.7 21.6 0.4
Con-A-BdII 19.0 11.8 11.9 4.7 19.2 1.2
PL 0 0 4.2 1.7 0 0.7
L-PHAt 45.0 28.8 46.9 61.9 47.6 76.1
L-PHAr 25.9 43.2 17.1 27.9 11.6 21.1
%[beta]1-6 structures 25.4 43.2 21.3 29.8 11.6 21.8
The transfected, L-PHA sensitive cell lines are denoted by TV. Asn-linked oligosaccharides from both transfected and control cell lines were radiolabeled, purified, and applied sequentially to lectin affinity columns, as described in Materials and methods. Con A-BdI denotes high mannose oligosaccharides eluted with [alpha]-methylglucoside. Con A-BdII denotes high mannose oligosaccharides eluted with [alpha]-methylmannoside. PL denotes [beta]1-6 branched oligosaccharides containing a core fucose. L-PHAt denotes oligosaccharides in the through fraction. L-PHAr denotes oligosaccharides retarded on the column. %[beta]1-6 structures is the sum of the PL and L-PHAr fractions. * Indicates control cell lines. These experiments were performed in duplicate with similar results.

The recent cloning of the GlcNAcT-V cDNA (Shoreibah et al., 1993; Saito et al., 1994) permits the specific alteration of GlcNAcT-V expression in cells and the study of that change on the phenotype of those cells. The rat GlcNAcT-V cDNA has been transfected into non-metastatic, premalignant mink lung epithelial cells (Demetriou et al., 1995). Nontransformed cell lines with increased expression of GlcNAcT-V were significantly reduced in serum-growth requirements, migrated more rapidly into scratch wounds, and were less adhesive to fibronectin- and collagen type IV-coated plastic. These results indicated that an increase in [beta]1-6 branching has a role in the loss of contact-inhibition of cell growth in nontransformed cells.

The present experiments show that an increase in [beta]1-6 branching by transfection of an expression vector containing GlcNAc-T V cDNA into metastatic and transformed cells directly increases metastatic potential. This increase has been shown in three different cell lines syngenic to Balb/c mice with increases of 4- to 40-fold in metastatic potential relative to control transfected cell lines.

These transfected cell lines with increased [beta]1-6 branching are not cell lines which were cloned and then found to be increased in [beta]1-6 structures. PCR analysis, which uses a 3[prime] primer to the T7 promoter of the GlcNAcT-V cDNA, shows the 328 bp product specific for the transfected plasmid only in the transfected cell lines (Figure 1). This shows that the transfected cell lines contain an exogenous GlcNAcT-V gene specific for the transfected cDNA. Furthermore, increased expression of the GlcNAcT-V cDNA was detected by Northern blot analysis in transfected cell lines and not in controls (Figure 2).

The transfected and control cell lines were tested for changes in in vitro growth rate, but no difference was seen (data not shown). This result is consistent with other reports in which no changes in in vitro growth rates were observed in cells expressing increased [beta]1-6 branching (Yoshimura et al., 1995; Derappe et al., 1996). There may be differences in in vivo growth rates or responsiveness to conditioned media, however (Vander Elst and Dennis, 1991).

One putative effect of increased [beta]1-6 branching of cell-surface Asn-linked carbohydrates on cells is adhesion (Olden, 1993). Both first trimester human trophoblasts and metastatic, oncogene transfected cells treated with swainsonine, which inhibits the formation of [beta]1-6 branching and other complex oligosaccharides, were less adhesive to amnion membranes (Yagel et al., 1990, 1989). Mv1Lu cells transfected with an expression construct for GlcNAcT-V and expressing increased [beta]1-6 structures were less adhesive to fibronectin- and collagen type IV-coated plastic (Demetriou et al., 1995).

In experiments performed in our laboratory (results not shown), transfected cells were tested for the ability to adhere to laminin-, collagen IV-, and fibronectin-coated plastic. No significant difference nor trend in the ability of cells expressing increased amounts of [beta]1-6 structures vs. control cells was found at any concentration or time for adherence to these molecules. These results suggest that the increase in experimental metastasis is not the result of changes in adhesion to fibronectin, collagen IV, or laminin.

A frequent change associated with increased [beta]1-6 branching is increased polylactosamine and sialic acid content. Both of these changes have been implicated in the transformation and metastasis of cells (Dennis, 1986; Pierce and Arango, 1986; Yousefi et al., 1991). In human breast cancer, tri- and tetra-antennary branching structures from normal mammary gland, primary carcinoma, and axillary lymph node metastasis were shown to contain both [beta]1-6 branches with increased and unchanged amounts of N-acetylglucosamine repeating units on the metastases (Hiraizumi et al., 1992).

Figure 1a clearly shows an increase in [beta]1-6 branching in the transfected cell lines as analyzed by L-PHA binding. However, a specific increase is not observed in the polyN-acetyllactosamine or sialic acid content, as determined by DSA or WGA binding to membrane proteins purified from transfected cell lines relative to control cell lines (Figure 3b-c). However, an increase in WGA and DSA binding to membrane proteins from cell line 410.4-TV.84 relative to the control transfected cell line 410.4-C6 can be seen (Figure 3b-c).

Table III. . Relative kinetic parameters of nine I-CeuI variant enzymes synthesized in vitro
Cell line Tumors Average tumor number
First experiment
168.1-C1* 1, 0, 0, 1, 2, 3, 2, 2 1 ± 1
168.1-TV.24 95, 103, 74, 68, 88, 121, 136, 117 100 ± 37#
66.1-C2* 74, 1, 37, 36, 20, 29, 23, 44 33 ± 21
66.1-TV.18 135, 143, 154, 78, 86, 110, 162, 98 121 ± 32#
410.4-C6* 8, 1, 2, 5, 2, 4, 2, 3 4 ± 2
410.4-TV.84 130, 164, 182, 193, 151, 142, 194, 138 182 ± 25#
Second experiment
168.1-C1* 2, 1, 0, 2, 1, 0, 0 1 ± 1
168.1-TV.24 111, 28, 65, 60, 50, 33, 21 53 ± 31#
66.1-C2* 30, 28, 41, 32, 26, 33, 36, 29 32 ± 5
66.1-TV18 136, 125, 129, 96, 89, 123, 135 119 ± 19#
410.4-C6* 4, 3, 1, 2, 3, 1, 4, 5 3 ± 1.5
410.4-TV.84 96, 93, 107, 81, 106, 92, 80, 82 92 ± 11#
Cells were injected into female syngenic Balb/c mice; the mice were sacrificed after 3 weeks, and the lungs were removed, as described in Materials and methods. The number of tumors on the lung surface was counted and the average determined. *, Control cell lines. #, P < 0.002 by nonparametric long-rank analysis.

These data show that the increase in [beta]1-6 branching by increased GlcNAcT-V expression did not lead in two cell lines to increased modification with repeating units of N-acetylglucosamine and galactose in two of the transfected and L-PHA sensitive cell lines, 168.1-TV.24 and 66.1-TV.18. One modification shown to effect fibronectin binding in vitro is the extension of polyN-acetyllactosamine on fibronectin (Zhu et al., 1984; Zhu and Laine, 1985). Human placental fibronectin containing polylactosamine carbohydrates has weakened binding affinity to gelatin and contains several protease-resistant domains. This suggests that the possible lack of change in adhesion of the cells to collagen IV, fibronectin, and laminin may be the result of no or little increase in the amount of poly-N-acetyllactosamine and sialic acid. A second possibility for the lack of change in adhesion is that no further alteration in adhesion of these cells is possible, regardless of the increase and change of the carbohydrates. However, the metastasis results and Western blots from the three different cell lines and control cell lines demonstrate that an increase in [beta]1-6 branching without increasing sialic acid or polylactosamine content will nonetheless increase experimental metastatic potential.

Experiments with glycosylation inhibitors and mutant cell lines have shown a relationship between Asn-linked carbohydrates and invasive potential. Treatment with nontoxic concentrations of swainsonine of first trimester human trophoblasts and metastatic melanoma cells inhibited basement membrane invasion (Seftor et al., 1991; Korczak and Dennis, 1993). At the level of gene expression, glycosylation mutants and cells treated with swainsonine are increased in the transcription of tissue inhibitor of metallo-proteinases (TIMP).

Changes in invasion were observed, though not highly significant, in in vitro invasion assays (data not shown). Of the three transfected cell lines, two-66.1-TV.18 and 410.4-TV.84-were derived from in vivo invasive cell lines. Both showed an increase in in vitro invasive potential relative to control cell lines, with the largest increase in invasion in cell line 410.4-TV.84 (p < 0.08). This cell line also has the largest relative increase in [beta]1-6 branching and increases in extension of polylactosamine units. This result suggests that increased [beta]1-6 branching increases invasive potential in already invasive cells. The large increase in metastasis of the noninvasive cell line 168.1-TV.24 would support the conclusion that the increase in metastatic potential in this cell line is the result of other mechanisms rather than an increase in invasive ability as measured by in vitro assays.

The results presented demonstrate that specific increases in [beta]1-6 branched Asn-linked oligosaccharide structures will increase experimental metastasis in transformed mouse mammary adenocarcinoma cells. However, the mechanism by which altering [beta]1-6 branched oligosaccharide levels can affect the metastatic potential of these cells is not clear. This increase does not appear to be the result of a single in vitro increase in (1) invasiveness; (2) adhesion to fibronectin, laminin, or collagen IV; (3) growth rate; or (4) polylactosamine expression. Further work will be required to understand the mechanism by which changes in [beta]1-6 branching structures effect the metastatic potential of cells.

Materials and methods

Cell lines, lectins, animals, culture media, and plasmids

Mouse mammary cancer cell lines were obtained from G. Heppner (Karamanos Cancer Foundation, Detroit, MI) (Dexter et al., 1978). The lectins concanavalin (Con-A), wheat germ agglutinin (WGA), Ricinus communis agglutinin II (Ric), Datura stramonium lectin (DSA), and Phaseolus vulgaris agglutinin (L-PHA), as well as lectin-conjugated to agarose, were purchased from Vector Laboratories, Inc. (Burlingame, CA). Female Balb/C mice were purchased from Charles River (Wilmington, MA). Waymouth's media was purchased from Life Technologies Laboratories (Gaithersburg, MS). Calf bovine serum was purchased from Hyclone Laboratories, Inc. (Logan, UT).

The murine cDNA for GlcNAcT-V in pCD1-mGNT-V was kindly provided by N. Fregien (University of Miami, Miami, FL). This plasmid contains the 2.3 kb ORF of murine cDNA for GlcNAcT-V and ~1.0 kb of untranslated message in the eukaryotic expression vector pCDNA1 (Invitrogen, San Diego, CA). A second polyA+ tail is 3[prime] of the GlcNAcT-V insert, with expression driven by the CMV promoter.

All plasmids were purified by large scale purification from transformed DH5[alpha]-sur cells using Tip-500 columns and standard procedures (Qiagen, Inc. Chatsworth, CA). Mouse mammary cancer cell lines were obtained following transfection using the polybrene/DMSO shock method (Chaney et al., 1986) and selection in 1 mg/ml G-418 (Life Technologies, Gaithersburg, MD).

Lectin-mediated cytotoxicity assay

Sensitivity to plant lectins was performed as described previously (Stanley, 1983). Cells were trypsinized, washed, resuspended, counted, and plated at 4 × 103 cells/well in 96-well plates in 0.1 ml of Waymouth's media containing 10% bovine calf serum and 1% penicillin G, 1% streptomycin, and 1% glutamine (Life Technologies, Gaithersburg, MD). Cells were incubated overnight at 37°C and increasing concentrations of lectins were added in 0.1 ml of media. The cells were grown until control wells receiving no lectin were confluent and the cells were stained with 0.2% methylene blue in 50% methanol. The concentration of lectin which gave 10% survival of cells was then determined. The stability of the lectin mediated cytotoxicity profile of cell lines was confirmed throughout the course of this study.

PCR analysis

Genomic DNA was prepared from confluent cell cultures. Cells were lysed and placed in a rotating oven at 55°C for 2 h in 1 ml of 0.1 M NaCl, 0.05 M Tris, pH 7.5, 25 mM EDTA, pH 7.5, 1.0% SDS, and 0.5 mg Proteinase K (Life Technologies, Gaithersburg, MD). Genomic DNA was extracted with phenol/chloroform, ethanol precipitated, dried, and resuspended in TE (10 mM Tris-CL, 1 mM EDTA, pH 7.4) and 10 mM NaCl. Concentrations were determined by agarose gel electrophoresis and spectrophotometrically at an absorbency of 260 nm.

PCR reactions were performed in 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2 mM MgCl2 using 2 µg of genomic DNA or 1 ng of pCD1-mGNT-V, 50 pmol of primers, and 2.5 U of Taq polymerase (Life Technologies, Gaithersburg, MD). PCR was performed with 35 cycles at 94°C, 1 min, 50°C, 1 min, and 72°C, 1.5 min, following 94°C, 5 min and ending with a final extension time of 10 min, 72°C and a 4°C soak.

The 5[prime]-primer TAATACGACTCACTATAGGGCG corresponds to the T7 primer site of pCDNA1 (Invitrogen Corporation, San Diego, CA). The 3[prime]-primer GGCGAGCGTTTTCTTCAGATCAT (IDT, Inc., Coralville, IA) corresponds to the nucleotide 239 bp 3[prime] of the ATG start codon of the mouse GlcNAcT-V cDNA. Reactions were analyzed on a 1% agarose gel using 10 µl of reaction product.

Serial lectin-affinity column chromatography

Asn-linked oligosaccharides were labeled by the addition of Waymouth's media containing 100 µCi [3H]glucosamine (ICN Biochemical, Cosat, CA) and 10% dialyzed fetal calf serum to cell lines at 30% confluence. The cells were grown until 90% confluent and washed three times with 0.02 M phosphate, 0.15 M NaCl, pH 7.2 (PBS) buffer, lysed with 1% Triton-X-100, and centrifuged for 5 min at 650 × g. The supernatant was adjusted to 50 mM Tris-HCl and 1 mg/ml pronase (Boehringer Mannheim Corp., Indianapolis, IN). The pH was adjusted to 8.5, two drops of toluene were added, and the digestion was incubated at 55°C for 24 h. A second aliquot of pronase was added to 1 mg/ml for a second 24 h incubation.

The sample was heated for 10 min at 100°C and then centrifuged for 10 min at 650 × g. The supernatant fraction was collected, desalted on a Bio-gel P2 column (1.5-30 cm), and the peak fraction was saved, lyophilized, and resuspended in Con-A buffer (0.1 M NaAcetate, 1.0 M NaCl, 0.01 M McCl2, 0.01 M CaCl2, 0.01 M MnCl2, 0.02% NaN3). The glycoconjugates were applied to a column of Con-A-agarose (1 × 10cm) and washed with Con-A buffer (Con-A-T). The bound glycoconjugates were eluted with 10 mM [alpha]-methylglucoside in Con-A buffer (Con-A-B(I)) followed by 200 mM [alpha]-methylmannoside in ConA buffer (Con-A-B(II)). The ConA-T fractions were applied to a PL-agarose column (1 × 10cm) and washed with Con-A buffer (Con-A-T/PL-T) and bound materials eluted with 200 mM [alpha]-methylmannoside in Con-A buffer (Con-A-T/PL-B). The Con-A-T/PL-T glycoconjugates were desalted on a P2 column and loaded on to a column of L-PHA-agarose (1.2 × 15cm) in PBS buffer and eluted with PBS buffer to give Con-A-T/PL-T/L-PHA-T and Con-A-T/PL-T/L-PHA-B (Pierce and Arango, 1986).

Northern blot analysis

Total RNA was isolated from confluent cells using Triazol Reagent (Chomczynski and Sacchi, 1987). Five micrograms of polyA+ RNA (Collaborative Research, Inc., Lexington, MA) was subjected to electrophoresis in a 1.2% agarose, 6% formaldehyde gel and blotted to GeneScreen membrane (NEN Research Products, Boston, MA). A HindIII-XhoI fragment of a plasmid containing the murine GlcNAcT-V cDNA and a KpnI-XbaI fragment from the murine [beta]-actin cDNA (Ambion, Inc., Austin, TX) were radiolabeled using the random primer method (Amersham, Arlington, IL) and used as probes. The blot was hybridized at 55°C for 2 days in Church hybridization buffer (Church and Gilbert, 1984) washed twice at 45°C in 1 × SSC, 1% SDS, and developed for 9 days on a phosphoimager (Molecular Dynamics, Menlo Park, CA).

Western blot protocol

Cell membrane preparations were prepared according to the method of Massague and Czech (Massague and Czech, 1982) and the concentration determined using a Micro BCA Protein Assay Reagent Kit (Pierce, Rockford, IL). The 50 µg of membrane proteins were heated to 95°C for 5 min and placed on a reducing, 5-14% polyacrylamide gradient gel (Laemmli, 1970). Following electrophoresis, proteins were transferred to Immobilon (Millipore, Bedford, MA) by electrotransfer. The Immobilon blot was blocked with 5% BSA in TBS (50 mM Tris, 0.1% BSA, 0.025% Tween-20) and probed with biotinylated L-PHA (Vector Laboratories, Inc., Burlingame, CA) at a dilution of 1:500 in TBT for 2 h The blot was washed with TBT and developed with 0.006% NBT and 0.003% BCIP in 0.1 M NaHCO3. Similar blots were also probed with WGA (1:1000) and DSA (1:500).

Experimental metastasis assay

Transfected and control cells were isolated as described above. Cells (2.5 × 105 cells of 168.1-TV.24 and 168.1-C1 and 1.0 × 105 cells of 66.1-TV.18, 66.1-C2, 410.4-TV.84, and 410.4-C6) were resuspended in 0.1 ml PBS and injected into the tail veins of 8-10 week old female Balb/c mice. The mice were sacrificed after 3 weeks, the lungs were removed and fixed in Bouin's solution, and the surface tumors counted visually.

Acknowledgments

This research was supported by NIH Grant CA47980, the State of Nebraska, the Bessie Parker Fund, and the generous gift of the GlcNAcT-V expression vector from Nevis Fregien.

Abbreviations

GlcNAcT-V, N-acetylglucosaminyltransferase V, L-PHA, Phaseolus vulgaris agglutinin, Ric, Ricinus communisagglutinin II, Con-A, concanavalin A, WGA, wheat germ agglutinin, DSA, Datura stramonium lectin, PL, Pisum sativum lectin, PBS, phosphate-buffered saline, PCR, polymerase chain reaction.

References

Chaney ,W.G., Howard,D.R., Pollard,J.W., Sallustio,S. and Stanley,P. (1986) High-frequency transfection of CHO cells using polybrene. Somatic Cell Mol. Genet., 12, 237-244. MEDLINE Abstract

Chomcznski ,P. and Sacchi,N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159. MEDLINE Abstract

Church ,G.M. and Gilbert,W. (1984) Genomic sequencing. Proc. Natl. Acad. Sci. USA, 81, 1991-1995. MEDLINE Abstract

Cummings ,R.D., Trowbridge,I.S. and Kornfeld,S. (1982) A mouse lymphoma cell line resistant to the leukoagglutinating lectin from Phaseolus vulgaris is deficient in UDP-GlcNAc:[alpha]-d-mannoside [beta]1,6 N-acetylglucosaminyltrasnferase.J. Biol. Chem., 257, 13421-13427. MEDLINE Abstract

Demetriou ,M., Nabi,I.R., Coppolino,M., Dedhar,S. and Dennis,J.W. (1995) Reduced contact-inhibition and substratum adhesion in epithelial cells expressing GlcNAc-transferase V. J. Cell Biol., 130, 383-392. MEDLINE Abstract

Dennis ,J.W. (1986) Effects of swainsonine and polyinosinic:polycytidylic acid on murine tumor cell growth and metastasis.Cancer Res., 46, 5131-5136. MEDLINE Abstract

Dennis ,J.W., Kosh,D., Bryce,D.M. and Brietman,M.L. (1989a) Oncogenesconferring metastatic potential induce increased branching of Asn-linked oligosaccharides in Rat2 fibroblasts. Oncogene, 4, 853-860.

Dennis ,J.W. and Laferte,S. (1989) Oncodevelopmental expression of -GlcNAc[beta]1-6Man[alpha]1-6Man[beta]1-branched asparagine linked oligosaccharides in murine tissues and human breast carcinomas. Cancer Res., 49, 945-950. MEDLINE Abstract

Dennis ,J.W., Laferte,S., Fukuda,M., Dell,A. and Carver,J.P. (1986) Asn-linked oligosaccharides in lectin-resistant tumor-cell mutants with varying metastatic potential. Eur. J. Biochem., 161, 359-373. MEDLINE Abstract

Dennis ,J.W., Laferte,S. and Vanderelst,I. (1989b) Asparagine-linked oligo-saccharides in malignant tumor growth. Biochem. Soc. Trans., 17, 29-31.

Dennis ,J.W., Laferte,S., Wagnorne,C., Breitman,M.L. and Kerbel,R.S. (1987) [beta]1-6 branching of Asn-linked oligosaccharides is directly associated with metastasis. Science, 236, 582-585. MEDLINE Abstract

Derappe ,C., Haentjens,G., Lemaire,S., Feugeas,J.P., Lebbe,C., Bussel,A., Auber,M. and Nell,D. (1996) Circulating malignant lymphocytes from Sezary syndrome express high levels of glycoproteins carrying [beta](1-6)N-acetylglucosamine-branched N-linked oligosaccharides. Leukemia, 10, 138-141. MEDLINE Abstract

Dexter ,D., Kowalski,H.M., Blazar,B.A., Fligiel,Z., Vogel,R. and Heppner, G. (1978) Heterogeneity of tumor cells from a single mouse mammary tumor. Cancer Res., 38, 3174-3181. MEDLINE Abstract

Fernandes ,B., Sagman,U., Auger,M., Demetrio,M. and Dennis,J.W. (1991) [beta]1-6 branched oligosaccharides as a marker of tumor progression in human breast and colon neoplasia. Cancer Res., 51, 718-723. MEDLINE Abstract

Fidler ,I.J. (1990) Critical factors in the biology of human cancer metastasis: twenty-eighth G.H.A. Clowes memorial award lecture. Cancer Res., 50, 6130-6138. MEDLINE Abstract

Hebert ,E. and Monsigny,M. (1993) Oncogenes and expression of endogenous lectins and glycoconjugates. Biol. Cell, 79, 97-109. MEDLINE Abstract

Hiraizumi ,S., Takasaki,S., Ohuchi,N., Harada,Y., Nose,M., Mori,S. and Kobata, A. (1992) Altered glycosylation of membrane glycoproteins associated with human mammary carcinoma. Jpn. J. Cancer Res., 83, 1063-1072. MEDLINE Abstract

Korczak ,B. and Dennis,J.W. (1993) Inhibition of N-linked oligosaccharide processing in tumor cells is associated with enhanced tissue inhibitor of matalloproteinases (TIMP) gene expression. Int. J. Cancer, 53, 634-639. MEDLINE Abstract

Kornfeld ,R. and Kornfeld,S. (1985) Assembly of asparagine-linked oligosaccharides. Annu. Rev.Biochem., 54, 631-664. MEDLINE Abstract

Laemmli ,U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685. MEDLINE Abstract

Lu ,Y. and Chaney,W. (1993) Induction of N-acetylglucosaminyltransferase V by elevated expression of activated or proto-Ha-ras oncogenes. Mol. Cell. Biochem., 122, 85-92. MEDLINE Abstract

Lu ,Y., Pelling,J.C. and Chaney,W.G. (1994) Tumor cell surface [beta]1-6 branched oligosaccharides and lung metastasis. Clin. Exp. Metastasis, 12, 47-54. MEDLINE Abstract

Opdenakker ,G., Rudd,P.M., Ponting,C.P. and Dwek,R.A. (1993) Concepts and principles of glycobiology. FASEB J., 7, 1330-1337. MEDLINE Abstract

Massague ,J. and Czech,M.P. (1982) The subunit structures of two distinct receptors for insulin-like growth factors I and II and their relationship to the insulin receptor. J. Biol. Chem., 257, 5038-5045. MEDLINE Abstract

Olden ,K. (1993) Adhesion molecules and inhibitors of glycosylation in cancer. Semin. Can. Biol., 4, 269-276.

Pierce ,M. and Arango,J. (1986) Rous sarcoma virus-transformed baby hamster kidney cells express higher levels of asparagine-linked tri- and tetraantennary glycopeptides containing [GlcNAc-[beta](1,6)Man-[alpha](1,6)man] and poly-N-acetyllactosamine sequences than baby hamster kidney cells. J. Biol. Chem., 261, 10772-10777. MEDLINE Abstract

Saito ,H., Nishikawa,A., Gu,J., Ihara,Y., Soejima,H., Wada,Y., Sekiya, C., Niikawa,N. and Taniguchi,N. (1994) cDNA cloning and chromosomal mapping of human N-acetylglucosaminyltransferase V. Biochem. Biophys. Res. Commun., 198, 318-327. MEDLINE Abstract

Schwarz ,R.E., Wojciechowicz,D.C., Park,P.Y. and Paty,P.B. (1996) Phytohemagglutinin-L (PHA-L) lectin surface binding of N-linked [beta]1-6 carbohydrate and its relationship to activated mutant Ras in human pancreatic cancer cell lines. Cancer Lett., 107, 285-291. MEDLINE Abstract

Seftor ,R.E., Seftor,E.A., Grimes,W.J., Liotta,L.A., Stetler-Stevenson,W.G., Welch,D.R. and Hendrix,M.J.C. (1991) Human melanoma cell invasion is inhibited in vitro by swainsonine and deoxymannojirmycin with a concomitant decrease in collagenase IV expression. Mel. Res., 1, 43-54.

Shoreibah ,M., Perng,G.S., Adler,J., Weinstein,J., Basu,R., Cupples,R., Wen,D., Browne,J.K., Bucklaults,P., Freigien,N. and Pierce, M. (1993) Isolation, characterization, and expression of a cDNA encoding N-acetylglucosaminyltransferase V. J. Biol. Chem., 268, 15381-15385. MEDLINE Abstract

Stanley ,P. (1983) Selection of lectin-resistant mutants of animal cells. Methods Enzymol., 96, 157-184. MEDLINE Abstract

Takano ,R., Nose,M., Nishihira,T. and Kyogoku,M. (1990) Increase of [beta]1-6 branched oligosaccharides in human esophageal carcinomas invasive against surrounding tissue in vivo and in vitro. Am. J. Pathol., 137, 1007-1011. MEDLINE Abstract

Takasaki ,S., Ikehira,H. and Kobata,A. (1980) Increase of asparagine-linked oligosaccharides with branched outer chains caused by cell transformation. Biochem. Biophys. Res. Commun., 92, 735-742. MEDLINE Abstract

VanderElst ,I. and Dennis,J.W. (1991) N-Linked oligosaccharide processing and autocrine stimulation of tumor cell proliferation. Exp. Cell Res., 192, 612-621. MEDLINE Abstract

Wojciechowicz ,D.C., Park,P.Y. and Paty,P.B. (1995) [beta]1-6 branching of N-linked carbohydrates is associated with K-RAS mutation in human colon carcinoma cell lines. Biochem. Biophys. Res. Commun., 212, 758-766. MEDLINE Abstract

Yagel ,S., Feinmesser,R., Waghorne,C., Lala,P.K., Breitman,M.L. and Dennis,J.W. (1989) Evidence that [beta]1-6 branched Asn-linked oligosaccharides on metastatic tumor cells facilitate invasion of basement membranes. Int. J. Cancer, 44, 685-690.

Yagel ,S., Kerbel,R., Lala,P., Eldar-Gera,T. and Dennis,J.W. (1990) Basement membrane invasion by first trimester human trophoblast: requirement for branched complex-type Asn-linked oligosaccharides. Clin. Exp. Metastasis, 8, 305-317. MEDLINE Abstract

Yamashita ,K., Tachibana,Y., Ohkura,T. and Kobata,A., (1985) Enzymatic basis for the structural changes of asparagine-linked sugar chains of membrane glycoproteins of baby hamster kidney cells induced by polyoma transformation. J. Biol. Chem., 260, 3963-3939.

Yamashita ,K., Totani,K., Ohkura,T., Takasaki,S., Goldstein,I.J. and Kobata,A. (1987) Carbohydrate binding properties of complex-type oligosaccharides on immobilized Datura stamonium lectin. J. Biol. Chem., 262, 1602-1607. MEDLINE Abstract

Yoshimura ,M., Hishikawa,A., Ihara,Y., Taniguchi,S. and Taniguchi,N. (1995) Suppression of lung metastasis of B16 mouse melanoma by N-acetylglucosaminyltransferase III gene transfection. Proc. Natl. Acad. Sci. USA, 92, 8754-8758. MEDLINE Abstract

Yousefi ,S., Higgins,E., Daoling,Z., Pollex-Kruger,A., Hindsgaul,O. andDennis,J.W. (1991) Increased UDP-GlcNAc:Gal[beta]1-3BalNAc-R (GlcNAc to GalNac) [beta]-1,6-N-acetylgulcosaminyltransferase activity in metastatic murine tumor cell lines. J. Biol. Chem., 266, 1772-1782.

Zhu ,B.C., Fisher,S.F., Pande,H., Calaycay,J., Shively,J.E. and Laine, R.A. (1984) Human placental (fetal) fibronectin: increased glycosylation and higher protease resistance than plasma fibronectin. J. Biol. Chem., 259, 3962-3970. MEDLINE Abstract

Zhu ,B.C. and Laine,R.A. (1985) Polylactosamine glycosylation on human fetal placental fibronectin weakens the binding affinity of fibronectin to gelatin.J. Biol. Chem., 260, 4041-4045.


1To whom correspondence should be addressed


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 19 Feb 1999
Copyright©Oxford University Press, 1999.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Zhao, T. Nakagawa, S. Itoh, K.-i. Inamori, T. Isaji, Y. Kariya, A. Kondo, E. Miyoshi, K. Miyazaki, N. Kawasaki, et al.
N-Acetylglucosaminyltransferase III Antagonizes the Effect of N-Acetylglucosaminyltransferase V on {alpha}3beta1 Integrin-mediated Cell Migration
J. Biol. Chem., October 27, 2006; 281(43): 32122 - 32130.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-B. Guo, I. Lee, M. Kamar, and M. Pierce
N-Acetylglucosaminyltransferase V Expression Levels Regulate Cadherin-associated Homotypic Cell-Cell Adhesion and Intracellular Signaling Pathways
J. Biol. Chem., December 26, 2003; 278(52): 52412 - 52424.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H.-B. Guo, I. Lee, M. Kamar, S. K. Akiyama, and M. Pierce
Aberrant N-Glycosylation of {beta}1 Integrin Causes Reduced {alpha}5{beta}1 Integrin Clustering and Stimulates Cell Migration
Cancer Res., December 1, 2002; 62(23): 6837 - 6845.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ihara, E. Miyoshi, J. H. Ko, K. Murata, S. Nakahara, K. Honke, R. B. Dickson, C.-Y. Lin, and N. Taniguchi
Prometastatic Effect of N-Acetylglucosaminyltransferase V Is Due to Modification and Stabilization of Active Matriptase by Adding beta 1-6 GlcNAc Branching
J. Biol. Chem., May 3, 2002; 277(19): 16960 - 16967.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Skinner and A. G. Wildeman
Suppression of Tumor-related Glycosylation of Cell Surface Receptors by the 16-kDa Membrane Subunit of Vacuolar H+-ATPase
J. Biol. Chem., December 14, 2001; 276(51): 48451 - 48457.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Murata, E. Miyoshi, M. Kameyama, O. Ishikawa, T. Kabuto, Y. Sasaki, M. Hiratsuka, H. Ohigashi, S. Ishiguro, S. Ito, et al.
Expression of N-Acetylglucosaminyltransferase V in Colorectal Cancer Correlates with Metastasis and Poor Prognosis
Clin. Cancer Res., May 1, 2000; 6(5): 1772 - 1777.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Sasai, Y. Ikeda, T. Tsuda, H. Ihara, H. Korekane, K. Shiota, and N. Taniguchi
The Critical Role of the Stem Region as a Functional Domain Responsible for the Oligomerization and Golgi Localization of N-Acetylglucosaminyltransferase V. THE INVOLVEMENT OF A DOMAIN HOMOPHILIC INTERACTION
J. Biol. Chem., January 5, 2001; 276(1): 759 - 765.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (32)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Seberger, P. J.
Right arrow Articles by Chaney, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seberger, P. J.
Right arrow Articles by Chaney, W. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?