Glycobiology, 1999, Vol. 9, No. 12 1397-1406
© 1999 Oxford University Press
Article |
The relationship between ST6Gal I Golgi retention and its cleavage-secretion
3 Department of Biochemistry and Molecular Biology, University of Illinois at Chicago, College of Medicine, Chicago, IL 60612, USA, 4 Department of Biomolecular Characterization, and 5 Molecular Glycobiology, Frontier Research Program, the Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 3510198, Japan
Received on April 28, 1999; revised on June 28, 1999; accepted on June 28, 1999
| Abstract |
|---|
|
|
|---|
The ST6Gal I is a sialyltransferase that modifies N-linked oligosaccharides of glycoproteins. Previous results suggested a role for luminal stem and active domain sequences in the efficiency of ST6Gal I Golgi retention. Characterization of a series of STtyr isoform deletion mutants demonstrated that the stem is sensitive to proteases and that preventing cleavage in this region leads to increased cell surface expression. A mutant lacking amino acids 32104 (ST
4) is not active or cleaved and secreted like the wild type STtyr, but does exhibit increased cell surface expression. It is probable that the ST
4 mutant lacks the stem region and some amino acids of the active domain because the ST
5 mutant lacking amino acids 86104 is also not active but is cleaved and secreted. In contrast, deletion of stem amino acids between residues 32 and 86 in the ST
1, ST
2, and ST
3 mutants does not inactive these enzyme forms, eliminate their cleavage and secretion, or increase their cell surface expression. Surprisingly, cleavage occurs even though the previously identified Asn63-Ser 64 cleavage site is missing. Further evaluation demonstrated that a cleavage site between Lys 40 and Glu 41 is used in COS cells. Mutagenesis of Lys 40 significantly decreased, but did not eliminate cleavage, suggesting that there are additional secondary sites of cleavage in the ST6Gal I stem. Key words: glycosyltransferase/Golgi/secretion/sialyltransferase
| Introduction |
|---|
|
|
|---|
The structures of oligosaccharides present in cells are mainly determined by the expression pattern of Golgi glycosidases and glycosyltransferases in those cells. While there are considerable cell type differences in Golgi enzyme subcompartmentation (Colley, 1997
2,6-sialyltransferase, ST) led to no increase in cell surface expression (Burke et al., 1992
In addition to their localization in the Golgi, glycosyltransferases have also been found as extracellular, soluble forms. Indeed, many glycosyltransferases were first purified from colostrum, serum, and other body fluids (reviewed in Colley, 1997
). Glycosyltransferases are type II membrane proteins and are believed to have a proteolytically sensitive stem region that tethers the luminal active domain to a membrane anchor (Paulson and Colley, 1989
). A previous report showed that a soluble form of ST6Gal I purified from rat liver was missing its NH2-terminal 63 amino acid residues due to proteolytic cleavage (Weinstein et al., 1987
). Like many glycosyltransferases, ST6Gal I has been isolated from body fluids (Bartholomew et al., 1973
; Paulson et al., 1977
) and has been reported to be released into the culture media from hepatoma cells expressing endogenous ST6Gal I (Bosshart and Berger, 1992
) or transfected tissue culture cells (Ma et al., 1997
).
ST6Gal I has been used as one of the model proteins to study the process of Golgi protein retention. Previous studies investigating the Golgi retention mechanism of ST6Gal I demonstrated that the ST transmembrane sequences were not sufficient for the Golgi retention of neuraminidase (NA) reporter sequences and suggested that the luminal sequences played an important role in efficient Golgi retention (Dahdal and Colley, 1993
). Recently we confirmed the existence of two naturally occurring forms of the ST6Gal I which differ at amino acid residue 123 in the active domain (Ma et al., 1997
). The higher activity STtyr form has a Tyr residue at amino acid 123 and the lower activity STcys form has a Cys residue at this position. The STcys is retained for long times in the Golgi of COS cells, while the STtyr is transiently retained in the Golgi and eventually moves beyond the Golgi where it is cleaved and secreted from the cells with a half time of 36 h. These results suggest that the active domain of the enzyme may play a role in the efficiency of Golgi retention. In addition, earlier results that showed that a mutant ST protein consisting of both the stem and active domain was transiently retained in the Golgi (Colley et al., 1992
) suggested that the ST stem region could be an independent Golgi retention signal.
In this study, to investigate the role of ST6Gal I stem region in Golgi retention, a series of mutant ST proteins with deletions of sequences in the stem region were constructed and characterized. We found that one of the mutant ST proteins (ST
4) showed a significantly increased level of cell surface expression in COS cells. Interestingly, pulse-chase labeling and immunoprecipitation analysis showed that this mutant that was found at the highest levels on the cell surface was not cleaved and secreted out of the cells. Based on these results, we suggest that the efficiency of cleavage of a glycosyltransferases stem region controls the level of that glycosyltransferase found at the cell surface. Interestingly, the other deletion mutants in this study lacked the originally identified cleavage site Asn 63-Ser 64 (Weinstein et al., 1987
) and yet were still cleaved and secreted. For this reason, we reexamined the in vivo proteolytic cleavage site of ST6Gal I and found that it resided between Lys 40 and Glu 41, only 14 amino acids from the transmembrane domain. Finally, continued cleavage of ST6Gal I proteins in which this cleavage site was mutated or deleted suggested the presence of other secondary sites and a generally proteolytically sensitive stem region that extends from amino acid 27 to ~100.
| Results |
|---|
|
|
|---|
The role of the stem region in ST Golgi retention
To determine whether the ST6Gal I stem region was critical for Golgi retention, we constructed two chimeric proteins from ST6Gal I and influenza neuraminidase (NA) sequences. NAttST contained the NA tail and transmembrane region fused to the ST stem and active domain regions. NAttsST contained the NA tail, transmembrane and stem region fused to the ST active domain region. Immunofluorescence microscopy of expressing COS cells demonstrated that NAttST was localized to the Golgi while NAttsST was found in vesicles and on the cell surface (data not shown). These results suggested that the ST6Gal I stem region plays a role in the Golgi retention of the NAttST chimeric protein.
We initially made a series of stem deletion mutants in the NAttST chimeric protein, however their expression levels were so low that we were unable to localize them in cells by immunofluorescence microscopy. Similar problems were encountered with stem deletion mutants in the fully Golgi retained STcys isoform of the ST6Gal I. Alternatively, we analyzed stem sequences in the full length STtyr isoform of the ST6Gal I. This isoform is found in the Golgi, but must be transiently retained, since it appears to be transported into a very late Golgi or even post-Golgi compartment where it is cleaved and then secreted (Ma et al., 1997
). Some enzyme must escape this cleavage since we observe small amounts at the cell surface by immunofluorescence microscopy (Ma et al., 1997
). Based on these previous observations it was clear that, for the STtyr isoform, a loss of Golgi retention might be manifested as either an increase in cell surface localization and/or an increase in cleavage and secretion.
A series of mutants were constructed in which portions of stem (or stem plus carboxy-terminal sequences of the active region, for ST
4 and ST
5) were deleted from the STtyr protein (Figure 1). These proteins were transiently expressed in COS cells and localized by indirect immunofluorescence microscopy using the affinity purified anti-ST antibody which was raised against a soluble enzyme comprised of amino acids 64403 (Ma and Colley, 1996
) (Figure 2). Staining of internal structures in permeabilized cells demonstrated that the wild type STtyr and all the stem mutants were predominantly localized in the Golgi. We observed that 1020% of expressing cells exhibited endoplasmic reticulum as well as Golgi staining, while the remaining 80% of expressing cells exhibited exclusively Golgi staining. Staining of unpermeabilized cells demonstrated that the wild type STtyr, ST
1, ST
2, and ST
3 are expressed at low levels on the cell surface. A very few cells expressing the ST
3 mutant appeared to have slightly elevated cell surface expression (data not shown). In contrast, ST
4 showed a significantly increased level of cell surface expression when compared with that of wild type STtyr (Figure 2G,H).
|
|
To determine more quantitatively the level of the mutant ST proteins on the cell surface, we biotinylated cell surface proteins of metabolically labeled COS cells expressing those proteins (data not shown). Surprisingly, little to no wild type STtyr was detectable by biotinylation in these experiments. Quantitation of the mutant ST protein bands demonstrated that less than 1% of ST
1, ST
2, and ST
3 were found at the cell surface, while 32% of ST
4 protein was found at the cell surface. It is possible that the biotinylation reagent may have limited access to free amino groups in the active domain of the ST6Gal I thereby decreasing the sensitivity of this technique. Despite this potential sensitivity problem, this experiment confirmed that ST
4 was expressed at higher levels on the cell surface and suggested that the deletion of amino acids 86104 (difference between ST
3 and ST
4) was responsible for this increase in cell surface expression.
Cleavage and secretion of mutant ST6Gal I proteins
One possibility was that the ST
4 mutant was not cleaved as effectively as the wild type STtyr and, as a consequence, more was transported to the cell surface. To test this hypothesis, we compared the cleavage and secretion of the wild type STtyr and the mutant ST proteins. We found that ST
1, ST
2, and ST
3 proteins were cleaved and secreted into the media (Figure 3). The molecular mass of their soluble forms were similar to the soluble form of the wild type ST judging from the mobilities of immunoprecipitated proteins on the SDSpolyacrylamide gel. In addition, comparisons of cleavage products of ST
2 and ST
3 suggested that there might be two closely spaced cleavage sites that are used with different efficiency in the different mutants. Two soluble forms are observed in ST
2 media, while only the lower molecular mass form is observed in ST
3 media (Figure 3). Most interestingly, the predominant cleavage site(s) were not used in ST
4, whose expression was significantly higher at the cell surface (Figure 3). The small amount of ST
4 cleavage that did occur resulted in significantly smaller bands that were found at low levels in the cell medium. The low level of cleavage and secretion of ST
4 is consistent with a hypothesis that the efficiency of STtyr proteolytic cleavage is directly related to the level of cell surface expression.
|
Deletion of amino acids 86104 does not alter ST6Gal I cleavage and secretion
The results shown in Figure 3 suggested that the primary in vivo ST6Gal I cleavage site may be located within the region of amino acids 86104. Alternatively, this region may be necessary for the binding of a protease, which would then cleave downstream from this site. To test these possibilities, we deleted only amino acids 86104 (ST
5, see Figure 1) and compared the cleavage and secretion of the ST
5 mutant to that of the wild type STtyr isoform and the ST
4 mutant. Surprisingly, while deletion of amino acids 32104 completely abolished ST6Gal I cleavage and secretion, deletion of amino acids 86104 in the ST
5 mutant did not alter enzyme cleavage (Figure 4). These results suggested that this site does not contain the major cleavage site of the enzyme and these sequences are not involved in protease recognition and binding.
|
A third possibility, suggested by the differences in cleavage between ST
3 and ST
4, was that by deleting amino acids 32104 we had deleted the major ST6Gal I cleavage site and any secondary cleavage sites also present in the stem region. As support for this hypothesis, we found that deletion mutants ST
1, ST
2, and ST
3 were localized in the Golgi (Figure 2) and catalytically active when expressed in CHO cells that lack the endogenous enzyme (Figure 5). In contrast, ST
4 and ST
5 were localized in the Golgi (Figure 2) but catalytically inactive since transfected CHO cells did not stain with the FITC-conjugated SNA lectin which specifically recognizes
2, 6-linked sialic acid (Figure 5). These results strongly suggested that by deleting amino acids 32104 (ST
4 mutant) we had effectively deleted the entire proteolytically sensitive stem region as well as residues in the active domain essential for catalytic activity. More recent results demonstrate that a soluble form of the ST6Gal I containing amino acids 97403 is catalytically active and this result places the stem-active domain border between amino acids 97104 (C.Chen and K.J.Colley, unpublished observations).
|
Comparison of soluble secreted ST6Gal I from different cell types
Deletion of the Asn63-Ser64 cleavage site first identified by Weinstein et al. (1987)
1, ST
2 and ST
3 cleavage and secretion in Figure 3). This original cleavage site was defined by amino terminal sequencing of a soluble, truncated form of the enzyme purified from rat liver. It remains unclear whether this site is the only cleavage site used in vivo, and in fact, the above results suggest that it may not be. To investigate whether the Asn63-Ser64 cleavage site or another site was used in vivo, we reevaluated the amino terminal sequence of the soluble secreted ST6Gal I. First, we asked whether the cleavage site used in COS cells was significantly different from that used in liver cells by comparing the molecular mass of the soluble forms secreted from COS cells expressing the STtyr isoform and FTO2B rat hepatoma cells expressing endogenous ST6Gal I (Figure 6). Radiolabeled and immunoprecipitated ST proteins from cell lysate and medium fractions were subjected to PNGase F digestion to eliminate any molecular mass differences due to differences in processing of N-linked oligosaccharides. Deglycosylated, soluble forms of the ST proteins expressed in COS and FTO2B cells migrated with identical molecular masses, suggesting that the same or very closely spaced ST6Gal I cleavage sites were used in both cell types.
|
Amino terminal amino acid sequence of soluble ST-FLAG released from transfected COS cells
Since COS cells and the rat liver hepatoma cells cleaved the ST to a similar molecular mass form (Figure 6), it was reasonable to use material expressed in COS cells for analysis of the amino terminus of the secreted STtyr protein. To easily purify the secreted protein, we tagged it with the FLAG epitope tag at its carboxy-terminus as described in Materials and methods. We found that the ST-FLAG was localized in the Golgi apparatus (Figure 7A) and cleaved and secreted out of the cells just like wild type ST (Figure 7B). Soluble ST-FLAG was purified from culture medium by immunoaffinity chromatography, and the purified material subjected to amino terminal amino acid sequencing. The amino terminal amino acid sequence of soluble ST-FLAG was found to be Glu-Phe-Gln-Met-pro-lys-ser-thr-glu-lys, where lower case amino acids indicate ambiguous identification. These results indicate that, in COS cells and possibly in liver cells, the primary ST6Gal I cleavage site is between Lys-40 and Glu-41, at a distance of 14 amino acid residues from the transmembrane region (Figure 8).
|
|
Cleavage and secretion of ST-K40A in which the Lys40-Glu41 proteolytic cleavage site is mutated
To provide support for the identified cleavage site being used in vivo in COS cells and to evaluate the possibility of other secondary cleavage sites, we tested whether the cleavage and secretion of ST6Gal I could be prevented or decreased by the elimination of this site. We constructed the mutant STtyr, ST-K40A, in which Lys 40 was changed to Ala. Immunofluorescence microscopy demonstrated that the ST-K40A mutant was efficiently transported to the Golgi (Figure 9A). However, this mutant was poorly cleaved and secreted by COS cells. Whereas 63% of the wild type STtyr protein was found in the cell medium after 6 h of chase, only 38% of the K40A mutant protein was found in the cell medium after the same chase time (Figure 9B). Mutagenesis of this site did not prevent proteolytic cleavage completely suggesting that although Lys 40-Glu41 is likely to be the primary ST6Gal I cleavage site in COS cells, other amino acids can act as less efficient, secondary cleavage sites.
|
| Discussion |
|---|
|
|
|---|
In this study we evaluated the role of the ST6Gal I stem region in its Golgi retention and cleavage and secretion. Analysis of a series of STtyr mutants (Figure 1) demonstrated that deletion of stem sequences did not alter the rate of cleavage and secretion or the appearance of the STtyr proteins at the cell surface until the entire stem region (amino acids 32104) was deleted in the ST
4 mutant. We found that cleavage and secretion of this mutant were significantly decreased and its cell surface expression was substantially increased (Figures 2 and 3). The ST
5 mutant, lacking amino acids 86104 (the difference between ST
3 and ST
4), did not differ significantly from the wild type STtyr protein in terms of cleavage and secretion or levels of cell surface expression (Figures 2, 4). Therefore, it is unlikely that this carboxyl-terminal portion of the ST6Gal I stem region is required for Golgi retention per se. In contrast, the inactivity of the ST
4 and ST
5 mutants suggested that the ST
4 protein lacks the entire stem region and some amino acids of the active domain, thereby eliminating all possible cleavage sites and leading to an increase in its cell surface expression.
Surprisingly, the ST
1, ST
2, and ST
3 mutants all lacked the Asn63-Ser64 cleavage site originally defined by Weinstein et al. (1987)
, yet all were cleaved and secreted with the same efficiency as wild type STtyr. Reevaluation of the cleavage site(s) used when the wild type STtyr protein is expressed in COS cells demonstrated that the enzyme is cleaved at a single major site located between Lys 40 and Glu 41 (Figures 3, 4, 8). The Lys 40-Glu 41 cleavage site was also missing in the ST
2 and ST
3 mutants, and yet they still were cleaved. This result and the migration patterns of these mutants in Figure 3 suggested that there were certainly multiple cleavage sites. The elimination of the Lys 40-Glu41 cleavage confirmed this possibility. We found that conversion of Lys 40 to an Ala residue significantly decreased, but did not eliminate, cleavage and secretion of the ST6Gal I STtyr isoform from COS cells (Figure 9).
The presence of sialyltransferases and other glycosyltransferases in body fluids was recognized many years ago. Investigators initially purified many glycosyltransferases from body fluids such as serum, milk, colostrum, and amniotic fluid (for example, Paulson et al., 1977
; Gerber et al., 1979
; Elhammer and Kornfeld, 1986
; Sarnesto et al., 1990
; Johnson and Watkins, 1992
). More recently, the expression of full-length, recombinant forms of glycosyltransferases has demonstrated that these enzymes are also cleaved and secreted from tissue culture cells (for example, Jaskiewicz et al., 1996
; Cho and Cummings, 1997
; Cho et al., 1997
; Ma et al., 1997
). These observations have drawn renewed attention to the proteolytic processes involved in these enzymes conversions from membrane associated to soluble forms.
Several laboratories have deduced potential glycosyltransferase cleavage sites from the amino terminal sequence analysis of soluble/truncated forms of these enzymes purified from body fluids, tissue culture medium or tissue. No common cleavage site has been found for all glycosyltransferases and frequently, more than one site has been identified for the same enzyme. Homa et al. (1993)
found that the GalNAc-transferase (O-linked) purified from colostrum was cleaved following an Arg residue that is 12 amino acids from the transmembrane region (ER/GLPAGDV). Jaskiewicz et al. (1996)
demonstrated that the ß1,4-N-acetylgalactosaminyltransferase (GM2 synthase), when expressed in CHO cells, is cleaved at a single major site near the carboxy-terminal end of the transmembrane region (GLL/YASTRDA). Cho et al. (1997)
found that the murine
1,3-galactosyltransferase, when expressed in human 293 cells, was cleaved at two sites (73KDWW/FPS/WFKNG) within the stem region. Masri et al. (1988)
and D'Agostaro et al. (1989)
used a purified truncated form of the ß1,4-galactosyltransferase to identify a potential cleavage site following an Arg reside that is 34 amino acids from the transmembrane region (LR/TGGAR). In contrast, work done by Gerber et al. (1979)
suggested three closely spaced cleavage sites in purified soluble forms of the same enzyme.
Amino terminal sequencing of a soluble form of the ST6Gal I protein purified from rat liver, led Weinstein et al. (1987)
to conclude that this enzyme was proteolytically cleaved following Asn 63 in the sequence SN/SKQDP, 37 amino acids from the transmembrane region. Further work by Lammers and Jamieson (Lammers and Jamieson, 1988
; Jamieson et al., 1993
) demonstrated that pepstatin A inhibited ST6Gal I cleavage from isolated Golgi membranes, suggesting that a cathepsin D-like, aspartic protease may be responsible for this cleavage event. In this study, amino terminal sequencing of a soluble secreted form of the ST6Gal I expressed in COS cells suggests there is a single major cleavage site 14 amino acids away from the transmembrane region (see Figure 8). This cleavage is predicted to occur following a basic Lys residue (DPK/EDIPI) and in this way is more similar to the predicted cleavage sites for the GalNAc-transferase and ß1,4-galactosyltransferase that occur following basic Arg residues (see above).
Why does the ST6Gal I cleavage site identified in this work differ from that deduced by Weinstein et al. (1987)
? One possibility is that the cell type of expression and the level of protein expression may determine the cleavage site(s) used. If the stem region of the ST6Gal I is generally sensitive to proteolysis, and the presence of different proteases in different cell and tissue types may lead to the use of different cleavage sites in the same protein. This may also be the case for the ß1,4-galactosyltransferase (Gerber et al., 1979
; Masri et al., 1988
; D'Agostaro et al., 1989
; see above). A second possibility is that the cleavage observed by Weinstein et al. (1987)
occurred during purification and after lysis of liver membranes as the result of the release of proteases from the lysosomal compartment. By isolating the soluble form of the ST6Gal I protein from cell medium, we would have eliminated this latter possibility and directly analyzed the cleavage event that takes place in these intact cells that precedes the secretion of the newly formed, soluble enzyme.
The presence of soluble glycosyltransferases in body fluids has led to questions concerning why the cleavage events occur and what potential roles these proteins may play in the extracellular space. Some investigators feel that these cleavage events are part of a natural turnover process (Cho et al., 1997
; Colley, 1997
). Another possibility is that soluble glycosyltransferases use their ability to bind sugar residues and function as lectins and either bind back to cell surfaces or bind to glycoproteins in the extracellular fluids. The functions of these soluble glycosyltransferases and the mechanisms involved in their cleavage and secretion are presently unknown and provide important areas for future investigation.
| Materials and methods |
|---|
|
|
|---|
Materials
Tissue culture media and reagents, including Dulbeccos modified Eagles medium (DMEM), Lipofectin, and LipofectAMINE were purchased from Life Technologies, Inc. (Grand Island, NY). Fetal bovine serum was obtained from Atlanta Biologicals (Norcross, GA). FTO2B rat hepatoma cells were obtained from Dr. Carolyn Bruzdzinski (University of Illinois, Chicago, IL). Sequenase enzyme was obtained from U. S. Biochemical Corp. (Cleveland, OH). Fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG and biotinyl N-hydroxysuccinimide ester were purchased from EY laboratories (San Mateo, CA). FITC-conjugated Sambucus nigra agglutinin (SNA or elderberry bark lectin) was purchased from Vector Laboratories, Inc. (Burlingame, CA). Protein A Sepharose Fast Flow was purchased from Pharmacia Biotech, Inc. (Piscataway, NJ). Biotinyl N-hydroxylsuccinimide ester was purchased from Pierce Chemical Co. Streptavidinagarose was obtained from Upstate Technology (Lake Placid, NY). Anti-FLAG M2 affinity gel was purchased from Eastman Kodak Co. (New Haven, CT). Columns for DNA purification were obtained from Qiagen Inc. (Chatsworth, CA). Protein molecular weight standards were purchased from Bio-Rad (Richmond, CA). Peptide-N-glycosidase F (PNGase F) was purchased from New England BioLabs (Beverly, MA). 35S-Express protein labeling mix was purchased from DuPont NEN (Boston, MA).
Construction of ST deletion mutant proteins and FLAG-tagged ST (ST-FLAG) protein
In this study, we used the STtyr isoform of the rat ST6Gal I (GenBank accession number: M18769). Polymerase chain reaction (PCR) using Vent polymerase (New England BioLabs) was performed according to manufacturers instructions using the ST coding sequences in Bluescript + (bs+) as a template. The PCR fragments encoding the specific sequences of the mutant proteins were gel-purified using low melting point agarose (Life Technologies, Inc) and were then ligated into the pSVL expression vector (Pharmacia) for expression in COS or CHO cells. In most cases, specific restriction sites were incorporated into the oligonucleotides used in the PCR reaction and allowed the ligation of DNA fragments into the expression vectors and with other DNA fragments. The sequence of each mutant construct was verified by DNA sequencing using Sequenase enzyme (U. S. Biochemical Corp.).
ST deletion mutants
. The ST
1-pSVL was generated by digesting ST-pSVL with MscI and CvnI and ligating the oligonucleotide which was made by annealing primer 1 (CCAGCAAGCAAGACCC) and primer 2 (TTAGGGTCTTGCTTGCTGG). ST
2-pSVL was constructed as described previously (Colley et al., 1992
). The ST
3 was generated by fusing the 5' sequences (generated from the ST-bs+ plasmid using primer 3 (GCCTCGAGCTGGACCATTCATTATGATT) and primer 4 (GCGAAGCTTGTCGC-TCCCTTTCTTCCAAA)) to the 3' sequences (generated from the ST-bs+ plasmid using primer 5 (CGCAAGCTTCCACAGCCTTCCTTCCAGGT) and primer 6 (GCGGGATCCCTTTCC-CTACCCATGCAGAA)) at an oligonucleotide-encoded HindIII site. The ST
4 was generated by fusing the 5' sequences generated from the ST-bs+ plasmid using primer 3 and primer 4 to the 3' sequences generated from the ST-bs+ plasmid using primer 7 (CGCAAGCTTAGGCTGCTGAAGATCTGGAG) and primer 6 at an oligonucleotide-encoded HindIII site. The ST
5 was generated by fusing the 5' sequences (generated from the ST-bs+ plasmid using primer 3 and primer 8 (GCGAAGCTTTTTGA-CCTTGGCTGTGACCC)) to the 3' sequences (generated from the ST-bs+ plasmid using primer 6 and the primer 7) at an oligonucleotide-encoded HindIII site. ST
3, 4, and 5 were cloned into bs+ in the XhoI and BamHI sites and then ligated into the pSVL expression vectors XhoI and BamHI sites.
ST-FLAG protein.
The ST-FLAG construct, in which the FLAG peptide was fused to the carboxy-terminus of ST6Gal I, was generated by fusing the ST sequences (generated from the ST-bs+ using primer 9 (GCCTCGAGCTGGACCATTCATTATGATT) and primer 10 (CGCAAGCTTACAACGAATGTTCCGGAAG) to the FLAG-encoding oligonucleotide which was made by annealing primer 11 (AGCTTGACTA-CAAGGACGACGATGACAAGTGAG) and primer 12 (GATCCTCACTTGTCATCGTCGTCCTTGTAGTCA) at an oligonucleotide-encoded HindIII site. The ST-FLAG construct was cloned into bs+ in the XhoI and BamHI sites and then ligated into the pSVL expression vector at the XhoI and BamHI sites.
ST-K40A protein
. ST-K40A-bs+ was generated using Quick Change Site Directed Mutagenesis kit (Stratagene). Primer 13 (CTTACACTGCAAGCAGCAGAGTTCC-AGATGCCC) and primer 14 (GGGCATCTGGAACTCTGCTGCTTGCAGTGTAAG) were used to mutate the Lys residue at position 40 to Ala. ST-K40A-pSVL was then generated as described above for the ST-FLAG-pSVL construct.
Transfection of COS cells
COS-1 or 7 cells maintained in DMEM, 10% fetal bovine serum were plated on 100-mm tissue culture dishes and grown in a 37°C, 5% CO2 incubator until 5070% confluent. Cells were transfected using the Lipofectin method and Opti-MEM I with 55 µM ß-mercaptoethanol according to the Life Technologies, Inc. instructions and as described previously (Colley et al., 1992
). Expression of transfected proteins was typically allowed to continue for 1636 h.
Immunofluorescence localization and SNA lectin staining
COS or CHO cells expressing wild type STtyr, mutant, and STtyr-FLAG proteins were processed for immunofluorescence microscopy as described previously (Colley et al., 1992
; Dahdal and Colley, 1993
; Ma et al., 1997
). Following the fixation and blocking steps, cells were incubated for 45 min with a 1:100 dilutions of either a rabbit affinity purified antibody raised against soluble rat liver ST6Gal I (generation and affinity purification described in Ma and Colley, 1996) or the M2 mouse monoclonal antibody against the FLAG epitope (only for ST-FLAG protein) in blocking buffer. Following PBS washes, appropriate secondary antibodies conjugated to FITC and diluted 1:100 in blocking buffer were incubated with the cells. For staining transfected CHO cells with FITC-conjugated SNA lectin (Sambucus nigra agglutinin, elderberry bark lectin), the blocking step was eliminated and unpermeabilized cells were incubated with a 1:200 dilution of the FITC-conjugated SNA in PBS for 45 min. Washing and mounting was performed as described previously (Ma et al., 1997
). Immunofluorescence staining was visualized and photographed using a Nikon Axiophot or Optiphot 2 microscope equipped with epifluorescence illumination and a 60x oil immersion Plan Apochromat objective.
Pulse-chase analysis and immunoprecipitation of transiently expressed proteins
Metabolic labeling of cells and immunoprecipitation of expressed proteins was performed essentially as previously described using 35S-Express protein labeling mix (100 µCi/ml) and methionine- and cysteine-free DMEM (Colley et al., 1992
; Dahdal and Colley, 1993
; Ma et al., 1997
). Cells were chased for various times in 4 ml of DMEM, 10% FBS and lysed in immunoprecipitation buffer (50 mM TrisHCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% Nonidet P-40, 0.1% SDS). Immunoprecipitation of expressed proteins were processed as described previously (Colley et al., 1992
; Dahdal and Colley, 1993
; Ma et al., 1997
). Immunoprecipitated proteins were denatured in Laemmli sample buffer with 5% ß-mercaptoethanol by boiling for 5 min. Immunoprecipitated proteins were analyzed using 10% or 520% gradient SDSpolyacrylamide gels (Laemmli, 1970
) and radiolabeled proteins were visualized by fluorography and exposure to x-ray film or using the BAS 2000 radio image analyzer (Fuji Film). The results in Figure 9 were quantified by densitometry using NIHimage computer software. Prestained protein molecular markers (Bio-Rad) used in this study are 203 kDa, myosin; 113116 kDa, ß-galactosidase; 8288 kDa bovine serum albumin; 4849 kDa, ovalbumin; 3335 kDa, carbonic anhydrase; 2829 kDa, soybean trypsin inhibitor; 21 kDa, lysozyme; and 8 kDa, aprotinin.
Cell surface biotinylation
COS cells were transfected, labeled as described above, and washed with ice-cold PBS. Cells were then biotinylated as previously described (Wong et al., 1992
; Dahdal and Colley, 1993
). Three milliliters of cold PBS containing 1 mg/ml biotinyl N-hydroxysuccinimide ester was added to the cells, and the incubation was continued for 30 min with gentle rocking at 4°C. Cells were washed four times with 5 ml of PBS containing 50 mM lysine to block any unreacted reagent. Following cell lysis, proteins were immunoprecipitated with anti-ST antibodies and then with protein A Sepharose as previously described (Dahdal and Colley, 1993
). The proteins were eluted from the beads by boiling for 10 min in 100 µl of 0.2 M TrisHCl, pH 8.8, 1.0% SDS, 0.5 mM EDTA. Pellets were washed in 150 µl of lysis buffer containing 3% Nonidet P-40. Both the elution and wash were combined and one fifth of the sample was reserved as "total." The remaining sample was rotated for 1 h with 20 µl of a 50% suspension of streptavidinagarose at 4°C. Complexes were pelleted, washed, denatured as described above, and reserved as "surface." "Total" and "surface" samples were analyzed using 520% gradient SDSpolyacrylamide gels, and quantitated with the BAS2000 radio image analyzer.
PNGase F digestions
COS cells transiently expressing ST and rat hepatoma FTO2B cells endogenously expressing ST were labeled for 1 h and then chased for 6 h (in case of COS cells) or for 14 h (in case of FTO2B cells), as described above. ST proteins were immunoprecipitated from both cell lysate and medium fractions. Immunoprecipitates were divided into two portions and treated with or without 1000 units of PNGase F in 10 mM TrisHCl, pH 7.2, 50 mM EDTA, pH 7.2, 0.2% SDS, 1% Nonidet P-40, and 20 mM ßmercaptoethanol (Masibay et al., 1993
). After incubation at 37°C for 16 h, samples were analyzed by SDSpolyacrylamide gel electrophoresis and the BAS2000 radio image analyzer.
Purification of soluble ST-FLAG protein and NH2-terminal amino acid sequence analysis
COS cells were transfected with ST-FLAG-pSVL using the Lipofectin method. After 24 h of expression, 800 ml of the culture medium was collected, centrifuged at 500 x g for 10 min to remove debris, and incubated at 4°C for 16 h with 5 ml of anti-FLAG M2 affinity gel with rotation. The beads were washed with 10 volumes of PBS and then with 2 volumes of 20 mM phosphate buffer (pH 7.0). The proteins bound to the beads were then eluted with 50 mM citrate (pH 3.0), and the eluate was immediately neutralized with 1 M TrisHCl (pH 9.6). The protein mixture, which contained primarily the ST-FLAG protein, was precipitated with 75% ice-cold ethanol at 20°C for 16 h and subjected to SDSpolyacrylamide gel electrophoresis. The proteins were then electrophoretically transferred to an Immobilon membrane (Millipore). After staining with Coomassie blue, the soluble form of ST-FLAG (~49 K) was excised from the membrane, and the amino-terminal amino acid sequence was determined using a Procise 492 cLC protein sequencer (Applied Biosystems).
| Acknowledgments |
|---|
|
|
|---|
We thank the members of the Colley and Tsuji laboratories for their continued advice and support. This work was supported in part by National Institutes of Health Research Grant GM48134 (to K.C.) and in part by Grants-in-Aid from Scientific Research on Priority Areas (Nos. 10152263 and10178104) and for Scientific Research (No. C 09680639) from the Ministry of Education of Japan (to S. T.). K.C. is an Established Investigator of the American Heart Association.
| Abbreviations |
|---|
ST6Gal I or ST, ß-galactoside
2,6-sialyltransferase; DMEM, Dulbeccos modified Eagles medium; CHO, Chinese hamster ovary; NA, neuraminidase; PCR, polymerase chain reaction; FITC, fluorescein isothiocyanate; PBS, phosphate-buffered saline; PNGase F, peptide-N-glycosidase; bs+, Bluescript+; SNA, Sambucus nigra agglutinin or elderberry bark lectin; PNGase F, peptide N-glycosidase F.
| Footnotes |
|---|
1 Present title and address: Special researcher, Basic Science Program, Molecular Glycobiology, Frontier Research Program, The Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 3510198, Japan
2 To whom correspondence should be addressed at: Department of Biochemistry and Molecular Biology, University of Illinois at Chicago, College of Medicine, 1819 West Polk Street M/C 536, Chicago, IL 60612 ![]()
| References |
|---|
|
|
|---|
Bartholomew,B.A., Jourdian,G.W. and Roseman,S. (1973) The sialic acids. XV. Transfer of sialic acid to glycoproteins by a sialyltransferase from colostrum. J. Biol. Chem., 248, 57515762.
Bosshart,H. and Berger,E.G. (1992) Biosynthesis and intracellular transport of
-2, 6-sialyltransferase in rat hepatoma cells. Eur. J. Biochem., 208, 341349.[ISI][Medline]
Bretscher,M.S. and Munro,S. (1993) Cholesterol and the Golgi apparatus. Science, 261, 12801281.
Burke,J., Pettit,J.M., Schachter,H., Sarker,M. and Gleeson,P.A. (1992) The transmembrane sequences and flanking sequences of ß1,2-N-acetylglucosaminyltransferase I specify medial Golgi localization. J. Biol. Chem., 267, 2443324440.
Cho,S.K. and Cummings,R.D. (1997) A soluble form of
1,3-galactosyltransferase functions within cells to galactosylate glycoproteins. J. Biol. Chem., 272, 1362213628.
Cho,S.K., Yeh,J.-C. and Cummings,R.D. (1997) Secretion of
1,3-galactosyltransferase by cultured cells and presence of enzyme in animal sera. Glycoconj. J., 14, 809819.[ISI][Medline]
Colley,K.J. (1997) Golgi localization of glycosyltransferases: more questions than answers. Glycobiology, 7, 113.[Medline]
Colley,K.J., Lee,E.U. and Paulson,J.C. (1992) The signal anchor and stem regions of the ß-galactoside
-2,6-sialyltransferase may each act to localize the enzyme to the Golgi apparatus. J. Biol. Chem., 267, 77847793.
DAgostaro,G., Bendiak,B. and Tropak,M. (1989) Cloning of cDNA encoding the membrane-bound form of bovine ß1,4-galactosyltransferase. Eur. J. Biochem., 183, 211217.[ISI][Medline]
Dahdal,R.Y. and Colley,K.J. (1993) Specific sequences in the signal anchor of the b-galactoside
2,6-sialyltransferase are not essential for Golgi localization. J. Biol. Chem., 268, 2631026319.
Elhammer,A. and Kornfeld,S. (1986) Purification and characterization of UDP-N-acetylgalactosamine: polypeptide N-acetylgalactosaminyltransferase from bovine colostrum and murine lymphoma BW5147 cells. J. Biol. Chem., 261, 52495255.
Gerber,A.C., Kozdrowski,I., Wyss,S.R. and Berger,E.G. (1979) The charge heterogeneity of soluble human galactosyltransferases isolated from milk, amniotic fluid and malignant ascites. Eur. J. Biochem., 93, 453460.[ISI][Medline]
Homa,F.L., Hollander,T., Lehman,D.J., Thomsen,D.R. and Elhammer,A. (1993) Isolation and expression of a cDNA clone encoding a bovine UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem., 268, 1260912616.
Jamieson,J.C., McCaffrey,G. and Harder,P.G. (1993) Sialyltransferase: a novel acute phase reactant. Comp. Biochem. Physiol., 105, 2933.[Medline]
Jaskiewicz,E., Zhu,G., Bassi,R., Darling,D.S. and Young,W.W., Jr. (1996) b1, 4 N-acetylgalactosaminyltransferase (GM2 synthase) is released from Golgi membranes as a neuraminidase sensitive, disulfide-bonded dimer by a cathepsin D-like protease. J. Biol. Chem., 271, 2639526403.
Johnson,P.H. and Watkins,W.M. (1992) Purification of the Lewis blood-group gene associated alpha-3/4-fucosyltransferase from human milk: an enzyme transferring fucose primarily to type 1 and lactose-based oligosaccharide chains. Glycoconj. J., 9, 241249.[ISI][Medline]
Laemmli,U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680685.[Medline]
Lammers,G. and Jamieson,J.C. (1988) The role of a cathepsin D-like activity in the release of Galß1-4GlcNAc
2-6-sialyltransferase from rat liver Golgi membranes during the acute-phase response. Biochem. J., 256, 623631.[ISI][Medline]
Levine,Y.K. and Wilkins,M.H.F. (1971) Structure of oriented lipid bilayers. Nature New Biol., 230, 6972.
Ma,J. and Colley,K.J. (1996) A disulfide-bonded dimer of the Golgi b-galactoside a2, 6-sialyltransferase is catalytically inactive yet still retains the ability to bind galactose. J. Biol. Chem., 271, 77587766.
Ma,J., Qian,R., Rausa,F.M. and Colley,K.J. (1997) Two naturally occurring a2, 6-sialyltransferase forms with a single amino acid change in the catalytic domain differ in their catalytic activity and proteolytic processing. J. Biol. Chem., 272, 672679.
Machamer,C.E. (1991) Golgi retention signals: do membranes hold the key? Trends Cell Biol., 1, 141144.[Medline]
Masibay,A.S., Balaji,P.J., Boeggeman,E.E. and Quasba,P.K. (1993) Mutational analysis of the Golgi retention signal of bovine ß1,4-galactosyltransferase. J. Biol. Chem., 268, 99089916.
Masri,K.A., Appert,H.E. and Fukuda,M.N. (1988) Identification of the full-length coding sequence for human galactosyltransferase (ß-N-acetylglucosaminide: ß1,4-galactosyltransferase). Biochem. Biophys. Res. Commun., 157, 657663.[ISI][Medline]
Munro,S. (1991) Sequences within and adjacent to the transmembrane segment of
2,6-sialyltransferase specify Golgi retention. EMBO J., 12, 35773588.
Munro,S. (1995) An investigation of the role of transmembrane domains in Golgi protein retention. EMBO J., 14, 46954704.[ISI][Medline]
Munro,S. (1998) Localization of proteins to the Golgi apparatus. Trends Cell Biol., 8, 1115.[ISI][Medline]
Nezil,F.A. and Bloom,M. (1992) Combined influence of cholesterol and synthetic amphiphilic peptides upon bilayer thickness in model membranes. Biophysical J., 61, 11761183.
Nilsson,T., Slusarewicz,P., Hoe,M.H. and Warren,G. (1993) Kin recognition: a model for the retention of Golgi enzymes. FEBS Lett., 330, 14.[ISI][Medline]
Nilsson,T., Hoe,M.H., Slusarewicz,P., Rabouille,C., Watson,R., Hunte,F., Watzele,G. Berger,E.G. and Warren,G. (1994) Kin recognition between medial Golgi enzymes in HeLa cells. EMBO J., 13, 562574.[ISI][Medline]
Nilsson,T., Rabouille,C., Hui,N., Watson,R. and Warren,G. (1996) The role of the membrane-spanning domain and stalk region of N-acetylglucosaminyltransferase I in retention, kin recognition and structural maintenance of the Golgi apparatus in HeLa cells. J. Cell Sci., 109, 19751989.[Abstract]
Orci,L., Montesano,R., Meda,P., Malaisse-Lagae,F., Brown,D., Perrelet,A. and Vassalli,P. (1981) Heterogeneous distribution of filipin-cholesterol complexes across the cisternae of the Golgi. Proc. Natl. Acad. Sci. USA, 78, 293297.
Osman,N., McKenzie,I.F.C., Mouhtouris,E. and Sandrin,M.S. (1996) Switching amino-terminal cytoplasmic domains of
(1,2)fucosyltransferase and
(1,3)galactosyltransferase alters the expression of H substance and Gal
(1,3)Gal. J. Biol. Chem., 271, 3310533109.
Paulson,J.C. and Colley,K.J. (1989) Glycosyltransferases: structure, localization and control of cell type-specific glycosylation. J. Biol. Chem., 264, 1761517618.
Paulson,J.C., Beranek,W.E. and Hill,R.L. (1977) Purification of sialyltransferase from bovine colostrum by affinity chromatography on CDP-agarose. J. Biol. Chem., 252, 23562362.
Roth,J. (1987) Subcellular organization of glycosylation in mammalian cells. Biochim. Biophys. Acta, 906, 405436.[Medline]
Sarnesto,A., Kohlin,T., Thurin,J. and Blaszczyk-Thurin,M. (1990) Purification of H gene-encoded ß-galactoside
1, 2-fucosyltransferase from human serum. J. Biol. Chem., 265, 1506715075.
Skrincosky,D., Kain,R., El-Battari,A., Exner,M., Kerjaschki,D. and Fukuda,M. (1997) Altered Golgi localization of core 2 ß-1, 6-N-acetylglucosaminyltransferase leads to decreased synthesis of branched O-glycans. J. Biol. Chem., 272, 2269522702.
Teasdale,R.D., DAgostaro,G. and Gleeson,P.A. (1992) The signal for Golgi retention of bovine ß-1, 4-galactosyltransferase is in the transmembrane domain. J. Biol. Chem., 267, 40844096.
Weinstein,J., Lee,E.U., McEntee,K., Lai,P.-H. and Paulson,J.C. (1987) Primary structure of ß-galactoside
2, 6-sialyltransferase. J. Biol. Chem., 262, 1773517743.
Wong,S.H., Low,S.H. and Hong,W. (1992) The 17-residue transmembrane domain of beta-galactoside alpha 2,6-sialyltransferase is sufficient for Golgi retention. J. Cell Biol., 117, 245258.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
|









