| Glycobiology | Pages |
Mouse C127 cells transfected with fucosyltransferase Fuc-TIII express masked Lewisx but not Lewisx antigen
Introduction
Results
Discussion
Materials and methods
Acknowledgments
Abbreviations
References
Mouse C127 cells transfected with fucosyltransferase Fuc-TIII express masked Lewisx but not Lewisx antigen
Key words: carbohydrate antigens/glycosyltransferase/lectins/Western blot
Introduction
Human Fuc-TIII is able to transfer [alpha]-Fuc to either the C-4 or C-3 positions of GlcNAc in oligosaccharides ending in Gal[beta]1-3GlcNAc or Gal[beta]1-4GlcNAc structures, respectively. While the synthesis of the [alpha]1-4 linkage is limited to Fuc-TIII and Fuc-TV, the ability to make the [alpha]1,3 linkage is common to a family (Natzuka and Lowe, 1994; Costache et al., 1997) of different fucosyltransferases (FucTs). Specific involvement of each [alpha]1,3FucT in relevant steps of glycoconjugate biosynthesis is not fully defined.
A useful approach for studying the biosynthetic role of glycosyltransferases involves analyzing the cell surface antigens expressed in a cell line upon transient or permanent transfection of cDNA. Such studies have demonstrated that fine differences between related cell lines greatly affect cell surface glycoconjugate synthesis (Goeltz et al., 1994), and that recombinant enzymes compete with endogenous glycosyltransferases (Smith et al., 1990). Data concerning Fuc-TIII indicate that it synthesizes Lex, sialyl-Lex, Lea, and sialyl-Lea antigens in transfected COS cells (Kukowska-Latallo et al., 1990; Elmgren et al., 1997), Lex and sialyl-Lex antigens in transfected CHO cells (Sueyoshi et al., 1994) as well as in the small intestine of transgenic mice (Bry et al., 1996), and utilizes LacNAc (Legault et al., 1995) and 3[prime]-sialyl LacNAc (Weston et al., 1992) as acceptor substrates in vitro. On this basis, it is widely accepted that Fuc-TIII acts as an [alpha]1,3FucT under several different experimental conditions, although its biological relevance is still uncertain. In fact, recent data suggest that the synthesis of bioactive sialyl-Lex is due to Fuc-TVII (Hiraiwa et al., 1996; Zollner and Vestweber, 1996).
To obtain more information regarding Fuc-TIII as an [alpha]1,3FucT, we constructed and analyzed a mouse cell line that permanently expresses the enzyme. C127 cells, a line derived from a mouse mammary tumor, were chosen because they were expected to lack [alpha]1,3FucT, as well as [alpha]2,3sialyltransferase and [beta]1,3galactosyltransferase activities (Kagawa et al., 1988). To ensure that transfectant cell clones actually express human Fuc-TIII, enzyme activity was characterized kinetically and the RNA analyzed by RT-PCR with a specific oligonucleotide primer pair. We then analyzed the cell surface antigens by immunofluorescence with specific antibodies and lectins, and determined the reactivity with different lectins of N-linked oligosaccharides which became radioactive upon metabolic labeling with tritiated fucose. Immunoblotting of glycoproteins separated by SDS-PAGE was also performed to determine the pattern of glycoproteins used as acceptors by Fuc-TIII. In addition, we constructed two other C127 clones, one that expresses Polyoma large T antigen, and another one that expresses both Polyoma large T antigen and Fuc-TIII, and analyzed the cell surface antigens expressed in the cells upon transient transfection with FUT1.
Results
Construction and characterization of transfected cell clones
Mouse C127 cells were transfected with plasmid DNA coding for human Fuc-TIII using the G418 selection plasmid pSV2Neo as described under Materials and methods. Thirty G418 resistant cell colonies were analyzed for Fuc-TIII activity in vitro. Four of the most active colonies were subcloned by serial dilution and the obtained clones analyzed as above. A clone that expressed constant high level of enzymatic activity, named C127-FT was submitted to extensive characterization.
Since it was useful to perform transient transfection experiments using C127 cells, we also constructed cell clones that express Polyoma virus large T antigen. C127 cells were transfected with plasmid DNA coding for Polyoma virus large T antigen, using histidinol for selection as described under Materials and methods. A histidinol resistant clone found to be enzymatically active upon transient transfection with pcDNAI-[alpha]1,2FT and homogeneously bright by immunofluorescence with anti-T antigen antibody, named C127-T, was selected. Clone C127-T was transfected with plasmid DNA coding for human Fuc-TIII using G418 for selection (see Materials and methods), and a histidinol/G418 resistant clone that stably expressed Fuc-TIII activity, named C127-T-FT, was used for further experiments.
Table I.
| Enzyme source | Acceptor | Donor GDP-Fuc (Km µM) | ||
| Lacto-N-bioseI | LacNAc(Km mM) | |||
| Specific activitya | (Km mM) | |||
| C127 | Undetectable | - | - | - |
| C127-FT | 2.2 | 4.1 | 110 | 8.5 |
| C127-T | Undetectable | - | - | - |
| C127-T-FT | 2.5 | 4.9 | 126 | 8.8 |
| COS-7- pcDNAI-[alpha](1,3/1,4)FT |
NC | 5.7 | 119 | 8.1 |
| CHO-Fuc-TIII | 2.0 | NC | NC | NC |
Poly(A)+ RNA extracted from parental C127 cells and from the obtained clones was used as template for RT-PCR analysis using a primer pair known to be specific to human Fuc-TIII sequence (Yago et al., 1993). Poly(A)+ RNA extracted in a parallel preparation from the human adenocarcinoma cell line COLO 205, known to express Fuc-TIII (Majuri et al., 1995), was also used in the experiment. No amplification is seen by gel electrophoresis analysis with poly(A)+ RNA from C127 and C127-T cells, while a fragment of an approximate size of 450 bp is found with poly(A)+ RNA from both C127-FT and C127-T-FT clones. It is identical in size to the one obtained with poly(A)+ RNA from COLO 205 cells and corresponds to the PCR fragment obtained by amplification of authentic Fuc-TIII sequence (Figure
Figure 1. RT-PCR analysis of poly(A)+ RNA extracted from parental and clonal C127 cells. Lanes 1 and 8, reference molecular weight markers, 587, 540, 504, 458, and 434 bp, from the top; lane 2, RNA from COLO205 cells; lane 3, RNA from parental C127 cells; lane 4, RNA from clone C127-FT; lane 5, RNA from clone C127-T; lane 6, RNA from clone C127-T-FT; lane 7, amplification of authentic Fuc-TIII cDNA. Construction of cellular clones, poly(A)+ RNA extraction, reverse transcription, and amplification were carried out as described under Materials and methods using a Fuc-TIII specific oligonucleotide primer pair. One-fifteenth (lanes 2-6) or one-hundredth (lane 7) aliquots of the reactions were electrophoresed in 2.5% agarose gel and stained with ethidium bromide.
Flow cytometry analysis of carbohydrate antigens expressed on the cell surface of transfected cells
In order to study the cell surface antigens synthesized by mouse C127 cells expressing Fuc-TIII, parental C127 cells and clone C127-FT were stained by different antibodies and lectins, and analyzed by flow cytometry. Both cells are strongly positive with GSI-B4 lectin, positive to SNA and ECA, and both are negative to anti-Lex, sialyl-Lex, Lea, and sialyl-Lea antibodies; no difference in fucosylated epitopes is apparent between Fuc-TIII positive and negative C127 cells (not shown). Staining experiments were repeated after treating the cells with glycohydrolases. A typical experiment (Figure
Figure 2. Flow cytometry analysis of C127 cells and clone C127-FT. Cells were prepared, treated with no enzyme, [alpha]-galactosidase, or sialidase, stained with antibody or lectins, and analyzed by flow cytometry as described under Materials and methods. Control reactions, performed on [alpha]-galactosidase treated cells, contained FITC-conjugate secondary antibody alone in the case of anti-Lex staining, or complete reactions plus lectin haptens as follows: 50 mM melibiose for GSI-B4, 200 mM lactose for SNA, and 50 mM lactose for ECA. Lectin chromatography analysis of oligosaccharides released from metabolically radiolabeled cells
To verify the hypothesis that Fuc-TIII expressed in C127 cells synthesized masked Lex antigens, C127 cells and clone C127-FT were metabolically radiolabeled with [3H]Fuc. Clone C127-FT incorporates more radioactivity than parental C127 cells after 72 h incubation. The amount of radioactivity extracted in the glycolipid fraction or released by mild alkaline hydrolysis (O-linked oligosaccharide fraction) is similar in the two cell lines. On the other hand, N-glycanase digestion releases 2.5 times more radioactivity from C127-FT cells than from the parental line (Table II). Immunoprecipitation with anti-Lex antibody of the [3H]Fuc N-linked oligosaccharide fraction prepared from C127-FT cells provides no radioactivity in the insoluble phase. Sialidase or galactosidase treatment of the fraction before immunoprecipitation allows detection of radioactivity in the precipitate.
Figure 3. Flow cytometry analysis of clone C127-FT and clone CHO-Fuc-TIII. Cells were prepared, stained with monoclonal antibodies, and analyzed by flow cytometry as in Figure 2.
Radiolabeled oligosaccharides released by N-glycanase were submitted to sequential lectin affinity chromatography. Twenty-five percent and 30% of labeled oligosaccharides released from clone C127-FT and C127 cells, respectively, bound to ConA and were eluted with 20 mM [alpha]-methylglucoside. Material not bound to the ConA column from both C127-FT and C127 cells did not bind very efficiently to LEA column either (9.5% and 8.8%, respectively). C127 oligosaccharides not bound to LEA column bound to the ECA column more efficiently (35%) than the corresponding C127-FT oligosaccharides (18%). Conversely, C127-FT oligosaccharides not bound to the ConA, LEA, and ECA columns, efficiently bound to the SNA column and are eluted with ethylenediamine (37%), and those unbound to SNA column bound efficiently to GSI column and were eluted with melibiose (54%). A fraction of [3H]Fuc oligosaccharides eluted from SNA bound to the GSI column as well (not shown). C127 oligosaccharides did not bind efficiently to both SNA and GSI columns (14 and 20%, respectively). The quantitative results are summarized in Table III. The radioactivity ratio measured between C127-FT and C127 oligosaccharides at the various steps of serial lectin affinity chromatography decreased in the eluate of the ECA column and in the unbound fraction of both SNA and GSI columns, and increased in the unbound fraction of ECA column and the eluate of both SNA and GSI columns. The radioactivity recovered in the eluate of SNA and GSI column (52.1 nCi total) represented a relevant fraction of the increased amount of radioactivity in C127-FT oligosaccharides, as calculated in the LEA unbound fraction (54.5 nCi). These results confirm that the aliquot of [3H]Fuc incorporated in clone C127-FT that exceeds the amount in parental C127 cells is bound to N-glycans ending with GSI and SNA reactive sugars.
Table II.
Incorporated radioactivity
C127-FT (%)
C127 (%)
Total cell pellet
650 (100)
295 (100)
Glycolipid fraction
27 (4.1)
26 (8.8)
O-Linked oligosaccharide fraction
74 (11.3)
69 (23.3)
N-Linked oligosaccharide fraction
447 (68.7)
172 (58.3)
Western blot analysis
To confirm the above findings and to attempt the identification of potential glycoprotein substrates of Fuc-TIII in the cells, clones C127-FT and C127-T were lysed and solubilized protein separated by SDS-PAGE before and after treatment with glycohydrolases. In the experiment shown in Panel A (Figure
Flow cytometry analysis of cells transiently transfected with FUT1
We expressed FUT1 by transient transfection of plasmid DNA in C127 clones able to replicate episomal plasmid DNA. Panning of pcDNAI-[alpha]1,2FT transfected and mock transfected cells on Petri dishes coated with UEAI, that reacts with [alpha]1,2 linked fucose residues, provided no adherent cell with mock transfected cells, while many pcDNAI-[alpha]1,2FT transfected cells stuck to the dish. Adherent cells were detached from panning dishes, stained with GSI-B4 or SNA, and analyzed by flow cytometry in comparison with mock transfected or nonadherent cells. The results show that lower levels of GSI-B4 and SNA reactive residues are expressed by adherent cells (Figure
On this basis, as a further and independent way to assess that C127 cells transfected with Fuc-TIII express a metabolically active enzyme, we tried to determine whether it cooperates with FUT1 in the biosynthesis of Ley antigen. Flow cytometry analysis of pcDNAI-[alpha]1,2FT transfected clone C127-T-FT stained with specific anti-Ley antibody shows that about 30% of cells are positive (Figure
Discussion
In this article we show that C127 cells transfected with Fuc-TIII express masked Lex, but not Lex antigen. Ley is also synthesized in the cells once they are made able to express human FUT1.
Our experimental model involves the construction of two mouse cell clones, named C127-FT and C127-T-FT, respectively. One is derived from parental C127 cells and the other from C127 cells transfected to express Polyoma large T antigen (clone C127-T). Clones were obtained by permanent transfection of human Fuc-TIII cDNA placed under the control of Cytomegalovirus promoter. We found that transfected cells express high levels of a fucosyltransferase activity kinetically identical to human Fuc-TIII, and a RNA message that can be amplified by a Fuc-TIII specific oligonucleotide primer (Yago et al., 1993), while C127 and C127-T cells lack both enzymatic activity and RNA. On this basis we conclude that C127-FT and C127-T-FT clones actually express human Fuc-TIII.
C127 cells react with GSI-B4 lectin (very bright), SNA, and ECA, while fucosylated epitopes are not detectable by a panel of monoclonal antibodies. Clone C127-FT is stained with the same lectins as are C127 cells, and remains negative to anti-Lex, sialyl-Lex, Lea, and sialyl-Lea antibodies. Since the cells were expected to lack [alpha]2,3 sialyl residues and cognate [alpha]2,3sialyltransferase, as well as type 1 chain and cognate [beta]1,3galactosyltransferase (Kagawa et al., 1988), the lack of expression of sialyl-Lex, Lea, and sialyl-Lea was predicted. Conversely, the absence of Lex antigen was not immediately expected in cells expressing both Fuc-TIII activity and ECA positive structures (presumably including Gal[beta]1-4GlcNAc residues). In fact, in a parallel experiment with CHO cells expressing Fuc-TIII, Lex antigen was detected, as previously reported (Sueyoshi et al., 1994)
Lex reactivity could be demonstrated only after [alpha]-galactosidase or sialidase treatment of clones expressing Fuc-TIII, while the same treatment was ineffective on parental C127 or C127-T cells, not expressing the enzyme. A metabolic labeling experiment with [3H]Fuc indicates that clone C127-FT incorporates more fucose than parental C127 cells, and serial lectin affinity chromatography of released N-linked oligosaccharides provides different radioactivity distribution profiles within the two cell lines. In particular, we found that radioactive N-linked oligosaccharides released from clone C127-FT bind to immobilized GSI and SNA much more efficiently than those released from parental C127 cells. Taken together, the flow cytometry and lectin chromatography results suggest that C127 cells transfected with human Fuc-TIII express masked Lex structures.
Table III.
| Lectin column | Unbound radioactivity | Bound radioactivity | ||||
| C127-FT | C127 | C127-FT/C127 ratio | C127-FT | C127 | C127-FT/C127 ratio | |
| ConA | 110 | 42.2 | 2.6 | 38.6 | 18.4 | 2.1 |
| LEA | 92.7 | 40.3 | 2.3 | 10.2 | 3.6 | 2.8 |
| ECA | 80.4 | 25.9 | 3.1 | 17.0 | 14.8 | 1.1 |
| SNA | 48.2 | 22.1 | 2.1 | 23.2 | 3.8 | 6.1 |
| GSI | 21.3 | 15.3 | 1.5 | 25.9 | 4.4 | 5.9 |
Figure 4. Immunoblot analysis of glycoproteins extracted from C127-FT and C127-T clones. Cell lysis, glycohydrolase treatment, SDS-PAGE, and immunoblotting with anti-Lex antibody or GSI-B4 were performed as described under Materials and methods. (A) Approximately 50 µg of protein were loaded and blotted. The same filter was incubated with anti-Lex antibody (+), stripped, and reprobed with secondary antibody alone (-), GSI-B4, or GSI-B4 in the presence of 200 mM melibiose. Lanes 1 and 2 are clones C127-FT and C127-T, respectively, treated with no enzyme; lanes 3 and 4 are lanes 1 and 2, respectively, treated with [alpha]-galactosidase. (B) Approximately 50 µg of protein were loaded and blotted. Filter was incubated with anti-Lex antibody (+), stripped and reprobed with secondary antibody alone (-). Lanes 5 and 6 are lanes 1 and 2, respectively, treated with sialidase. (C) Different amount of protein from the same samples as in (A) were loaded and blotted to separated filters. Amounts loaded on lanes 1A and 1B are one-half and one-quarter, respectively, the amount of lane 1; lanes 3A and 4A are one half of lanes 3 and 4, respectively.
The specificity reported for the lectins and the glycohydrolases used (Magnani et al., 1987; Merkle and Cummings, 1987; Cummings 1994a), as well as the information on the endogenous glycosylation machinery in C127 cells (Kagawa et al., 1988), lead to the hypothesis that [alpha]1,3galactose and [alpha]2,6sialic acid are candidate to be the masking groups. Gal[alpha]1-3Gal[beta]1-4(Fuc[alpha]1-3)GlcNAc structure was recently demonstrated in cobra venom mucin (Gowda and Davidson, 1994), and masking of Lex antigen by [alpha]1,3galactose was recently proposed in mouse F9 embryonic cells (Cho et al., 1996). The structure Gal[alpha]1-3Gal[beta]1-4(Fuc[alpha]1-3)GlcNAc was previously suggested to be a developmentally expressed antigen in the mouse (Pennington et al., 1985).
Since Ley antigen can be considered a type of masked Lex antigen, where [alpha]1,2Fuc is the masking residue, we predicted that a metabolically active Fuc-TIII would be able to synthesize Ley in C127 cells if endogenous masking residues were, in part, replaced by [alpha]1,2Fuc. This is what occurs in C127 cells transiently transfected with FUT1. In fact, FUT1 transfected cells were found to express less GSI-B4 and SNA reactive residues than cells not expressing the enzyme, but to express UEAI reactive residues instead. Concurrently, we found that transient expression of FUT1 in C127-T-FT cells directs synthesis of Ley antigen, indicating that Fuc-TIII and FUT1 do cooperate on the same oligosaccharide chain.
Figure 5. Flow cytometry analysis of clone C127-T-FT transiently transfected with pcDNAI-[alpha]1,2FT. Cells were transfected, in some case panned, stained, and analyzed by flow cytometry as reported under Materials and methods. Upper panel, transfected cells were directly stained with anti-Ley antibody (solid line) or with secondary antibody alone (dotted line). Lower panel, transfected cells were panned on petri dishes coated with UEAI, and adherent (solid line) or non adherent (dotted line) cells stained with FITC-conjugate GSI-B4 lectin or SNA.
Our results indicate that Lex antigen is undetectable in C127 cells expressing Fuc-TIII, but the Lex trisaccharide structure is formed by Fuc-TIII as part of more glycosylated compounds. Two alternative biosynthetic pathways can be postulated. In the first pathway, Lex antigen is actually synthesized by Fuc-TIII from unsubstituted lactosamine residues but immediately and quantitatively glycosylated by endogenous glycosyltransferases. In the other one, substituted lactosamine residues are formed first and then fucosylated by Fuc-TIII. Here we found that Fuc-TIII has a very low affinity for LacNAc, and other authors reported measurable Fuc-TIII activity in vivo with H type 2 trisaccharide but not with LacNAc (de Vries et al., 1995). Other literature data reported that substituted lactosamines are suitable acceptor for human FucTs in vitro (Joziasse et al., 1993) including Fuc-TIII (Chandrasekaran et al., 1995), while Lex trisaccharide is not efficiently glycosylated (Blanken and van den Eijnden 1985; Sarnesto et al., 1992), suggesting that [alpha]1,3 fucosylation is in general the last step in a biosynthetic pathway. For the further studies necessary to establishing this point, our working hypothesis is that the [alpha]1,3 activity of Fuc-TIII may be devoted to fucosylate substituted lactosamines, while its activity may be less relevant in Lex as well in sialyl-Lex biosynthesis, as recently suggested for a soluble recombinant form of the enzyme (Costa et al., 1997).
Materials and methods
Materials
Lacto-N-bioseI, LacNAc, phenyl-[beta]-galactoside, GDP-[beta]-l-Fucose, l-Fuc, melibiose, lactose, Triton X-100, ethylenediamine, Clostridium perfringens sialidase, coffee bean [alpha]-galactosidase, histidinol, FITC conjugate and peroxidase conjugate GSI-B4 lectin, purified UEAI, FITC conjugate and peroxidase conjugate goat anti-mouse IgM (µ chain specific), and FITC conjugate anti-mouse IgG were from Sigma. GDP-(1-3H)Fuc (specific radioactivity 5.9 Ci/mmol) was from Du Pont New England Nuclear. FITC conjugate UEAI, ECA, and SNA, gel immobilized GSI, SNA, LEA, and ECA were from EY laboratories. Anti-Lex monoclonal antibody anti-CD15, clone MMA, was from Becton Dickinson; anti-Lex monoclonal antibody anti-SSEA-1 (Gersten et al., 1995) was also used. Anti-Ley monoclonal antibody (clone F3) was from Signet. Common chemicals were from Merck; (5,6-3H)Fuc, restriction enzymes, and ECL Western blotting detection reagents were from Amersham.
Plasmid pCDM8 [alpha](1,3/1,4)FT was obtained by subcloning the XhoI insert of pCDM7 [alpha](1,3/1,4)FT (Kukowska-Latallo et al., 1990) in pCDM8. pcDNAI-His was obtained by cloning the His-D cDNA in the BamHI-XhoI sites of pcDNAI. His-D cDNA was obtained by PCR using plasmid pSV2-His (Hartman and Mulligan, 1988) as template and the following primer pair: 5[prime] GCGCGGATCCGCGACCATGAGCTTCAATACCCTGAATTGA (upper strand primer) and 5[prime] GCGCTCTAGAGTGTTTTCAGTGCTCAGTGCTCATGCTTGCT (lower strand primer). Plasmid pLT1 was a gift of G. Nunez (University of Michigan).
Cell lines
C127 cells (ATCC CRL 1616) were cultured in DMEM medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 mg/ml streptomycin, and 2 mM l-Glu. COLO205 cells (ATCC CCL-222) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 mg/ml streptomycin, and 2 mM l-Glu. CHO cells expressing Fuc-TIII, a gift of J. B. Lowe (University of Michigan), were cultured in [alpha]-MEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 mg/ml streptomycin, 2 mM l-Glu, and 750 U/ml Hygromycin B.
Transfection procedures
A mixture containing a 10:1 molar ratio of target and selection plasmid was used for transfections. For the construction of clone C127-FT, plasmids pCDM8 [alpha](1,3/1,4)FT and pSV2Neo (Lowe et al., 1990), for G418 selection, were linearized by digestion with NheI and EcoRI, respectively, before mixing. For the construction of clone C127-T, plasmid pLT1 (circular) and a gel purified NheI-ScaI fragment of pcDNAI-His (for histidinol selection) were used. In both cases, the procedure followed the calcium phosphate method (Chen and Okayama, 1987), using 20 µg of DNA mixture. For selection, the C127 medium was supplemented with 0.5 mg/ml G418 (active drug) or 2.5 mM histidinol, respectively. For the construction of clone C127-T-FT, a gel purified NheI-ScaI fragment of pCDM8 [alpha](1,3/1,4)FT was mixed with a gel purified XhoI-ScaI fragment of pcDNAI-Neo (Invitrogen) and transfected in C127-T cells using the procedure developed for transient transfection (see after). For selection, the selective medium used for clone C127-T was supplemented with 0.5 mg/ml G418 (active drug). In all cases cell colonies resistant to the selection medium or isolated by serial dilution were collected using cloning cylinders.
For transient transfection, 1-1.5 × 106 C127-T or C127-T-FT cells were plated in 100 mm dishes 20 h before transfection, washed with serum-free DMEM, and incubated with 4 ml of transfection solution for 3 h under usual growing conditions. Transfection solution, containing 3.5 µg/ml DNA and 12 µl/ml DOTAP (Boehringer), was prepared by diluting stock DNA and DOTAP in serum-free DMEM separately (7.0 µg/ml DNA and 24 µl/ml DOTAP) and then mixing equal volumes. After 20 min at room temperature, the solution is applied to the plates. At the end of incubation, regular complete medium (8 ml) was added to each plate without removing transfection solution, and cells incubated for additional 20 h. Medium was then replaced with regular complete medium and cells harvested 72 h following transfection.
Cell clones expressing Polyoma virus large T antigen
C127 cells were transfected with plasmid DNA coding for Polyoma virus large T antigen, using the histidinol selection plasmid pcDNAI-HisD, as above described. Twenty histidinol resistant colonies were analyzed for T antigen expression by immunofluorescence microscopy. Five bright colonies were then analyzed for FUT1 activity upon transient transfection with pcDNAI-[alpha]1,2FT. Two enzymatically active colonies were subcloned by serial dilution and analyzed as above. A clone found to be enzymatically active upon transient transfection and homogeneously bright by immunofluorescence, named C127-T, was selected and transfected with plasmid DNA coding for human Fuc-TIII using the G418 selection plasmid pcDNAI-Neo. Histidinol/G418 resistant cell colonies were analyzed, subcloned by serial dilution, and reanalyzed as described above, until isolating a cell clone, named C127-T-FT, that stably expressed Fuc-TIII activity.
RT-PCR analysis
Total RNA was extracted by a guanidine isothiocyanate CsCl method as reported previously (Gersten et al., 1995), and poly(A)+ RNA prepared using latex bound oligo(dT) (Oligotex, Qiagen) according to a published method (Hiraiwa et al., 1996). First strand cDNA was prepared from poly(A)+ RNA using murine leukemia virus reverse transcriptase (Perkin Elmer) and random hexamer primers according to the manufacturer's recommendations. It was then used as template for second strand synthesis and amplification using Taq thermostable DNA polymerase (Perkin Elmer). PCR reactions contained, in 0.1 ml total volume, 0.2 mM of each deoxynucleotide triphosphate, 10 mM Tris/HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2, 250 ng of Fuc-TIII specific oligonucleotide primer pair (Yago et al., 1993), 2.5 U of Taq polymerase, and the cDNA transcribed from 0.5 µg of poly(A)+ RNA. Control amplification contained 20 ng plasmid DNA as template. Reactions were incubated as follows. A single treatment at 94°C for 2.0 min, followed by a cycle consisting of 1.5 min at 94 °C (melting) and 3.5 min at 72°C (annealing plus extension), was repeated 35 times; a final extension step was performed at 72°C for 8 min. PCR products were analyzed by 2.5% agarose gel electrophoresis.
Fucosyltransferase assays
Fuc-TIII was assayed in COS-7 upon transient transfection and expression of pcDNAI-[alpha]1,3/1,4FT as reported previously (Trinchera and Bozzaro, 1996). Fuc-TIII activity was also determined in C127 cells and derived clones using the cell homogenate, prepared as above reported for COS cells, as the enzyme source. In all cases the reaction mixture contained, in a final volume of 20 µl, 0.1 M Tris/HCl buffer, pH 7.4, 10 mM MnCl2, 0.5 mg/ml Triton X-100, 40 µM donor GDP-[3H]Fuc, specific radioactivity 100 mCi/mmol, 10 mM acceptor (lacto-N-bioseI or LacNAc), and enzyme protein (1-3 mg/ml). FUT1 was assayed in cell homogenates of clones C127-T and C127-T-FT upon transient transfection of plasmid pcDNAI-[alpha]1,2FT (Trinchera and Bozzaro, 1996). Enzyme activity was determined in a reaction mixture containing, in a final volume of 20 µl, 0.1 M Tris/HCl buffer, pH 6.5, 0.5 mg/ml Triton X-100, 40 µM donor GDP-[3H]Fuc, specific radioactivity 100 mCi/mmol, 10 mM acceptor phenyl-[beta]-galactoside, and enzyme protein, 0.5-1 mg/ml. Incubations were done at 37°C for 90 min. At the end of incubations, reaction products were assayed by Dowex chromatography (Kukowska-Latallo et al., 1990) or Sep-Pak C-18 cartridges (Larsen et al., 1990). Radioactivity incorporation was determined by liquid scintillation counting. Blanks were prepared by omitting the acceptor in the reaction mixture and the values subtracted for enzyme activity calculations.
Immunofluorescence, immunoprecipitation, and panning
Cells were detached by incubating the plates 15 min at 37°C with 3 mM EDTA, 0.02% NaN3 in PBS, followed by vigorous pipetting. Cells were recovered by centrifugation, washed twice with PBS, in some cases treated with glycohydrolase (see after), and finally washed with staining medium (DMEM containing 2% fetal bovine serum, 10 mM Hepes, and 0.02% NaN3). Staining was performed for 30 min on ice using 0.1 ml of staining medium containing 0.5-5.0 × 105 cells, and the antibody or lectin at the proper dilution, as follows: anti-Lex (anti-SSEA-1), 1:500; anti-Ley, 1:200, used after adsorption on H type 2 bovine serum albumin conjugate (IsoSep), according to a published procedure (Bry et al., 1996); anti-sialyl-Lex and anti-Lea antibodies were used as reported (Gersten et al., 1995). GSI-B4 lectin, SNA, UEAI, and ECA, all as FITC conjugates, were used at a concentration of 10-50 µg/ml. Antibody staining, after washing twice with staining medium, was followed by incubation with FITC-conjugate anti-mouse IgG (anti-Lea staining) or IgM (all others), both at 1:40 dilution in staining medium. Control reactions were performed by incubating cells with FITC-conjugate anti-mouse IgM or IgG alone, or FITC-conjugate lectins in the presence of the proper haptens as follows: 50 mM melibiose for GSI-B4, 200 mM lactose for SNA, 50 mM Fuc for UEAI, and 50 mM lactose for ECA. Cells were then analyzed by flow cytometry using a FACstar (Becton Dickinson) flow cytometer.
Immunoprecipitation of N-glycanase released oligosaccharides was carried out as follows. Samples (25,000 c.p.m.), resuspended to a volume of 0.2 ml with 1% bovine serum albumin in PBS, were precleared by incubation (1 h) with 0.025 mg/ml goat anti-mouse IgM (Sigma) followed by precipitation with 5 mg Protein A-Sepharose beads (Pharmacia). The cleared supernatant was then incubated overnight with anti-Lex antibody (anti-CD15, 1:200 dilution). Antigen-antibody complex was recovered after incubation (1h) with 0.025 mg/ml goat anti-mouse IgM and precipitation with 5 mg Protein A-Sepharose beads. Beads were washed with incubation buffer, resuspended in the same buffer, and submitted to liquid scintillation counting.
Panning dishes were prepared by incubating 60 mm Petri dishes overnight at 4 °C with 10 µg/ml purified UEAI in PBS. After washing three times with PBS, plates were blocked with 1 mg/ml bovine serum albumin in PBS. For panning, transfected cells, detached and washed as above, were suspended in staining medium (4 ml/ transfected plate) and placed on panning dishes (4 ml/dish). Panning took place at 4°C for 1 h. Nonadherent cells were removed by washing three times with PBS, while adherent cells were detached, washed, and processed for immunofluorescence as above described.
Immunofluorescence with anti-Polyoma large T antigen was performed in tissue culture slides and detected by fluorescence microscopy as reported (Smith and Lowe, 1994).
Glycohydrolase treatment
Treatment was performed on isolated cells, freshly prepared as above, by incubating a suspension of 1-2 × 106 cells in PBS, pH 6.0 for 1 h at 37°C, in either the presence or absence of 2 U/ml of Clostridium perfringens sialidase or coffee bean [alpha]-galactosidase. After incubation, cells were pelleted, washed twice with PBS then with staining medium, and finally processed for immunofluorescence.
Treatment of cell lysates and N-glycanase released oligosaccharides was performed by incubating 1 mg/ml protein in 50 mM cacodylate buffer, pH 6.0 for 3 h at 37°C, in either the presence or absence of 0.5 U/ml of Clostridium perfringens sialidase or coffee bean [alpha]-galactosidase.
Metabolic radiolabeling of cells and serial lectin chromatography of oligosaccharides
C127 and C127-FT cells (2.0 × 106 cells) were plated in 150 mm dishes and incubated in the presence of 0.5 mCi [3H]Fuc for 72 h. Cells were harvested and washed as for immunofluorescence. The cell pellet was freeze dried, resuspended, and submitted to lipid extraction (Cummings, 1994a). The total lipid extract was processed as previously reported (Trinchera et al., 1991), and the radioactivity recovered in dried organic phase plus that in the dialyzed water phase referred to as the glycolipid fraction. Crude glycopeptides were prepared by heating the delipidized pellet at 100°C for 15 min in 50 mM phosphate buffer, pH 8.5, in the presence of 0.4% SDS, followed by centrifugation at 14,000 r.p.m. for 5 min. The clear lysate was diluted to 0.1% SDS, digested by N-glycanase, and N-linked oligosaccharides separated from unreacted glycopeptides by Sephadex G-50 chromatography, according to published methods (Cummings, 1994a). An aliquot of the diluted crude glycopetides were hydrolyzed under mild alkaline conditions (0.05 M NaOH containing 0.5 M NaBH4) and the hydrolyzate analyzed by descending paper chromatography, according to published procedures (Furukawa et al., 1998). Released radioactivity was referred to as the O-linked oligosaccharide fraction.
Lectin affinity chromatography was performed following published procedures (Merkle and Cummings, 1987; Cummings, 1994b). Columns were prepared in a 1 ml glass pipette containing about 0.5 ml bed volume of resin, equilibrated with TBS buffer (10 mM Tris, 150 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, and 0.02% NaN3, pH 8.0), loaded with oligosaccharides dissolved in TBS buffer, washed with TBS, and eluted as follows. ConA column: 20 mM and 200 mM (prewarmed at 60°C) [alpha]-methylglucoside; LEA column: 10 mg/ml of a mixture (1:1, w/w) of N,N[prime],N[prime][prime]-triacetylchitotriose and N,N[prime],N[prime][prime],N[prime][prime][prime]-tetraacetylchitotetraose (both from Sigma); GSI column: 10 mM melibiose; ECA column: 25 mM lactose. SNA column was eluted with 10 mM ethylenediamine, according to the manufacture's recommendations.
Western blotting
Cells were detached as for immunofluorescence, washed with PBS, suspended in lysis buffer (PBS containing a protease inhibitors cocktail (Trinchera and Bozzaro, 1996) and 1 mg/ml Triton X-100), lysed for 30 min on ice, centrifuged at 14,000 r.p.m. for 3 h at 4°C, and the supernatant was collected. After glycohydrolase treatment, the protein was precipitated with 10% trichloracetic acid, washed with cold acetone, and dissolved in Laemmli's sample buffer, containing 50 mM dithiothreitol (Laemmli 1970). Aliquots (12-50 µg) were electrophoresed on 8% SDS-PAGE and transferred to nitrocellulose filters (Schleicher & Schuell; Towbin et al., 1979). The membranes were blocked with Tris buffered saline, 0.1% Tween 20 (T-TBS), 5% nonfat dry milk, washed with T-TBS, and probed with monoclonal anti-Lex (anti-CD15, 1:250 dilution) using peroxidase conjugate goat anti-mouse IgM as secondary antibody, secondary antibody alone, or with peroxidase conjugate GSI-B4 (10 µg/ml), in the presence or absence of 200 mM melibiose (Cho et al., 1996). Blots were developed by ECL. When indicated, the same membrane was stripped according to manufacturer's instructions and sequentially reprobed.
Acknowledgments
We thank John B. Lowe for advice and support during the preparation of some reagents, and for help and encouragement in pursuing the experiments. We also thank Katharine Dyne for improving the English style of the manuscript, Antonio Mortara for skillful technical assistance, and Marco Bellaviti for the artwork. During the first part of this work M.T. received a postdoctoral fellowship at the Department of Pathology (University of Michigan). M.T. is a researcher at the University of Pavia Medical School II. This work was supported by a grant from AIRC (Associazione Italiana per la Ricerca sul Cancro) to M.T. The financial support of Telethon-Italy (Grant 918 to M.T.) is also gratefully acknowledged.
Abbreviations
Fuc-TIII, [alpha]1,3/1,4fucosyltransferase; Lex, Lewis x, Gal[beta]1-4(Fuc[alpha]1-3)GlcNAc; sialyl-Lex, sialyl-Lewis x,NeuAc[alpha]2-3Gal[beta]1-4(Fuc[alpha]1-3)GlcNAc; Lea, Lewis a, Gal[beta]1-3(Fuc[alpha]1-4)GlcNAc; Ley, Lewis y, Fuc[alpha]1-2Gal[beta]1-4(Fuc[alpha]1-3)GlcNAc; lacto-N-bioseI, Gal[beta]1-3GlcNAc; LacNAc, Gal[beta]1-4GlcNAc; FUT1, human blood group H [alpha]1,2fucosyltransferase; RT-PCR, reverse transcriptase mediated-polymerase chain reaction; GSI-B4, Griffonia simplicifolia I isolectin B4; SNA, Sambucus nigra agglutinin; UEAI, Ulex europeus agglutinin I; LEA, Licopersicum esculentum agglutinin (Tomato lectin); ECA, Erithrina cristagalli agglutinin; DMEM, Dulbecco's modified minimum essential medium; ECL, enhanced chemoluminescence.
References
1To whom correspondence should be addressed at: Dipartimento di Biochimica, via Taramelli 3B, 27100 Pavia, Italy
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 12 Jan 1999
Copyright©Oxford University Press, 1999.
This article has been cited by other articles:
![]() |
R. Salvini, A. Bardoni, M. Valli, and M. Trinchera beta 1,3-Galactosyltransferase beta 3Gal-T5 Acts on the GlcNAcbeta 1right-arrow3Galbeta 1right-arrow4GlcNAcbeta 1right-arrowR Sugar Chains of Carcinoembryonic Antigen and Other N-Linked Glycoproteins and Is Down-regulated in Colon Adenocarcinomas J. Biol. Chem., January 26, 2001; 276(5): 3564 - 3573. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
