Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (40)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Mas, E.
Right arrow Articles by Sadoulet, M. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mas, E.
Right arrow Articles by Sadoulet, M. O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology Pages 605-613  


Fucosyltransferase activities in human pancreatic tissue: comparative study between cancer tissues and established tumoral cell lines
Introduction
Results
Discussion
Materials and methods
Acknowledgments
Abbreviations
References


Fucosyltransferase activities in human pancreatic tissue: comparative study between cancer tissues and established tumoral cell lines

Fucosyltransferase activities in human pancreatic tissue: comparative study between cancer tissues and established tumoral cell lines

Eric Mas, Eric Pasqualini, Nathalie Caillol, Assou El Battari, Christian Crotte, Dominique Lombardo, Marie-Odile Sadoulet1

INSERM-U. 260, Unité de Recherche de Physiopathologie des Régulations Hormono-Nutritionnelles, Faculté de Médecine, 27 Boulevard Jean Moulin, 13385 Marseille-Cedex 5, France

Received on November 10, 1997; revised on December 18, 1997; accepted on December 29, 1997

Human pancreatic cancer is characterized by an alteration in fucose-containing surface blood group antigens such as H antigen, Lewis b, Lewis y, and sialyl-Lewis. These carbohydrate determinants can be synthesized by sequential action of [alpha](2,3) sialyltransferases or [alpha](1,2) fucosyltransferases (Fuc-T) and [alpha](1,3/1,4) fucosyltransferases on (poly)N-acetyllactosamine chains. Therefore, the expression and the function of seven fucosyltransferases were investigated in normal and cancer pancreatic tissues and in four pancreatic carcinoma cell lines. Transcripts of FUT1, FUT2, FUT3, FUT4, FUT5, and FUT7 were detected by RT-PCR in carcinoma cell lines as well as in normal and tumoral tissues. Interestingly, the FUT6 message was only detected in tumoral tissues. Analysis of the acceptor substrate specificity for fucosyltransferases indicated that [alpha](1,2) Fuc-T, [alpha](1,3) Fuc-T, and [alpha](1,4) Fuc-T were expressed in microsome preparations of all tissues as demonstrated by fucose incorporation into phenyl [beta]-d-galactoside, 2[prime]-fucosyllactose, N-acetyllactosamine, 3[prime]-sialyl-N-acetyllactosamine, and lacto-N-biose. However, these fucosyltransferase activities varied between tissues. A substantial decrease of [alpha](1,2) Fuc-T activity was observed in tumoral tissues and cell lines compared to normal tissues. Conversely, the activity of [alpha](1,4) Fuc-T, which generates Lewis a and sialyl-Lewis a structures, and that of [alpha](1,3) Fuc-T, able to generate a lactodifucotetraose structure, were very important in SOJ-6 and BxPC-3 cell lines. These increases correlated with an enhanced expression of Lewis a, sialyl-Lewis a, and Lewis y on the cell surface. The activity of [alpha](1,3) Fuc-T, which participates in the synthesis of the sialyl-Lewis x structure, was not significantly modified in cell lines compared to normal tissues. However, the sialyl-Lewis x antigen was expressed preferentially on the surface of SOJ-6 and BxPC-3 cell lines but was not detected on Panc-1 and MiaPaca-2 cell lines suggesting that several [alpha](1,3) Fuc-T might be involved in sialyl-Lewis x synthesis.

Key words: cancer/fucosylated blood group antigens/fucosyltransferases/pancreas

Introduction

Pancreatic cancer has the highest mortality rate in the Western world. It is extremely aggressive and very resistant to current treatment including surgery (Chu, 1997). Its prognosis still remains a virtual death sentence for the patient due to the delayed diagnosis of the disease, at which time liver and peritoneal metastasis are generally present (Poston et al., 1991; Gansauge et al., 1996). The molecular mechanism regulating pancreatic tumor cell invasion and metastasis still remains poorly understood. One crucial step is the attachment of tumor cells to activated cells (Takada et al., 1993) which involves two adhesion molecules, E selectin and P selectin, expressed on the plasma membrane of activated endothelial cells. These selectins, which contain an amino-terminal Ca2+-dependent lectin domain, recognize sialylated and fucosylated oligosaccharide determinants expressed preferentially in cancer (Lowe et al., 1990; Phillips et al., 1990; Walz et al., 1990; Takada et al., 1993; Varki, 1994). These fucosylated oligosaccharide structures, such as Lewis x, Lewis y, sialyl-Lewis x, and sialyl-Lewis a are regarded as tumor associated antigens (Hakomori and Kannagi, 1983; Hakomori, 1989).

Fucosyltransferases are considered the key enzymes which regulate the synthesis of these carbohydrate determinants. Based on their acceptor specificity and their primary protein sequence, they are classified into two main families: the [alpha](1,2) fucosyltransferases (FUT1 and FUT2) and [alpha](1,3) fucosyltransferases (FUT3, FUT4, FUT5, FUT6, and FUT7) which are involved in the synthesis of H and Lewis related antigens, respectively (Kukowska-Latallo et al., 1990; Larsen et al., 1990; Kumar et al., 1991; Lowe et al., 1991; Koszdin et al., 1992; Weston et al., 1992a,b; Natsuka et al., 1994; Sasaki et al., 1994; Kelly et al., 1995). To date, seven fucosyltransferases have been isolated and cloned. The first one, FUT1, is an [alpha](1,2) Fuc-T encoded by the H gene (Larsen et al., 1990) which transfers fucose from GDP-fucose onto the galactose of terminal type II disaccharide (Gal [beta]1,4 GlcNAc).This enzyme is much less active on the type I disaccharide (Gal [beta]1,3 GlcNAc). A second [alpha](1,2) Fuc-T, FUT2 encoded by the secretor gene (Se) (Kelly et al., 1995), transfers fucose from GDP-fucose preferentially on the galactose of terminal type I disaccharide. FUT3, an [alpha](1,3/1,4) fucosyltransferase, corresponds to the Lewis type fucosyltransferase which transfers fucose residue more efficiently onto the N-acetylglucosamine of type I disaccharide than onto the type II disaccharide (Kukowska-Latallo et al., 1990), thus contributing to the synthesis of Lewis x, Lewis y, Lewis a, Lewis b, sialyl-Lewis x, and sialyl-Lewis a (Kukowska-Latallo et al., 1990). The FUT4, an [alpha](1,3) Fuc-T, corresponds to the myeloid type and contributes to the synthesis of Lewis x and Lewis y (Kumar et al., 1991; Lowe et al., 1991). FUT5 and FUT6, two other [alpha](1,3) Fuc-T, can synthesize Lewis x and sialyl-Lewis x (Koszdin et al., 1992; Weston et al., 1992a,b) whereas FUT7 can synthesize only sialyl-Lewis x (Natsuka et al., 1994; Sasaki et al., 1994). The expression of these fucosyltransferases in human colon cancer tissues has been exhaustively studied; however, it is still unclear which of these fucosyltransferases is responsible for the synthesis of the E/P-selectin ligand (Yago et al., 1993; Mannori et al., 1995; Hanski et al., 1996; Majuri et al., 1995; Wittig et al., 1996; Ito et al., 1997). Conversely, the expression pattern of fucosyltransferases on human pancreatic cancer tissues has never been analyzed in detail except work which has shown that the expression of sialyl-Lewis a may be an important mediator in the metastasis of pancreatic carcinoma cells (Iwai et al., 1993; Kaji et al., 1995; Takada et al., 1995; Kishimoto et al., 1996).

Therefore, the aim of the present study was to determine the expression pattern and the substrate specificity of these seven fucosyltransferases in human pancreatic cancer tissues and in four established cancer cell lines, compared to human normal pancreatic tissues. In addition, we wanted to determine whether a correlation could exist between enzyme activity, mRNA expression of those fucosyltransferases, and cell surface expression of fucosylated carbohydrate antigens.

Results

Fucosyltransferase mRNA expression in human pancreatic tissues and cell lines

The expression pattern of fucosyltransferases in pancreatic tissues was unknown, therefore, we performed RT-PCR analysis using specific primers summarized in Table I and deduced from the known sequence of fucosyltransferases. As shown in Figure 1A, the RT-PCR product for FUT1 was present in all pancreatic tissues and cell lines tested. FUT2 mRNA was also detected in pancreatic tissues and cell lines but was absent or poorly expressed in one tumoral tissue and PANC-1 cell line (Figure 1B).

The pair of primers used to amplify FUT3 cDNA (1088 bp) also amplified FUT5 (1124 bp) and FUT6 (1079 bp). Consequently, the RT-PCR product obtained with these primers was digested by BstU I restriction enzyme to cleave FUT5 into 299 bp, 51 bp, and 775 bp fragments and FUT6 into 308 bp, 745 bp, and 217 bp fragments before analysis on 2% agarose gel. Under these conditions, the remaining product is specific for FUT3. As shown in Figure 1C, FUT3 transcript (1088) was present in all pancreatic tissues and cell lines. The primers designed to amplify FUT4, FUT5, FUT6, and FUT7 were specific, and analysis of RT-PCR transcripts revealed that all pancreatic tissues and cell lines expressed FUT5 and FUT7 (Figure 1E,G). FUT4 was also detected in all but one tumoral tissue (Figure 1D). Interestingly, the signal for FUT6 was only detected in pancreatic cancer tissues (Figure 1F). Amplification of [beta]-actin, used as a positive control for the RT-PCR experiment, is presented in Figure 1H and suggested that amplifications were performed on comparable amounts of mRNA.

Fucosyltransferase activities in human pancreatic tissues and cell lines

Fucosyltransferase activities were determined in normal and cancer pancreatic tissues and in established human pancreatic cell lines as well. For this purpose, five different acceptors were used: phenyl [beta]-d-galactoside as substrate for [alpha](1,2) Fuc-T, N-acetyllactosamine as substrate for [alpha](1,2) Fuc-T and [alpha](1,3) Fuc-T, lacto-N-biose as substrate for [alpha](1,2) Fuc-T and [alpha](1,4) Fuc-T and finally 2[prime]-fucosyllactose and 3[prime]-sialyl-N-acetyllactosamine as substrates for [alpha](1,3) Fuc-T.

Table I. PCR primers used for amplifying fucosyltransferases and [beta]-actin mRNA
mRNA species Size of fragments
detected (bp) Primersa
FUT1 480 U : 5[prime] ATGTGGCTCCGGAGCCATCGTCAG 3[prime]
    L : 5[prime] AGGATCTCTCAAGTCCGCGTACTC 3[prime]
FUT2 341 U : 5[prime] CTAGCGAAGATTCAAGCCATGTGG 3[prime]
    L : 5[prime] GACGTACTCCCCCGGGATGTG 3[prime]
FUT3 1088b U : 5[prime] ATGGATCCCCTGGGTGCAGCCAAG 3[prime]
    L : 5[prime] TCAGGTGAACCAAGCCGCTATGCT 3[prime]
FUT4 315 U : 5[prime] GTGCCCGAAATTGGGCTCCTGCAC 3[prime]
    L : 5[prime] GAAGGAGGTGATGTGGACAGCGTA 3[prime]
FUT5 407c U : 5[prime] CTTATGGCAGTGGAACCTGTCACC 3[prime]
    L : 5[prime] CCAGCCGTAGGGCGTGAAGATGTC 3[prime]
FUT6 962d U : 5[prime] CCCACTGTGTACCCTAATGGGTCC 3[prime]
    L : 5[prime] CTCTCAGGTGAACCAAGCCGCTAT 3[prime]
FUT7 290 U : 5[prime] TCGGACATCTTTGTGCCCTATG 3[prime]
    L : 5[prime] CGCCAGAATTTCTCCGTAATGTA 3[prime]
[beta]-Actin 838 U : 5[prime] ATCTGGCACCACACCTTCTACAATGAGCTGCG 3[prime]
    L : 5[prime] CGTCATACTCCTGCTTGCTGATCCACATCTGC 3[prime]
aU, upper strand primer; L, low strand primer.
bThese primers amplify FUT3 but also FUT5 and FUT6. The FUT3 amplified fragment was differentiated from FUT5 and FUT6 amplification products by digestion with Bst U I restriction enzymes which cleaved the two latter fragments.
c,dThese primers detect specifically FUT5 and FUT6.


Figure 1. RT-PCR analysis of fucosyltransferases FUT1 (480 bp) (A), FUT2 (341 bp) (B), FUT3 (1088 bp) (C), FUT4 (315 bp) (D), FUT5 (407 bp) (E), FUT6 (962 bp) (F), and FUT7 (290 bp) (G). [beta]-Actin (838 bp) (H) was taken as control. cDNA was obtained from four normal human pancreatic tissues NP1 to NP4 (lanes 1-4), two tumoral pancreatic tissues TP1, TP2 (lanes 5 and 6), and four pancreatic cancer cell lines SOJ-6 (lane 7), BxPC-3 (lane 8), MiaPaCa-2 (lane 9), PANC-1 (lane 10). After PCR reaction, aliquots of products were electrophoresed on 1.5% agarose gel in the presence of ethidium bromide. Size marker (lane M) is a 1 kb DNA ladder. Left, the size of amplified products are indicated in base pairs (bp).

As shown in Figure 2, the amount of [14C]fucose transferred to phenyl [beta]-d-galactoside was significantly decreased in tumoral tissues (54% and 73% for TP 1 and TP 2, respectively) compared to normal tissues. A comparable decrease of the [alpha](1,2) Fuc-T activity was also observed in SOJ-6 (76%) and BxPC-3 (71%) cell lines. This decreased activity was even more evident in PANC-1 cells (93%) and in MiaPaCa-2 cells where only background level activity was detected (>98%).


Figure 2. [alpha](1-2) Fucosyltransferase activities in normal tissues: NP (n = 21, average of 21 independent determinations from four tissues); in tumoral tissues: TP1 (n = 5), TP2 (n = 5); and in four human pancreatic cell lines: SOJ-6 (n = 12), BxPC-3 (n = 10), MiaPaCa-2 (n = 5), PANC-1 (n = 3) were measured with phenyl [beta]-D-galactoside as acceptor (see Materials and methods). The fucosyltransferase activity was expressed as picomoles of fucose transferred from GDP-fucose to acceptor per minute and per milligram protein. Data represent means ± SE. The significance of difference from normal tissue values was examined using Student's t test. *, p < 0.05.

N-Acetyllactosamine may be the acceptor for fucose transfer catalyzed by an [alpha](1,2) Fuc-T which allows the formation of H-type II determinant and by an [alpha](1,3) Fuc-T leading to the formation of Lewis x structures. As shown in Figure 3A, we observed a decrease of H-type II antigens (open bars) in tumor tissues and all tumor cell lines compared to normal tissue values. This confirms the considerable decrease of [alpha](1,2)Fuc-T activity previously obtained with phenyl [beta]-d-galactoside acceptor. The formation of Lewis x structures (hatched bars) was of the same extend in TP2 and BxPC-3 and comparable to normal tissue, but a larger decrease was observed in TP1, SOJ-6, MiaPaCa-2, and PANC-1.


Figure 3. Fucosyltransferase activities were measured with N-acetyllactosamine (A) and lacto-N-biose (B) as acceptors (see Materials and methods). In Figure 3A, the amount of fucose (pmol) transferred from GDP-fucose to N-acetyllactosamine has been calculated from the ratio radioactivity obtained after TLC of H-type II (open bars) and Lewis x structures (hatched bars) normalized to the total radioactivity dotted in normal tissues: NP (n = 11 ); in tumoral tissues: TP1 (n = 8), TP2 (n = 7); and in four human pancreatic cell lines: SOJ-6 (n = 11), BxPC-3 (n = 8), MiaPaCa-2 (n = 4), PANC-1 (n = 3). In (B) the amount of fucose (pmol) transferred from GDP-fucose to lacto-N-biose has been calculated from the radioactivity ratio obtained after TLC of H-type I (open bars) and Lewis a structures (hatched bars) normalized to the total radioactivity dotted in normal tissues: NP (n = 7); in tumoral tissues: TP1 (n = 5), TP2 (n = 5); and in four human pancreatic cell lines: SOJ-6 (n = 11), BxPC-3 (n = 5), MiaPaCa-2 (n = 3), PANC-1 (n = 3). The fucosyltransferase activity was expressed as picomoles of fucose transferred from GDP-fucose to acceptor per minute and per milligram protein. Data points represent means ± SE.

[alpha](1,2) Fuc-T and [alpha](1,4) Fuc-T can fucosylate lacto-N-biose to generate H-type I, and Lewis a antigens respectively. As shown in Figure 3B, levels of Lewis a (hatched bars) and H-type I structures (open bars) decreased in tumoral pancreatic tissues when compared to normal ones. However, [alpha](1,4) Fuc-T activity was greatly increased in SOJ-6 (350%) and BxPC-3 cells (100%) whereas the activity of [alpha](1,2) Fuc-T was comparable to that found in tumoral tissues. Both [alpha](1,2) Fuc-T and [alpha](1,4) Fuc-T activities were dramatically low in MiaPaCa-2 and PANC-1 cell lines. Interestingly, and independent of tissue or cell lines examined, no formation of Lewis b or Lewis y antigens was detected (not shown).

[alpha](1,3) Fuc-T activity was determined with 2[prime]-fucosyllactose. This acceptor, which is already fucosylated in the [alpha](1,2) position of Gal, can also be fucosylated on Glc residues by [alpha](1,3) Fuc-T generating the tetrasaccharide, lactodifucotetraose (Fuc [alpha]1,2 Gal [Fuc [alpha]1,3] [beta]1,4 Glc). As shown in Figure 4A, the formation of lactodifucotetraose was detected to the same extend in both normal and tumoral pancreas. A 6- to 7-fold higher activity was measured in BxPC-3 and SOJ-6 cell lines while almost no activity was found in MiaPaCa-2 and PANC-1 cells.

Lastly, 3[prime]-sialyl-N-acetyllactosamine was used as acceptor to detect those of [alpha](1,3) Fuc-T able to generate a sialyl-Lewis x structure which is an important determinant for cell adhesion and metastasis. As shown in Figure 4B, this activity was significantly lower in tumoral pancreatic tissues than in normal ones. In tumoral cell lines, Fuc-T activity was not significantly modified compared to normal tissues, except in MiaPaCa-2 cells which showed a significant decrease as observed with tumoral tissues.


Figure 4. [alpha](1,3) fucosyltransferase activities were measured from 2[prime]-fucosyllactose (A) in normal tissues, NP (n = 8); tumoral tissues, TP1 (n = 9); TP2 (n = 4); and in four human pancreatic cell lines, SOJ-6 (n = 4), BxPC-3 (n = 6), MiaPaCa-2 (n = 4), PANC-1 (n = 3). [alpha](1,3) fucosyltransferase activities were measured from sialyllactosamine (B) for all tissues and cell lines (n = 3) (see Materials and methods). The fucosyltransferase activity was expressed as picomoles of fucose transferred from GDP-fucose to acceptor per minute and per milligram protein. Data points represent means ± SE. The significance of difference from normal tissue values was examined using Student's t test. *, p < 0.05.

Table II. Expression of carbohydrate determinants in human pancreatic carcinoma cell lines by immunofluorescence assays
Cell lines Carbohydrate determinant
  Slex Slea Lex Lea Ley Leb H
SOJ-6 +++ ++ + +++ ++ - +
BxPC-3 ++ +++ - + + - -
MiaPaCa-2 - - - - - - -
Panc-1 + - - - - - -
Fluorescence intensity of carbohydrate determinant was graded on a 4 point scale from - (negative), + (weak), ++ (moderate), to +++ (strong).

Table III. Ratio of incorporation of [14C] fucose in type I/type II and sialylated/non-sialylated oligosaccharides by microsomal [alpha](1,3) fucosyltransferases in normal and tumoral pancreatic tissues, tumoral pancreatic cell lines and CHO-K1 cells transfected with plasmid containing FUT3 cDNA
  Lacto-N-biose/
>N-acetyllactosamine
3`-sialyl- N-acetyllactosamine/
>N-acetyllactosamine
Normal pancreatic tissues
NP 0.80 0.13
Tumoral pancreatic tissues
TP1 1.14 0.07
TP2 0.90 0.03
Tumoral pancreatic cell lines
SOJ-6 2.97 0.33
BxPC-3 1.30 0.13
MiaPaCa-2 0.35 0.06
PANC-1 0.02 0.29
Transfected cells
CHO-K1(FUT3) 4.47 0.54

Expression of carbohydrate determinant on human pancreatic carcinoma cell lines

Expression of fucosylated antigens on the pancreatic cell surface was examined by immunofluorescence. As shown in Table II, a strong expression of sialyl-Lewis x (SLex) and sialyl-Lewis a (SLea) epitopes was observed on the cell surface of SOJ-6 and BxPC-3 cells, whereas these antigens were undetectable or poorly detectable on PANC-1 and MiaPaCa-2 cells. Lewis a (Lea) and Lewis y (Ley) epitopes, which have [alpha](1,4) and [alpha](1,3) linked fucose, were strongly detected in SOJ-6 cells whereas Lewis x (Lex), Lewis b (Leb), and H epitopes were weakly present or absent. BxPC-3 cells showed a poor positive staining for Lewis a and Lewis y structures and a negative staining for Lewis x, Lewis b, and H structures. All these epitopes were absent on the surface of MiaPaCa-2 and PANC-1 cell lines. The absence of Lewis b agrees with the very low activity of [alpha](1,2) Fuc-T found in tumoral tissues and cell lines. However, this activity, due to either FUT1 or FUT2 or both, can still generate Lewis y antigen at least in SOJ-6 and BxPC-3 cells which present an elevated activity compared to MiaPaCa-2 or PANC-1 cells (see Figure 2).

Antigens which are directly dependent on [alpha](1,3) or [alpha](1,4) Fuc-T activities (Lea, SLea, Lex, SLex) are well represented, particularly Lea and SLea structures generated by FUT3. To assert this point, FUT3 cDNA was transfected into CHO-K1 cells. Microsomes of a selected clone were isolated and the FUT3 activity measured on various acceptors (FUT3 activity cannot be recorded in control CHO-K1 cells). Our results showed that FUT3 preferentially transferred fucose onto lacto-N-Biose I (380 pmol.mg-1.min-1) which is a type I structure (Kukoska-Latallo et al., 1990). However, its activity on 2[prime]-fucosyllactose was not negligible (264 pmol.mg-1.min-1), while transfer of fucose onto type II structures, N-acetyllactosamine and 3[prime]-sialyl-N-acetyllactosamine to generate Lex and SLex antigens was low (85 and 46 pmol.mg-1.min-1, respectively). Although little is known about the half-life of [alpha](1,3) fucosyltransferase proteins or their mRNA transcripts, the increased expression of SLex in SOJ-6 and BxPC-3 cells suggested that FUT3 is not the only [alpha](1,3) fucosyltransferase gene that is being expressed in these tumoral cells. The ratios of enzyme activities with type I and type II acceptors for the [alpha](1,3) Fuc-T in normal and tumoral pancreatic tissues, in cell lines and in FUT3 CHO-K1 transfected cells, are summarized in Table III. Obviously, the ratios found with type I and type II acceptors in BxPC-3 and SOJ-6 resemble most closely the ratio found in transfected CHO-K1 cells but the ratios determined for tumoral tissue is low and more or less that of normal pancreas. The ratio is even lower in MiaPaCa-2 cells which do not express Lea and Lex structures. The ratio between sialylated and nonsialylated acceptors is also presented. Once again the ratio in SOJ-6 cells resembles that in FUT3 transfected CHO-K1 cells, while it decreased in normal and tumoral pancreatic tissues.

Discussion

The expression of blood group antigens in normal pancreas and their alteration in malignant neoplasms has been reported in several studies (Magnani et al., 1983; Kim et al., 1988; Ichihara et al., 1992; Lantini and Cossu, 1997). Indeed, by a postembedding immunogold staining method, H and Lewis b antigens were found in acini and ductal cells in normal pancreas (Lantini and Cossu, 1997). In comparative immunohistochemical studies, Lewis x and sialyl-Lewis x antigens were found in pancreatic cancer tissues whereas Lewis y was detected in normal tissues suggesting that the expression of these antigens may be due to a cancer-associated regulation of [alpha](1,2) Fuc-T activities (Kim et al., 1988). However, the correlation between the expression of fucosylated carbohydrate antigens and the expression of fucosyltransferases in pancreatic tissues has not been clarified. Therefore, in this study, the presence of mRNA and the activities of [alpha](1,2), [alpha](1,3), and [alpha](1,4) Fuc-T were investigated in human normal and cancer pancreatic tissues and in pancreatic cell lines.

Fuc-T activities and immunofluorescence studies suggested that BxPC-3 and SOJ-6 cells, which are well differentiated, behaved differently than MiaPaCa-2 and PANC-1 cells which are not differentiated or have a ductal morphology, respectively. Therefore, the difference in fucosyltransferase expression could be explained by the degree of differentiation of these pancreatic cancer cells. Fuc-T activities found in tumoral pancreatic tissue behaved, indistinctly, as the former or latter cell lines.

Our results showed that transcripts of FUT3 were present in carcinoma cell lines and in normal and tumoral tissues as well. Many epithelial cancer cell lines which express the sialyl-Lewis a determinant also contained messages for FUT3 (Yago et al., 1993; Majuri et al., 1995; Mannori et al., 1995; Hanski et al., 1996; Wittig et al., 1996; Ito et al., 1997). Indeed, this enzyme is known to efficiently utilize type I chain oligosaccharides as acceptors (Kukowska-Latallo et al., 1990). This was confirmed by our studies on transfected CHO cells (Table III) in which the formation of Lewis a by FUT3 was [sim]5-fold higher than the formation of Lewis x. Our data indicated that the activity of [alpha](1,4) Fuc-T able to generate Lewis a and sialyl-Lewis a structures was very important in two cell lines, SOJ-6 and BxPC-3 (Figure 3B). These increases were related to an enhanced expression of sialyl-Lewis a on the cell surface (Table II). This expression of sialyl-Lewis a on cell surface proteins and/or lipids could be essential for the adhesion of epithelial cancer cells to activated endothelium mediated by E-selectin carbohydrate. Particularly, it has been shown that the attachment between PCI pancreas carcinoma cells and activated endothelial cells is mediated by sialyl-Lewis a in pancreas carcinoma and E-selectin in endothelial cells (Iwai et al., 1993; Kaji et al., 1995). Moreover, the level of surface sialyl-Lewis a expression of PCI cells correlates with the number of metastatic colonies in the liver (Kishimoto et al., 1996). Conversely, in colon cancer tissues, no significant relationship was observed between the amount of FUT3 messages and the expression of sialyl-Lewis a. However, the expression of sialyl-Lewis a structure was enhanced at the surface of colon cancer tissues and cancer cell lines (Yago et al., 1993; Dohi et al., 1994; Ito et al., 1997).

Antigens with [alpha](1,3) fucose can be synthesized by FUT3; however, four other [alpha](1,3) Fuc-T, i.e., FUT4, FUT5, FUT6, and FUT7, can also synthesize these structures. In this study, we showed that FUT4, FUT5, and FUT7 transcripts were present in normal and cancerous pancreatic tissues and tumoral pancreatic cell lines whereas FUT6 was only detected in pancreatic cancer tissues. Because stromal tissues were avoided during tumor sampling (only the core of the tumor was taken) we believe that FUT6 expression is specific of pancreatic cancer. Interestingly FUT6 was recovered in normal epithelial cells of liver and kidney (Cameron et al., 1995; Johnson et al., 1995) whereas it is not expressed in normal pancreas. This observation indicates that the expression of this fucosyltranferase is tissue specific. It has now been established that FUT4 contributes to the synthesis of Lewis x and Lewis y determinants (Lowe et al., 1991). The frequent occurrence of FUT4 mRNA in various cancer cell lines has been previously described (Yago et al., 1993; Wittig et al., 1996). Since FUT4 was not expressed in normal tissues, it has been postulated that the expression of this enzyme could be related to the retrodifferentiation associated with tumorigenesis (Mollicone et al., 1992). In our study, the presence of FUT4 mRNA was observed in tumoral tissues but also in all normal pancreatic tissues. This result could explain the high expression of Lewis y antigen in normal pancreatic tissue (Kim et al., 1988; Ichihara et al., 1992). FUT5, FUT6, and FUT7 all contribute to the synthesis of Lewis x and sialyl-Lewis x. Among these structures, sialyl-Lewis x is an important determinant for cell adhesion and metastasis (Natsuka et al., 1994; Sasaki et al., 1994). In our [alpha](1,3) Fuc-T assays, no significant modification in the formation of Lewis x and sialyl-Lewis x structures between normal and tumoral tissues and cell lines was observed. In tumoral cell lines, we were unable to detect a significant correlation between [alpha](1,3) Fuc-T activities and sialyl-Lewis x expression on the cell surface. The sialyl-Lewis x antigen was expressed preferentially on SOJ-6 and BxPC-3 cell lines but was not detected on PANC-1 and MiaPaCa-2 cell lines, suggesting that several [alpha](1,3) Fuc-T are involved in sialyl-Lewis x synthesis. These data corroborate results reported by Witting et al. (1996), who suggest that, in gastrointestinal tumor cells, the sialyl-Lewis x determinant could be generated by at least two different [alpha](1,3) Fuc-T.

Lewis b, Lewis y, and H antigens were expressed in normal pancreas whereas Lewis x, sialyl-Lewis x, and sialyl-Lewis a were principally detected in pancreatic cancer tissues (Ichihara et al., 1992; Yago et al., 1993; Lantini and Cossu, 1997). Two [alpha](1,2) fucosyltransferases cDNA have been isolated and cloned (Larsen et al., 1990; Kelly et al., 1995). FUT1 gene encodes for the [alpha](1,2) fucosyltransferase making the H-type II antigen found on red cells and vascular endothelium. FUT2, the secretor gene product, is responsible for the expression of the [alpha](1,2) Fuc-T activity in exocrine secretions (Mollicone et al., 1994). Our results indicated that FUT1 and FUT2 are expressed in pancreatic tissues and that no difference is observed in their mRNA expression between the normal and tumoral pancreatic tissues or cells lines. However, a significant decrease in [alpha](1,2) Fuc-T activity was observed in tumoral material compared to normal tissue. This decrease was detected not only with phenyl [beta]-d-galactoside acceptor (Figure 2) but also with lacto-N-biose and N-acetyllactosamine assays where H-type I and H-type II determinants were detected after TLC. Our results correlated with those found by Kim et al. (1988). The amount of messages specific for FUT1 and FUT2 is certainly a determinant factor and a downregulation of their expression cannot be ruled out. A recent study has identified several forms of the FUT1 transcript generated by two transcription start codons and alternative splicing of 5[prime]-untranslated exons in several tumor cell lines (Koda et al., 1997a). These authors suggested that dual promoters regulated the stage- and tissue-specific expression of the FUT1 transcript and thus regulated the expression of blood related antigens in many human tissues. They detected in ovarian, gastric, and colonic cancer cell lines the presence of a large stem- and loop-structure in the 3[prime] untranslated region which may regulate the level of the FUT2 transcript by affecting the stability of the mRNA (Koda et al., 1997b). This decrease of [alpha](1,2) Fuc-T activity in pancreatic tumoral tissues and cell lines, in correlation with [alpha](2,3) sialyltransferase, [alpha](1,3) Fuc-T, and [alpha](1,4) Fuc-T activities could favor the expression of sialyl-Lewis x and sialyl-Lewis a determinants on the cell surface. Indeed, a recent study comparing the type of glycans synthesized by CHO cells expressing FUT1 with parental CHO cells lacking FUT1 showed that FUT1 fucosylates preferentially polylactosamine sequences in these cells, resulting in decreased [alpha](2,3) sialylation of polylactosamine structures (Prieto et al., 1997). Gorelik et al. and Goupille et al. have transfected BL6 melanoma cells and rat colon carcinoma cell lines, respectively, with FUT1 cDNA and observed a decrease of N-acetyllactosamine sialylation suggesting a competition between [alpha](1,2) Fuc-T and [alpha](2,3) or [alpha](2,6) sialyltransferases for the common substrate N-acetyllactosamine on the N-linked carbohydrate chain of glycoproteins and glycolipids.

The expression of sialyl-Lewis x and sialyl-Lewis a antigens in pancreas could be controlled not only by [alpha](1,3) and [alpha](1,4) fucosyltransferases but also by a more complicated system involving [alpha](1,2) fucosyltransferases and [alpha](2,3) sialyltransferases. An investigation concerning the amounts of these glycosyltransferases in normal and cancerous human pancreatic tissues and cell lines would be required to gain more information concerning the regulation of the expression of sialyl-Lewis determinants on the cell surface implicated in cell adhesion and metastasis.

Materials and methods

Nomenclature

We used the new international nomenclature created by the Genome Data Bank and recently reviewed in Costache et al. (1997) for the human fucosyltransferases cloned: FUT1 for the H [alpha]-2-fucosyltransferase, FUT2 for the secretor [alpha]-2-fucosyltransferase, FUT3 for the Lewis [alpha]-3/4-fucosyltransferase, FUT4 for the myeloid [alpha]-3-fucosyltransferase, FUT5 for the [alpha]-3-fucosyltransferase, FUT6 for the plasma [alpha]-3-fucosyltransferase, and FUT7 for the leukocyte [alpha]-3-fucosyltransferase.

Chemicals and reagents

RPMI 1640 medium, Dulbecco's modified Eagle medium (DMEM), glutamine, penicillin, streptomycin, G418, trypsin-EDTA, fungizone, and fetal calf serum were purchased from Gibco (Cergy-Pontoise, France). Paraformaldehyde was from Fluka (Buchs, Switzerland). Agarose was from Amresco (Solon, OI, USA). Benzamidine, BSA, AMP, GDP-fucose, 2[prime]-fucosyllactose, N-acetyllactosamine, lacto-N-biose, phenyl [beta]-d-galactoside, deoxyfuconojirimycin, and BstU I restriction enzyme were obtained from Sigma (St. Louis, MO). Nae I restriction enzyme was from Promega (Madison, WI, USA). 3[prime]-sialyl-N-acetyllactosamine was for Oxford Glycosystems (Abington, UK). Triton X-100 was from Pierce (Rockford, IL). GDP-[14C]fucose was from NEN (Les Ullis, France) and PCS from Amersham (Les Ullis, France).

Biological materials

Normal human pancreatic tissues came from four donors (females and males aged 60-65) and cancer tissues were from two patients (females, age-matched with normal donors) suffering from pancreatic adenocarcinoma. Diagnosis was confirmed by histological examination during the time-course of surgery. All tissues were a generous gift from Prof. J. R. Delpéro (Institut Paoli-Calmettes, Marseille. France). Tissue samples were immediately frozen in liquid nitrogen and stored at -80°C until use. Each sample was divided in half. One for RNA extraction and the other for microsome preparation and Fuc-T assays.

Cell lines

Human pancreatic carcinoma cell lines BxPC-3 (Tan et al., 1986), MiaPaCa-2 (Yunis et al., 1977), and PANC-1 (Lieber et al., 1975) were obtained from the American Type Culture Collection (Rockville, MD). SOJ-6 (Fujii et al., 1990) cell line was kindly provided by Dr. M. J. Escribano (INSERM-U. 260, Marseille, France).

BxPC-3 and SOJ-6 cells were grown in RPMI 1640 medium whereas MiaPaCa-2 and PANC-1 cells were cultured in DMEM. Mediums were supplemented with 10% fetal calf serum, 2 mM glutamine, penicillin (100 U/min), streptomycin (100 µg/ml), and fungizone (0.1%). The cells were kept at 37°C in an humidified atmosphere of 95% O2 and 5% CO2.

Preparation of cell and tissue extracts

Cells were washed in PBS, harvested with a rubber policeman, washed once again in PBS, and pelleted by centrifugation. Human pancreatic tissues and cell pellets were homogenized with a Polytron (Kinematica AG, Switzerland) in 10 mM Tris-HCl buffer (pH 7.0) containing 250 mM sucrose and 5 mM benzamidine. These homogenates were clarified by centrifugation at 1000 × g for 10 min at 4°C and microsomes were isolated as previously described (Dohi et al., 1994). Microsomes were either immediately assayed or were stored at -20°C until use. The concentration of protein was determined using the bicinchoninic acid assay (Pierce-Rockford, IL) using BSA as standard.

Fucosyltransferase assays

Standard assays were performed in 50 µl final volume of 10 mM Tris/HCl pH 7.0 buffer (0.25% Triton X-100, 10 mM AMP, 10 mM MnCl2), containing 65 µM GDP-[14C]fucose (0.62 GBq/mmol) and 50 µg of microsomal proteins. Acceptor substrates (N-acetyllactosamine, 20 mM, lacto-N-biose, 20 mM; 2[prime]-fucosyllactose, 5 mM; 3[prime]-sialyl-N-acetyllactosamine, 5 mM or phenyl [beta]-d-galactoside, 25 mM) were then added and the mixture incubated for 2 h at 37°C. The reaction was terminated by the addition of 50 µl of ethanol and 500 µl of water. The reaction mixture was centrifuged for 5 min at 10,000 × g in a bench-top centrifuge and an aliquot of the supernatant was counted (LKB scintillation counter) using PCS scintillation fluid. When N-acetyllactosamine, lacto-N-biose, 3[prime]-sialyl-N-acetyllactosamine, and 2[prime]-fucosyllactose were used as acceptors, 500 µl of the centrifuged mixture were applied to a 1 ml column of AG 1-X8 resin (200-400 mesh, formate form, Bio-Rad, Richmond, CA) and radiolabeled products were eluted with 2 ml of water and counted. When phenyl [beta]-d-galactoside was used as fucose acceptor, the radiolabeled reaction product was isolated by chromatography on preconditioned reverse-phase Sep-Pak C18 cartridges (Waters-Millipore Corporation, Milford, MA). After extensive washing with water (3x2 ml), the fucosylated product was eluted with acetonitrile/water (1:1 by vol) and counted.

All extracts were assayed in the absence of exogenous acceptor to determine endogenous activities. Enzyme specific activity was defined as picomoles of fucose transferred from GDP-fucose to a specific acceptor per minute and per milligram of microsomal protein. Controls were performed in the presence of 30 mM of deoxyfuconojirimycin, an inhibitor of fucosidase (Winchester et al., 1990).

Thin layer chromatography

Products obtained by enzymatic reactions, as described above, were analyzed by thin layer chromatography. For this purpose, samples were freeze-dried and reconstituted with 10 µl of water. They were then dotted onto 20 × 20 cm precoated cellulose plates (Merck, Darmstadt, Germany). Product separation was performed using ethylacetate/pyridine/acetic acid/water (12:17:3:8, by vol) as developing solvent for 7 h at room temperature. After development, plates were scanned on a radiochromatogram scanner (Automate TLC-linear analyzer LB2832, Berthold, France) using a 2.5 cm wide lane. Spots were identified using radiolabeled standards (Lewis a, Lewis x, fucosyl-type I, and fucosyl-type II structures) synthesized in our laboratory.

Antibodies

Anti SLex (clone KM-93) was from Seikagaku (Tokyo, Japan), and anti SLea (clone C241) was a generous gift from Dr. Ke-Zhang, University of Göteborg (Sweden). Anti Leb (clone 2-25 LE), anti Lea (clone 7-LE), anti Ley (clone12-4 LE), and anti H type II (clone 19-0-LE) were generously donated by Dr. Jacques Bara (Hospital St Antoine, Paris, France). Anti Lex (clone SH 1) was a gift from Dr. Else K. Philipsen (Sankt Elisabeth Hospital, Kobenhaum, Denmark). Anti H (clone HMS2 1101A4) was obtained from Sanofi Diagnostic Pasteur (Marne-la-Coquette, France).

Detection of fucosyltransferase transcripts by RT-PCR

Total RNA from cultured cells and tissues was isolated following standard protocols (Chirgwin et al. 1979). Five micrograms of the isolated RNA were submitted to Reverse Transcription System (Promega, Madison, WI) using oligodeoxythymidylic acid15 primer and AMV reverse transcriptase for first-strand cDNA synthesis. The sequence of primers used for PCR are given in Table I. The primers for FUT4 and FUT7 have been described by Yago et al. (1993) and Natsuka et al. (1995), and those specific for FUT1, FUT2, FUT3, FUT5, and FUT6 were deduced from cDNA sequences (Kukoska-Latallo et al., 1990; Larsen et al., 1990; Lowe et al., 1991; Koszdin et al.,1992; Weston et al., 1992a; Kelly et al., 1995). Second strand synthesis and amplification were carried out in a Gene AmpPCR System 2400 (PE Applied Biosystem, Roissy, France) on 2 µl of the first strand synthesis mixture in a final volume of 50 µl containing 5 µl 10× PCR buffer (10 mM Tris-HCl pH 9, 50 mM KCl, 1.5 mM MgCl2), 0.35 mM dNTP, 50 pmol of sense and anti-sense primers, and 2 units of Taq DNA polymerase (Appligene Oncor, Illkirch, France) under the following conditions: 94°C for 2 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 52-55°C (depending on primers used) for 30 s, and extension at 68°C for 1 min, 35 cycles. Extension was terminated by incubation at 68°C for 7 min. A reaction without cDNA or RT product was performed as negative control to exclude the possibility of amplification of contaminating genomic DNA. Positive control reactions consisted of the amplification of [beta]-actin using specific primers (Clontech, Palo Alto, CA) to confirm first-strand cDNA synthesis. Aliquots of each reaction were analyzed by electrophoresis on a 1.5% agarose gel. The amplification of FUT3 fragment was ascertained by digestion with Nae I and BstU I restriction enzymes which cleaved FUT5 and FUT6 transcripts but not the FUT3 fragment (see Results).

Transfection

pCDM 7 plasmids containing human [alpha](1,3/1,4) Fuc-T cDNA have been described previously (Kukoska-Latallo et al., 1990). CHO cells were cotransfected with pCDM 7 and pcDNA 3 plasmids (Invitrogen, Leek, Netherlands) using lipofectin reagent (Gibco BRL, Bethesda, MD). The latter plasmid confers G418 resistance to transfected cells. Cells resistant to 0.4 mg/ml G418, but expressing the sialyl-Lewis antigen, were cloned and subsequently cultured in Ham's F12 medium supplemented as described above.

Immunofluorescence

Detection of fucosylated oligosaccharide epitopes on the surface of human pancreatic cell lines was carried out by indirect fluorescence under the following conditions: cells grown to 50% confluence on sterile coverslides were washed three times in PBS and fixed with 0.5% paraformaldehyde in PBS for 10 min at room temperature. Cells were washed extensively with 1% BSA in PBS at 4°C. Oligosaccharide epitopes were detected by incubation (1 h) with specific antibodies (see above), washed three times with PBS, and finally incubated for 30 min with fluorescein-labeled anti-mouse Ig as secondary antibody (Sigma, St. Louis, MO). After staining, coverslides were washed and mounted and the immunofluorescence was observed on a BH2-RFCA Olympus microscope.

Acknowledgments

This work was financed in part with a grant awarded by the Association pour la Recherche sur le Cancer (ARC, Villejuif, France) and financial support from Conseil Général des Bouches du Rhône (Marseille, France). Eric Mas is the recipient of a postdoctoral fellowship from Société de Secours des Amis des Sciences (Paris, France). We are grateful to Dr. John B. Lowe (University of Michigan, Ann Arbor, MI) for the gift of pCDM7-FUT3 vector. Dr. F. Haigler is acknowledged for reviewing the manuscript.

Abbreviations

Fuc-T, fucosyltransferase; RT-PCR, reverse transcriptase mediated polymerase chain reaction; cDNA, complementary DNA; PBS, phosphate-buffered saline solution; BSA, bovine serum albumin; phenyl [beta]-d-galactoside, Gal [beta]-O-phenyl; 2[prime]-fucosyllactose, Fuc[alpha]1->2Gal[beta]1->4Glc; N-acetyllactosamine, Gal[beta]1->4GlcNAc; lacto-N-biose, Gal[beta]1->3GlcNAc; 3[prime]-sialyl-N-acetyllactosamine, NeuAc[alpha]2->3Gal[beta]1->4GlcNAc; sialyl-Lewis a, SLea, NeuAc[alpha]2->3Gal[beta]1->3[Fuc[alpha]1->4]GlcNAc[beta]1->R; sialyl-Lewis x, SLex, NeuAc[alpha]2->3Gal[beta]1->4[Fuc[alpha]1->3]GlcNAc[beta]1->R; Lewis a, Lea, Gal[beta]1->3[Fuc[alpha]1->4]GlcNAc[beta]1->R; Lewis b, Leb, Fuc[alpha]1->2Gal[beta]1->3[Fuc[alpha]1->4]GlcNAc[beta]1->R; Lewis x, Lex, Gal- [beta]1->4[Fuc[alpha]1->3]GlcNAc[beta]1->R; Lewis y, Ley, Fuc[alpha]1->2Gal[beta]1->4[Fuc[alpha]1->3]GlcNAc[beta]1->R; H-type II, Fuc[alpha]1->2Gal-[beta]1->4GlcNAc[beta]1->R; H-type I, Fuc[alpha]1->2Gal[beta]1->3GlcNAc[beta]1->R; lactodifucotetraose, Fuc[alpha]1->2Gal[beta]1->4[Fuc[alpha]1->3]Glc; GDP-fucose, guanosine diphosphate fucose; AMP, adenosine monophosphate; TLC, thin layer chromatography.

References

Cameron,H.S., Szczepaniak,D. and Weston,B.W. (1995) Expression of human chromosome 19p alpha (1,3)-fucosyltranferase genes in normal tissues. Alternative splicing, polyadenylation, and isoforms. J. Biol. Chem., 270, 20112-20122. MEDLINE Abstract

Chirgwin,J.M., Pryzbyla,A.E., MacDonald,R.J. and Rutter,W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, 18, 5294-5299. MEDLINE Abstract

Chu,T.M. (1997) Molecular diagnosis of pancreas carcinoma. J. Clin. Lab. Anal., 11, 225231. MEDLINE Abstract

Costache,M., Cailleau,A., Fernandez-Mateos,P., Oriol,R. and Mollicone,R. (1997) Advances in molecular genetics of alpha-2- and alpha-3/4-fucosyltransferases. Transfus Clin. Biol., 4, 367-382. MEDLINE Abstract

Dohi,T., Hashiguchi,M., Yamamoto,S., Morita,H. and Oshima,M. (1994) Fucosyltransferase producing sialyl Le(a) and sialyl Le(x) carbohydrate antigen in benign and malignant gastrointestinal mucosa. Cancer, 73, 1552-1561. MEDLINE Abstract

Fujii,Y., Sekiguchi,M., Shiroko,Y., Shimizu,H., Sugawara,I., Hasumi,K.,Eriguchi,M., Ikeuchi,T. and Uchida,H. (1990) Establishment and characterization of human pancreatic adeno-carcinoma cell line SOJ producing carcinoembryonic antigen and carbohydrate antigen 19-9. Hum. Cell, 3, 31-36. MEDLINE Abstract

Gansauge,S., Gansauge,F. and Beger,H.G. (1996) Molecular oncology in pancreatic cancer. J. Mol. Med., 74, 313-320. MEDLINE Abstract

Gorelik,E., Xu,F., Henion,T., Anaraki,F. and Galili,U. (1997) Reduction of metastatic properties of BL6 melanoma cells expressing terminal fucose(alpha)1-2-galactose after alpha1,2-fucosyltransferase cDNA transfection. Cancer Res., 57, 332-336. MEDLINE Abstract

Goupille,C., Hallouin,F., Meflah,K. and Le Pendu,J. (1997) Increase of rat colon carcinoma cells tumorigenicity by alpha(1-2) fucosyltransferase gene transfection. Glycobiology, 7, 221-229. MEDLINE Abstract

Hakomori,S. (1989) Aberrant glycosylation in tumors and tumor-associated carbohydrate antigens. Adv. Cancer Res., 52, 257-331. MEDLINE Abstract

Hakomori,S. and Kannagi,R. (1983) Glycosphingolipids as tumor-associated and differentiation markers. J. Natl. Cancer Inst., 71, 231-251. MEDLINE Abstract

Hanski,C., Klussmann,E., Wang,J., Bohm,C., Ogorek,D., Hanski,M.L., Krugerkrasagakes,S., Eberle,J., Schmittgraff,A. and Riecken,E.O. (1996) Fucosyltransferase III and sialyl Le(x) expression correlate in cultured colon carcinoma cells but not in colon carcinoma tissue. Glycoconjugate J., 13, 727-733.

Ichihara,T., Sakamoto,J., Nakao,A., Furukawa,K., Watanabe,T., Suzuki,N., Horisawa,M., Nagura,H., Lloyd,K.O. and Takagi,H. (1993) Expression of blood group-related antigens in normal and malignant pancreatic tissue correlated with genotype of the patient defined by saliva glycoprotein. Cancer, 71, 71-81. MEDLINE Abstract

Ito,H., Hiraiwa,N., SawadaKasugai,M., Akamatsu,S., Tachikawa,T., Kasai,Y., Akiyama,S., Ito,K., Takagi,H. and Kannagi,R. (1997) Altered mRNA expression of specific molecular species of fucosyl- and sialyl-transferases in human colorectal cancer tissues. Int. J. Cancer, 71, 556-564. MEDLINE Abstract

Iwai,K., Ishikura,H., Kaji,M., Sugiura,H., Ishizu,A., Takahashi,C., Kato,H., Tanabe,T. and Yoshiki,T. (1993) Importance of E-selectin (ELAM-1) and sialyl Lewis(a) in the adhesion of pancreatic carcinoma cells to activated endothelium. Int. J. Cancer, 54, 972-977. MEDLINE Abstract

Johnson,P.H., Donald,A.S., Clarke,J.L. and Watkins,W.M. (1995) Purification, properties and possible gene assignment of an alpha 1,3-fucosyltransferase expressed in human liver. Glycoconjugate J., 12, 879-893.

Kaji,M., Ishikura,H., Kishimoto,T., Omi,M., Ishizu,A., Kimura,C., Takahashi,T., Kato,H. and Yoshiki,T. (1995) E-Selectin expression induced by pancreas-carcinoma-derived interleukin-1 alpha results in enhanced adhesion of pancreas-carcinoma cells to endothelial cells. Int. J. Cancer, 60, 712-717. MEDLINE Abstract

Kelly,R.J., Rouquier,S., Giorgi,D., Lennon,G.G. and Lowe,J.B. (1995) Sequence and expression of a candidate for the human Secretor blood group alpha(1,2)fucosyltransferase gene (FUT2). J. Biol. Chem., 270, 4640-4649. MEDLINE Abstract

Kim,Y.S., Itzkowitz,S.H., Yuan,M., Chung,Y., Satake,K., Umeyama,K. and Hakomori,S. (1988) Lex and Ley antigen expression in human pancreatic cancer. Cancer Res., 48, 475-482. MEDLINE Abstract

Kishimoto,T., Ishikura,H., Kimura,C., Takahashi,T., Kato,H. and Yoshiki,T. (1996) Phenotypes correlating to metastatic properties of pancreas adenocarcinoma in vivo: the importance of surface sialyl Lewis(a) antigen. Int. J. Cancer, 69, 290-294. MEDLINE Abstract

Koda,Y., Soejima,M. and Kimura,H. (1997a) Structure and expression of H-type GDP-l-fucose:beta-d-galactoside 2-alpha-l-fucosyltransferase gene (FUT1). Two transcription start sites and alternative splicing generate several forms of FUT1 mRNA. J. Biol. Chem., 272, 7501-7505. MEDLINE Abstract

Koda,Y., Soejima,M., Wang,B. and Kimura,H. (1997b) Structure and expression of the gene encoding secretor-type galactoside 2-alpha-l-fucosyltransferase (FUT2). Eur. J. Biochem., 246, 750-755. MEDLINE Abstract

Koszdin,K.L. and Bowen,B.R. The cloning and expression of a human alpha-1,3 fucosyltransferase capable of forming the E-selectin ligand. (1992) Biochem. Biophys. Res. Commun., 187, 152-157. MEDLINE Abstract

Kukowska-Latallo,J.F., Larsen,R.D., Nair,R.P. and Lowe,J.B. (1990) A cloned human cDNA determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group alpha(1,3/1,4) fucosyltransferase. Genes Dev., 4, 1288-1303. MEDLINE Abstract

Kumar,R., Potvin,B., Muller,W.A. and Stanley,P. (1991) Cloning of a human [alpha](1,3)fucosyltransferase gene that encodes ELFT but does not confer ELAM-1 recognition on Chinese hamster ovary cell transfectants. J. Biol. Chem., 266, 21777-21783. MEDLINE Abstract

Lantini,M.S. and Cossu,M. (1997) Ultrastructural localization of blood group antigens in human exocrine pancreas by immunogold labelling. J. Submicrosc. Cytol. Pathol., 29, 245-251. MEDLINE Abstract

Larsen,R.D., Ernst,L.K., Nair,R.P. and Lowe,J.B. (1990) Molecular cloning, sequence, and expression of a human GDP-L-fucose:beta-d-galactoside 2-alpha-d-fucosyltransferase cDNA that can form the H blood group antigen. Proc. Natl. Acad. Sci. USA, 87, 6674-6678. MEDLINE Abstract

Lieber,M., Mazzetta,J., Nelson-Rees,W., Kaplan,M. and Todaro,G. (1975) Establishment of a continuous tumor-cell line (panc-1) from a human carcinoma of the exocrine pancreas. Int. J. Cancer, 15, 741-747. MEDLINE Abstract

Lowe,J.B., Stoolman,L.M., Nair,R.P., Larsen,R.D., Berhend,T.L. and Marks,R.M. (1990) ELAM-1 dependent cell adhesion to vascular endothelium determined by a transfected human fucosyltransferase cDNA. Cell, 63, 475-484. MEDLINE Abstract

Lowe,J.B., Kukowska-Latallo,J.F., Nair,R.P., Larsen,R.D., Marks,R.M., Macher,B.A., Kelly,R.J. and Ernst,L.K. (1991) Molecular cloning of a human fucosyltransferase gene that determines expression of the Lewis x and VIM-2 epitopes but not ELAM-1-dependent cell adhesion. J. Biol. Chem., 266, 17467-17477. MEDLINE Abstract

Magnani,J.L., Steplewski,Z., Koprowski,H. and Ginsburg,V. (1983) Identification of the gastrointestinal and pancreatic cancer-associated antigen detected by monoclonal antibody 19-9 in the sera of patient as mucin. Cancer Res., 43, 5489-92. MEDLINE Abstract

Majuri,M.L., Niemela,R., Tiisala,S., Renkonen,O. and Renkonen,R. (1995) Expression and function of alpha 2,3-sialyl- and alpha 1,3/1,4-fucosyltransferases in colon adenocarcinoma cell lines: role in synthesis of E-selectin counter-receptors. Int. J. Cancer, 63, 551-559. MEDLINE Abstract

Mannori,G., Crottet,P., Cecconi,O., Hanasaki,K., Aruffo,A., Nelson,R.M., Varki,A. and Bevilacqua,M.P. (1995) Differential colon cancer cell adhesion to E-, P-, and L-selectin: role of mucin-type glycoproteins. Cancer Res., 55, 4425-4431. MEDLINE Abstract

Mollicone,R., Candelier,J.J., Mennesson,B., Couillin,P., Venot,A.P. and Oriol,R. (1992) Five specificity pattern of (1-3)-[alpha]-l-fucosyltransferase activity defined by use of synthetic oligosaccharide acceptors. Differential expression of the enzymes during human embryonic development and in adult tissues. Carbohydrate Res., 228, 265-276.

Mollicone,R., Candelier,J.J., Reguigne,I., Couillin,P., Fletcher,A. and Oriol,R. (1994) Molecular genetics of alpha-L-fucosyltransferase genes (H, Se, Le, FUT4, FUT5 and FUT6). Transfus. Clin. Biol., 1, 91-97. MEDLINE Abstract

Natsuka,S., Gersten,K.M., Zenita,K., Kannagi,R. and Lowe,J.B. (1994) Molecular cloning of a cDNA encoding a novel human leucocyte alpha 1,3-fucosyltransferase capable of synthesizing the sialyl-Lewis x determinant. J. Biol. Chem., 269, 16789-16794. MEDLINE Abstract

Phillips,M.L., Nudelman,E., Gaeta,F.C., Perez,M., Singhal,A.K., Hakomori,S. and Paulson,J.C. (1990) ELAM-1 mediates cell adhesion by recognition of a carbohydrate ligand, sialyl-Lex. Science, 250, 1130-1132. MEDLINE Abstract

Poston,G.J., Gillespie,J. and Guillou,P.J. (1991) Biology of pancreatic cancer. Gut, 32, 800-812. MEDLINE Abstract

Prieto,P.A., Larsen,R.D., Cho,M., Rivera,H.N., Shilatifard,A., Lowe,J.B., Cummings,R.D. and Smith,D.F. (1997) Expression of human H-type alpha1,2-fucosyltransferase encoding for blood group H(O) antigen in Chinese hamster ovary cells. Evidence for preferential fucosylation and truncation of polylactosamine sequences. J. Biol. Chem., 272, 2089-2097. MEDLINE Abstract

Sasaki,K., Kurata,K., Funayama,K., Nagata,M., Watanabe,E., Ohta,S., Hanai,N. and Nishi,T. (1994) Expression cloning of a novel alpha 1,3-fucosyltransferase that is involved in biosynthesis of the sialyl Lewis x carbohydrate determinants in leukocytes. J. Biol. Chem., 269, 14730-14737. MEDLINE Abstract

Takada,A., Ohmori,K., Yoneda,T., Tsuyuoka,K., Hasegawa,A., Kiso,M. and Kannagi,R. (1993) Contribution of carbohydrate antigens sialyl Lewis A and sialyl Lewis x to adhesion of human cancer cells to vascular endothelium. Cancer Res., 53, 354-361. MEDLINE Abstract

Takada,M., Yamamoto,M., Hasegawa,Y. and Saitoh,Y. (1995) Endothelial leukocyte adhesion molecule-1-mediated vasoinvasion of human pancreatic adenocarcinoma. J. Surg. Res., 59, 653-657. MEDLINE Abstract

Tan,M.H., Nowak,N.J., Loor,R., Ochi,H., Sandberg,A.A., Lopez,C., Pickren,J.W., Berjian,R., Douglass,H.O. and Chu,T.M. (1986) Characterization of a new primary human pancreatic tumor line. Cancer Invest., 4, 15-23. MEDLINE Abstract

Varki,A. (1994) Selectin ligands. Proc. Natl. Acad. Sci. USA, 91, 7390-7397. MEDLINE Abstract

Walz,G., Aruffo,A., Kolanus,W., Bevilacqua,M. and Seed,B. (1990) Recognition by ELAM-1 of the sialyl-Lex determinant on myeloid and tumor cells. Science, 250, 1132-1135. MEDLINE Abstract

Weston,B.W., Nair,R.P., Larsen,R.D. and Lowe,J.B. (1992a) Isolation of a novel human alpha (1,3)fucosyltransferase gene and molecular comparison to the human Lewis blood group alpha (1,3/1,4)fucosyltransferase gene. J. Biol. Chem., 267, 4152-4160. MEDLINE Abstract

Weston,B.W., Smith,P.L., Kelly,R.J. and Lowe,J.B. (1992b) Molecular cloning of a fourth member of a human alpha-1,3 fucosyltransferase gene family. J. Biol. Chem., 267, 24575-24584. MEDLINE Abstract

Winchester,B., Barker,C., Baines,S., Jacob,G.S., Namgoong,S.K. and Fleet,G. (1990) Inhibition of alpha-l-fucosidase by derivatives of deoxyfuconojirimycin and deoxymannojirimycin. Biochem. J., 265, 277-282. MEDLINE Abstract

Wittig,B.M., Thees,R., Kaulen,H., Gott,K., Bartnik,E., Schmitt,C., Meyer Zum Büschenfelde,K.H. and Dippold,W. (1996) Alpha(1,3)fucosyltransferase expression in E selectin-mediated binding of gastrointestinal tumor cells. Int. J. Cancer, 67, 80-85. MEDLINE Abstract

Yago,K., Zenita,K., Ginya,H., Sawada,M., Ohmori,K., Okuma,M., Kannagi,R. and Lowe,J.B. (1993) Expression of alpha-(1,3)-fucosyltransferases which synthesize sialyl Le(x) and sialyl Le(a), the carbohydrate ligands for E- and P-selectins, in human malignant cell lines. Cancer Res., 53, 5559-5565. MEDLINE Abstract

Yunis,A.A., Arimura,G.K. and Russin,D. (1977) Human pancreatic carcinoma (MIA PaCa-2) in continuous culture: sensitivity to asparaginase. Int. J. Cancer, 19, 218-235. MEDLINE Abstract


1To whom correspondence should be addressed


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 18 May 1998
Copyright©Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. R. Barthel, G. K. Wiese, J. Cho, M. J. Opperman, D. L. Hays, J. Siddiqui, K. J. Pienta, B. Furie, and C. J. Dimitroff
Alpha 1,3 fucosyltransferases are master regulators of prostate cancer cell trafficking
PNAS, November 17, 2009; 106(46): 19491 - 19496.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
L. Benkoel, J.-P. Bernard, M.-J. Payan-Defais, L. Crescence, C. Franceschi, M. Delmas, M. Ouaissi, B. Sastre, J. Sahel, A.-M. Benoliel, et al.
Monoclonal antibody 16D10 to the COOH-terminal domain of the feto-acinar pancreatic protein targets pancreatic neoplastic tissues
Mol. Cancer Ther., February 1, 2009; 8(2): 282 - 291.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
S. R Barthel, J. D Gavino, G. K Wiese, J. M Jaynes, J. Siddiqui, and C. J Dimitroff
Analysis of glycosyltransferase expression in metastatic prostate cancer cells capable of rolling activity on microvascular endothelial (E)-selectin
Glycobiology, October 1, 2008; 18(10): 806 - 817.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
Z. Kyselova, Y. Mechref, P. Kang, J. A. Goetz, L. E. Dobrolecki, G. W. Sledge, L. Schnaper, R. J. Hickey, L. H. Malkas, and M. V. Novotny
Breast Cancer Diagnosis and Prognosis through Quantitative Measurements of Serum Glycan Profiles
Clin. Chem., July 1, 2008; 54(7): 1166 - 1175.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
M.-O. Sadoulet, C. Franceschi, M. Aubert, F. Silvy, J.-P. Bernard, D. Lombardo, and E. Mas
Glycoengineering of {alpha}Gal xenoantigen on recombinant peptide bearing the J28 pancreatic oncofetal glycotope
Glycobiology, June 1, 2007; 17(6): 620 - 630.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
N. Tokuda, Q. Zhang, S. Yoshida, S. Kusunoki, T. Urano, K. Furukawa, and K. Furukawa
Genetic mechanisms for the synthesis of fucosyl GM1 in small cell lung cancer cell lines
Glycobiology, October 1, 2006; 16(10): 916 - 925.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
W. Chen, J. Tang, and P. Stanley
Suppressors of {alpha}(1,3)fucosylation identified by expression cloning in the LEC11B gain-of-function CHO mutant
Glycobiology, March 1, 2005; 15(3): 259 - 269.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
R. Peracaula, L. Royle, G. Tabares, G. Mallorqui-Fernandez, S. Barrabes, D. J. Harvey, R. A. Dwek, P. M. Rudd, and R. de Llorens
Glycosylation of human pancreatic ribonuclease: differences between normal and tumor states
Glycobiology, April 1, 2003; 13(4): 227 - 244.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
V Gouyer, E Leteurtre, P Delmotte, W. Steelant, M. Krzewinski-Recchi, J. Zanetta, T Lesuffleur, G Trugnan, P Delannoy, and G Huet
Differential effect of GalNAc(&agr;)-O-bn on intracellular trafficking in enterocytic HT-29 and Caco-2 cells: correlation with the glycosyltransferase expression pattern
J. Cell Sci., January 4, 2001; 114(8): 1455 - 1471.
[Abstract] [PDF]


Home page
Cancer Res.Home page
M. Aubert, L. Panicot, C. Crotte, P. Gibier, D. Lombardo, M.-O. Sadoulet, and E. Mas
Restoration of {{alpha}}(1,2) Fucosyltransferase Activity Decreases Adhesive and Metastatic Properties of Human Pancreatic Cancer Cells
Cancer Res., March 1, 2000; 60(5): 1449 - 1456.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. Zhang, B. Potvin, A. Zaiman, W. Chen, R. Kumar, L. Phillips, and P. Stanley
The Gain-of-Function Chinese Hamster Ovary Mutant LEC11B Expresses One of Two Chinese Hamster FUT6 Genes Due to the Loss of a Negative Regulatory Factor
J. Biol. Chem., April 9, 1999; 274(15): 10439 - 10450.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (40)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Mas, E.
Right arrow Articles by Sadoulet, M. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mas, E.
Right arrow Articles by Sadoulet, M. O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?