Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Bennett, E. P.
Right arrow Articles by Clausen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bennett, E. P.
Right arrow Articles by Clausen, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology Pages 547-555  

Genomic organization and chromosomal localization of three members of the UDP-N-acetylgalactosamine: polypeptide N-acetylgalactosaminyltransferase family
Introduction
Results
Discussion
Material and methods
Acknowledgments
Abbreviations
References

Genomic organization and chromosomal localization of three members of the UDP-N-acetylgalactosamine: polypeptide N-acetylgalactosaminyltransferase family

Genomic organization and chromosomal localization of three members of the UDP-N-acetylgalactosamine: polypeptide N-acetylgalactosaminyltransferase family

Eric Paul Bennett, Daniël Olde Weghuis1, Gerard Merkx1, Ad Geurts van Kessel1, Hans Eiberg, Henrik Clausen3

Faculty of Health Sciences, School of Dentistry, University of Copenhagen, Copenhagen, Denmark, 1University Hospital Nijmegen, Department of Human Genetics, Nijmegen, The Netherlands, 2Faculty of Health Sciences, Genetics Institute, University of Copenhagen, Copenhagen, Denmark

Received on September 18, 1997; revised on January 12, 1998; accepted on January 13, 1998

A homologous family of UDP-N-acetylgalactosamine: polypeptide N-acetylgalactosaminyltransferases (GalNAc-transferases) initiate O-glycosylation. These transferases share overall amino acid sequence similarities of approximately 45-50%, but segments with higher similarities of [sim]80% are found in the putative catalytic domain. Here we have characterized the genomic organization of the coding regions of three GalNAc-transferase genes and determined their chromosomal localization. The coding regions of GALNT1, -T2, and -T3 were found to span 11, 16, and 10 exons, respectively. Several intron/exon boundaries were conserved within the three genes. One conserved boundary was shared in a homologous C.elegans GalNAc-transferase gene. Fluorescence in situ hybridization showed that GALNT1, -T2, and -T3 are localized at chromosomes 18q12-q21, 1q41-q42, and 2q24-q31, respectively. These results suggest that the members of the polypeptide GalNAc-transferase family diverged early in evolution from a common ancestral gene through gene duplication.

Key words: O-glycosylation/GalNAc-transferase/genome/ chromosome

Introduction

Mucin-type O-linked protein glycosylation is initiated by the transfer of N-acetylgalactosamine (GalNAc) to serine and threonine amino acid residues catalyzed by UDP-GalNAc: polypeptide N-acetylgalactosaminyltransferase activities (McGuire and Roseman, 1967) (GalNAc-transferases) (EC 2.4.1.41). It is now clear that initiation of O-glycosylation is undertaken by a family of GalNAc-transferases (Clausen and Bennett, 1996), of which four members, termed GalNAc-T1, -T2, -T3, and T4, have been reported thus far (Homa et al., 1993; White et al., 1995; Bennett et al., 1996; Hagen et al., 1997; Bennett et al., unpublished observations). These four GalNAc-transferases appear distinct in sequence and exhibit an overall amino acid sequence identity of [sim]45%; however, several peptide stretches within the putative catalytic domains of the enzymes show sequence identities of more than 80% (Clausen and Bennett, 1996). A total of 12 cysteine residues are conserved in spacing in the four human GalNAc-transferases, suggesting that the overall structure of the enzymes may be similar. A homologous putative GalNAc-transferase gene was identified in C.elegans (Hagen et al., 1995), which exhibited 40-50% sequence similarity to each of the human genes. Analysis of EST sequences from C.elegans indicates that additional putative members of this family are present in this organism (Hagen et al., 1995). These findings suggest that the family of polypeptide GalNAc-transferases is old in evolutionary terms.

The human GalNAc-transferases are differentially expressed in cells and tissues (Bennett et al., 1996), and they have both common and distinct acceptor substrate specificities (Bennett et al., 1996; Hagen et al., 1997; Wandall et al., 1997). In order to gain further insight into this family of genes, their regulatory elements and evolutionary origin, we analyzed their genomic organization and chromosomal localization. The genomic organization of human GalNAc-T1 was presented previously and the gene mapped to chromosome 18 by analysis of somatic cell hybrids (Meurer et al., 1995, 1996). Here, we show that all three human GalNAc-transferases have a complex but similar genomic organization with the coding regions covering 10-16 small exons, and that the three genes are localized on different chromosomes. The nucleotide sequence(s) reported in this article has been submitted to GenBank/EMBL Data Bank with the accession number(s) Y10343, Y10344, and Y10345.

Results

Genomic organization of GALNT1, -T2, and -T3

GalNAc-T1. Three P1 clones each covering the entire coding sequence of GALNT1 were isolated (Figure 1). Sequencing of the P1 clone, T1-2190, identified ten introns within the coding region (Figures 1 and 2). No introns were identified in the 3[prime] UTR. The organization of GALNT1 was identical to that reported by (Meurer et al., 1996). Minor sequence variations were observed in the flanking sequences of the introns (Figure 2). All boundaries conformed to the gt/ag consensus. Four polyadenylation sites (AATAAA) were identified in the 3[prime] UTR positioned at nucl. +2126, +2683, +2883, and +3518 downstream of the translation stop codon; the fourth is outside the sequence reported previously (Meurer et al., 1996) (Figure 1). 3[prime] RACE analysis using Colo205 mRNA showed that mainly the third AATAAA site was utilized, whereas no transcripts with the first and second site were identified (Figure 3). There was evidence for low level usage of the fourth site (Figure 3).


Figure 1. Genomic map of GalNAc-T1, -T2, and -T3 genes. Exons are indicated by boxes and coding sequences by black boxes. P1 clones used for determination of the organization are represented and labeled with clone identity. The primer pairs used for screening of P1 libraries are indicated with arrows and primer designations. EMBL3 #1 refers to a genomic clone from an EMBL3 library. Intron sizes are estimated based on PCR, and positions of AATAAA boxes and a Rapid Decay motif are indicated. Intron sizes for GalNAc-T1 were taken from Meurer et al. (1996).

Figure 2. Intron junctions in the coding regions of GalNAc- T1, -T2, and -T3 genes. Exon sequences are shown in capital letters with nucl. position from initiation codon in subscript, and the predicted amino acid sequence in single letter code above the sequence. Flanking intron sequences are shown in small letters, and introns are labeled according to Figure 1. Sequences were aligned to best fit of the gt/ag consensus rule (Kozak, 1992). Underlined bases in the top panel indicate sequence variations of GalNAc-T1 with the sequence reported by Meurer et al. (1996). 3[prime] Flanking sequences of intron 1 and 6, and 5[prime] flanking sequence of intron 5, were not determined as these intron positions were not included in the two nonoverlapping sets of P1 clones analyzed. As described in Materials and methods these intron positions were assessed by PCR.


Figure 3. 3[prime] RACE to determine utilization of polyadenylation boxes for GalNAc-T1 and -T3. (A) Schematic representation of the 3` UTR of GalNAc-T1 and -T3 with indication of sense primers (arrows) and probes (black lines) used. (B) Ethidium bromide staining and corresponding Southern blot of 3[prime] RACE products probed with the GalNAc-T1 (EBHC134 and EBHC131) or -T3 probes (EBHC217 and EBHC278). T1: lane 1, EBHC127/RT-primer; and lane 2, EBHC129/RT-primer. T3: lane 1, EBHC244/RT-primer; and lane 2, EBHC216/RT-primer. Arrows indicate adenylation sites utilized and the expected product sizes is indicated. Marker is PhiX/HaeIII (M). Asterisk indicates unspecific products.

Sequence analysis of EST databases where GALNT1 is highly represented was in agreement with this finding in that ESTs with a sequenced 3[prime] end were found to be derived from either the third or the fourth AATAAA site. Northern analysis has revealed two transcripts of 3.4 and 4.1 kb in all organs tested (Homa et al., 1993; Bennett et al., 1996). The major transcript of 3.4 kb corresponds to usage of the third polyadenylation site, and the minor transcript of 4.1 kb with usage of the fourth site.

GalNAc-T2. Two sets of P1 clones for GALNT2 were obtained using two separate pairs of primers. As shown in Figures 1 and 2 the use of two pairs of primer sets yielded P1 clones covering non overlapping parts of the 5[prime] region or the 3[prime] regions. Thus, none of the clones included the coding sequence nucl. position 608-817, and the 5[prime] coding region nucl. position 1-127. Combined analysis of the P1 clones, T2-2281, T2-2476, and T2-1732, two EMBL3 clones, and a genomic PCR product identified 15 intronic sequences in the coding region of GALNT2. All boundaries conformed to the gt/ag consensus. No intronic sequences were identified in the 3[prime] UTR. A single polyadenylation site was identified at nucl. +4346 (Figure 1). 3[prime] RACE using primers in the coding region as well as primer EBHC47 (5[prime]-TCGAATTCCACAAAGCCGAGTCGTGTCA) located in 3[prime] UTR failed to produce specific products. The reason for this is unknown; however, analysis of sequences in EST databases showed that none of the EST derived from GALNT2 reached into the coding region in contrast to ESTs from GalNAc-T1 and -T3 (dbEST, National Center for Biotechnology Information, NIH). The size of the GalNAc-T2 gene could not be estimated because several introns did not amplify by Expand PCR, but it may be estimated to span more than 100 kbp.

GalNAc-T3. One P1 clone, T3-4118, covering the entire coding sequence of GALNT3 was isolated using the primer pair EBHC205/EBHC211 (Figure 1). Sequencing of this identified 9 intronic sequences within the coding region (Figure 2). No intronic sequences were identified in the 3[prime] UTR, but 5[prime] RACE revealed one intron in the 5[prime] UTR at position -107. All boundaries conformed to the gt/ag consensus. Three polyadenylation sites were identified at nucl. positions +2325, +2857 and +3491 downstream of the translation stop codon (Figure 1). As shown in Figure 3, only polyadenylation site II was found to be utilized. The 3[prime] UTR of GALNT3 contained a Rapid Decay motif, UUAUUUAU, at position + 2029 downstream of the translational stop codon. This motif is found in many immediate-early genes (IEG) and cytokines (Zubiaga et al., 1995). The GALNT3 gene was found to be the smallest gene spanning [sim]30 kbp.

Conserved intron/exon boundaries in human GalNAc-transferases and a homologous C.elegans gene

Multiple sequence alignment (ClustalW) of DNA and amino acid sequences of human GalNAc-T1, -T2, -T3, and a homologous C.elegans gene are shown in Figure 4A,B. Analysis of the intron positions for each gene showed that several boundaries appeared to be shared between the genes. A schematic summary of shared boundaries is presented in Figure 5. GALNT1 and -T3 appear to share six boundaries, while only four of these are shared with GALNT2. Interestingly, a boundary shared between all three human genes in the 3[prime] end was also found in the C.elegans gene. The highly conserved sequences including the previously identified GalNAc-transferase motif were found to have different intron/exon organization (Figures 4 and 2).

Figure 4. Multiple sequence alignment (ClustalW) of GalNAc-T1, -T2, -T3, and C.elegans ZK688.8. (A) Alignment of predicted amino acid sequences. (B) Alignment of DNA sequences. Introduced gaps are shown by periods. Blank gaps are inserted in all sequences at positions of introns in any of the genes. Arrows indicate introns and are numbered according to Figure 1. The position of up to six introns are located identically in two or more of the genes (see Figure 5 for summary). Four of these are identified both by alignment analysis of amino acid and DNA sequences, while alignment of introns 2, 3, and 1 in GALNT1, -T2, and -T3, respectively, only match in the analysis of amino acid sequences, and introns 3, 5, and 2 in GALNT1, -T2, and -T3, respectively, only match in the DNA analysis.


Figure 5. Schematic representation of intron/exon boundaries with indications of the conserved boundaries by vertical dotted lines between genes. The position of the GalNAc-transferase motif used to clone GalNAc-T3 is indicated (Bennett et al., 1996). Exons are labeled according to Figure 1 with Roman numerals.

Chromosomal localizations

Fluorescence in situ hybridization revealed that the GALNT1 gene resides at chromosome 18q12-q21 (Figure 6A), which represents a refinement over the previous localization of this gene to chromosome 18 by somatic cell hybrid analysis (Meurer et al., 1995). The GALNT2 and -T3 genes were found to reside at chromosomes 1q41-q42 and 2q24-q31, respectively (Figure 6B and 6C). No specific hybridization signals were observed at other chromosomal sites. For each gene a total of 20 cells in metaphase were analyzed.

Figure 6. Fluorescence in situ hybridization to metaphase chromosomes. (A) GALNT1 (P1 DNA from clone T1-2190) labeled 18q12-q21. (B) GALNT2 (P1 DNA from clone T2-1732) labeled 1q41-q42. (C) GALNT3 (P1 DNA from clone T3-4118) labeled 2q24-q31.

The chromosomal location of GALNT3 was further studied by linkage analysis of a microsatellite marker, D2S2363, identified on the P1 clone T3-4118. Two CA-repeats were identified. One in intron 8 (Figure 1) and one outside the GALNT3 gene. D2S2363 was found to be positioned outside the GALNT3 gene in the P1 clone. Linkage analysis with this marker and markers, D2S71, D2S156, D2S124, D2S138, and D2S152 indicated that the most likely order of D2S2363 in these linkage groups was D2S71-D2S156-(D2S2363,D2S124)-D2S138-D2S152 using LINKMAP program of the FASTLINK package, with a multipoint lod score of Z = 20,72 (Figure 7). The odds for this order of markers as opposed to the second potential order was more than 103:1.


Figure 7. Multipoint analysis with five markers from chromosome 2q using seven families informative for D2S2363. The horizontal dashed line indicates the significance level for exclusion (odds 1:1000). D2S2363 is mapped between the markers D2S156 and D2S138.

Discussion

In the present study the genomic organization and chromosomal localization of three members of a family of polypeptide GalNAc-transferases were established. The coding regions of the three genes GALNT1, -T2, and -T3 were all found to reside in multiple exons ranging in number from 10 to 16. Several intron/exon boundaries were shared among the genes, and one of these was also shared with the putative GalNAc-transferase gene ZK688.8 found in C.elegans (Figure 5) (Hagen et al., 1995). Thus, similarities in sequence as well as genomic organization among these genes strongly suggest an evolutionary relationship. The three GalNAc-transferase genes are found on different chromosomes (Figure 6) and therefore are not arranged in a gene cluster. These data suggest that the family of GalNAc-transferases arose through gene duplication and subsequent divergence of sequences.

The shared intron/exon boundary of the three human GalNAc-transferase genes with the C.elegans gene suggests that all arose from a common ancestral gene. The C.elegans gene may represent an early version of one of the three human genes, but this cannot be definitely concluded from comparison of sequences as the four genes have near equal similarity to the C.elegans gene (Table I). Analysis of EST sequences from C.elegans leads to the prediction that this organism also contains an entire family of GalNAc-transferases (Hagen et al., 1995), however, the complete sequences of these and their relation to the human genes are not yet established. A fourth human GalNAc-transferase, GalNAc-T4, has recently been characterized, and interestingly the genomic organization is entirely different with the coding region placed in a single exon (Clausen and Bennett, 1996; Bennett et al., unpublished observations). Furthermore, several additional human GalNAc-transferase genes have been cloned and expressed (E. P. Bennett and H. Clausen, unpublished observations).

Table I. Amino acid sequence similarity (Clustal W) between GalNAc-T1, -T2, -T3, and ZK688.8
%Similarity overall/motif T1 T2 T3 ZK688.8
GalNAc-T1a   46/55e 45/55 53/65
GalNAc-T2b 46/55   42/50 42/56
GalNAc-T3c 45/55 42/50   38/53
ZK688.8d 53/65 42/56 38/53  
aT1 motif amino acid 115-420.
bT2 motif amino acid 135-435.
cT3 motif amino acid 184-494.
dZk[setmn]K688.8 motif amino acid 170-474.
eSimilarity overall/motif.

Several homologous families of glycosyltransferases have been identified, and the genomic organization and chromosomal localization have been determined for some of these. The largest glycosyltransferase family studied, the sialyltransferases, contain at least 11 members. The genes for four of these have been found to be organized in multiple coding exons and positioned on different chromosomes (Wang et al., 1990; Kitagawa et al., 1996; Yoshida et al., 1996a). Each of the sialyltransferases have unique acceptor substrate specificities and/or catalyze the formation of different linkages, and they are predicted to play different functions in sialylation of different glycoconjugates (Tsuji et al., 1996). Two distinct fucosyltransferase gene families are known: the [alpha]1-2fucosyltransferases, and the [alpha]1-3/4fucosyltransferases. Most of the members of these two families reside on chromosome 19 at two different sites, and all of these are encoded by single exons (Reguigne-Arnould et al., 1995); However, two of the [alpha]1-3/4fucosyltransferases, FUTIV and FUTVII reside on chromosome 11 and 9, respectively (Natsuka et al., 1994; Reguigne et al., 1994). FUTIV and FUTVII have diverged the most in sequence and FUTVII is encoded by multiple exons (Lowe, 1997).An [alpha]1-3Gal(NAc) transferase family has been identified that includes the histo-blood group A/B transferase, the [alpha]1-3Gal-transferase forming the Galili antigen, and the Forsman synthetase (Haslam and Baenziger, 1996). The genomic organization of the ABO and Galili antigen transferases have been determined (Joziasse, 1992; Bennett et al., 1995). Two major exons encoding the putative catalytic domains of the enzymes are conserved, whereas boundaries of several small exons in both genes encoding the N-terminal sequences showed no sequence similarity and hence likely not to be conserved. The [beta]1-6GlcNAc-transferase family which include the iI and the core 2 [beta]1-6GlcNAc-transferases colocalize on chromosome 9q21, but while the latter is encoded in a single exon, the I [beta]1-6GlcNAc-transferase is encoded in three exons (Bierhuizen et al., 1995). Finally, three homologous human [beta]1-4Gal-transferases are encoded by six exons and all five intron/exon boundaries are conserved (Almeida et al., 1997). Thus, from the present knowledge of the genomic structures of glycosyltransferase families it appears that chromosomal localization and genomic organization can be similar for different members of a family, but this is not always the case.

Joziasse et al., 1992) originally suggested that glycosyltransferase gene families may have emerged by exon-shuffling. One putative example is the histo-blood group ABO gene and the [alpha]1-3galactosyltransferase gene, which share two large coding exons in the 3[prime] end of the coding region (Joziasse et al., 1992). These coding regions can be divided into two parts, a 5` moiety without similarity and a 3[prime] moiety with high similarity. Since the region with similarity is confined to two exons that contain the catalytic domain, it is possible that this domain was replicated and assembled into several novel genes. A similar analysis of the polypeptide GalNAc-transferase genes did not provide evidence for exon shuffling as the basis for evolution of this gene family. Most of the central and 3[prime] regions with sequence similarity between GalNAc-T1, -T2, and -T3 are located within shared intron/exon boundaries (Figures 4 and 5) and several stretches of similar sequences are observed immediately outside these boundaries. It is therefore suggested that the GalNAc-transferase family probably arose by gene duplication and subsequent divergence. This is further corroborated by analysis of the genomic organization of a novel GalNAc-transferase gene, tentatively designated GalNAc-T5, which show high sequence similarity throughout the coding region with GalNAc-T3. The GalNAc-T5 gene was organized identical to GalNAc-T3 with all nine intron positions conserved (E. P. Bennett and H. Clausen, unpublished observations). The recent finding of an active human GalNAc-transferase, GalNAc-T4 (Bennett et al., unpublished observations), whose gene is encoded in a single exon (Clausen and Bennett, 1996), may represent evidence against the gene duplication theory. However, it is possible that GalNAc-T4 represents a retrotransposition from another GalNAc-transferase gene with complex organization. A retrotransposed pseudogene with high similarity to GalNAc-T1 has been identified, however, it is not expressed and the gene contains inserted sequences, multiple frameshift mutations, and repeat sequences characteristic of transposons (Meurer et al., 1996). GalNAc-T4 does not exhibit particularly high sequence similarity to any of the reported GalNAc-transferases, accordingly it is unlikely to be derived from any of these. Interestingly, we have identified and cloned a putative novel GalNAc-transferase with particularly high sequence similarity to GalNAc-T4, and preliminary data indicates that this gene has multiple introns including the intron conserved between human GalNAc-T1, -T2, and -T3, and the C.elegans gene (Figure 5) (E. P. Bennett and H. Clausen, unpublished observations). Presently, we therefore suggest that GalNAc-T4 may represent an active retrotransposed gene, and thus may not contradict that the GalNAc-transferase gene family arose through gene duplication.

During the course of this work GALNT1 was assigned to chromosome 18 by somatic cell hybrid analysis (Meurer et al., 1995). This observation is in agreement with our FISH localization to 18q12-q21. Meurer et al. (1996) also reported the exon structure of the coding region of GALNT1. Their results are identical to the results obtained in the present study, with minor sequence variations in the flanking intronic sequences (Figure 2). In addition, a fourth polyadenylation site was identified in the present study, and it was shown that the third site was the preferred adenylation site. The fourth site was also utilized and this yielded an expected increase in the transcript size of 635 bases (Figure 2). This finding may explain why Northern analysis with GalNAc-T1 identifies two transcript sizes of approximately 3.4 and 4.1 kb with the smallest being the most abundant (Homa et al., 1993; Bennett et al., 1996). Alternative splicing does not appear to be involved as extensive RT-PCR analysis with primers in all exons of the GALNT1 gene using RNA from several tissues did not provide evidence of this (data not shown). The use of multiple polyadenylation sites has also been shown for the [alpha]2,8 sialyltransferase (ST8SiaIII) (Yoshida et al., 1996b).

The GALNT3 gene has attracted attention because of its highly restricted tissue expression pattern compared to GALNT1 and -T2 as evaluated by Northern blot analysis (Bennett et al., 1996). Of 16 organs tested, high expression was only found in testes and pancreas. Recent Northern analysis of mouse organs with a mouse GalNAc-T3 probe, however, revealed that the gene is expressed in more tissues with high expression in salivary glands as well (Zara et al., 1996). The regulation of GalNAc-T3 expression may also be different from that of the other GalNAc-transferases because of a Rapid Decay motif in the 3[prime] UTR. This motif is conserved in mouse GalNAc-T3 (E. P. Bennett, E. Rygaard, and H. Clausen, unpublished observations). The Rapid Decay motif functions as a signal and is sufficient to promote mRNA degradation (Zubiaga et al., 1995), i.e., it has been shown to mediate proto-oncogene and cytokine mRNA degradation (Shaw and Kamen, 1986; Wilson and Treisman, 1988; Schiavi et al., 1994). Removal of the motif markedly stabilizes proto-oncogene fos mRNA transcripts (Meijlink et al., 1985). Thus, GalNAc-T3 may be regulated at either the transcriptional level or at the post transcriptional level. Analysis of the expression in pancreatic cell lines suggests that the gene is selectively down regulated in poorly differentiated pancreatic tumor cell lines while both GalNAc-T1 and -T2 expression levels were unchanged (Sutherlin et al., 1997).

The localization of the GalNAc-T3 gene was estimated by FISH to be positioned close to a recently identified insulin-dependent diabetes mellitus susceptibility locus, IDDM7 (Copeman et al., 1995; Luo et al., 1995). RT-PCR analysis of isolated human islet-cells has shown that these express GalNAc-T3 (E. P. Bennett, unpublished observations). In order to pursue these observations we have cloned and sequenced a CA repeat positioned less than 20-30 kb 3[prime] of the GalNAc-T3 gene, and identified this repeat as a previously characterized microsatellite marker designated D2S2363 (GenBank accession #Z51700). Using this marker the chromosomal localization was confirmed to 2q24-q31 close to D2S124. These findings will enable future studies using linkage and disassociation equilibrium analyses to test the hypothesis that GALNT3 is a candidate IDDM7 gene.

Material and methods

Genomic cloning and characterization of the organization of GALNT1, -T2 and -T3

A P1 human foreskin genomic library (DuPont Merck Pharmaceutical Company Human Foreskin Fibroblast P1 Library) was screened using primer pairs EBHC112 (5[prime]-TCGAATTCTTTGGAAATTGTTACATGCTCA)/EBHC106 (5[prime]-TCGAATTCATCCATCCATACTTCT) for GalNAc-T1, EBHC65 (5[prime]-TCGAATTCGGAATGGGCCTTGACGAAGGA) /TDS (5[prime]-GTCATTTT- CTCGGCAGCC) and EBHC34 (5[prime]-GAGGGAGGTCTCCATGCTTTG)/EBHC43 (5[prime]-TCGAATTCTGATGAATGAAGGTGTGCTT) for GalNAc-T2, and EBHC205 (5[prime]-AGCGGATCCACAGCAGCAGAATTGAAGCCT) /EBHC211 (5[prime]-AGCGGATCC- AGTGTTTAGCTTCCCCACG) for GalNAc-T3 (Figure 1).

Three clones for GalNAc-T1, DPMC-HFF#1-1167-B3 (T1-2190), DPMC-HFF#1-1191-G10 (T1-2191), DPMC-HFF#1-1253-D3 (T1-2192); six clones for GalNAc-T2, DPMC-HFF#1-155-G9 (T2-1732), DPMC-HFF#1-403-H5 (T2-2281), DPMC-HFF#1-1446-G11 (T2-2283), DPMC-HFF#1-403-H5 (T2-2474), DPMC-HFF#1-1446-G11 (T2-2475), DPMC-HFF#1-689-H11 (T2-2476); and one clone for GalNAc-T3, DPMC-HFF#1-534-12C (T3-4118) were obtained from Genome Systems. DNA from P1 phages were prepared as recommended by Genome Systems. P1 clones containing the largest inserts for each gene were selected for partial sequence analysis (GalNAc-T1, T1-2190; GalNAc-T2, T2-2281 and T2-1732; and GalNAc-T3, T3-4118). The 5[prime] sequence of GalNAc-T2 was analyzed in two genomic clones isolated from a human genomic EMBL3 library (Clontech) obtained by screening with the TEB1 GalNAc-T2 probe (White et al., 1995). Lambda DNA was prepared from these clones and the insert DNA isolated by KpnI/SacI DNA digestion followed by subcloning into the pT3T7U19 vector (Pharmacia). A central region of GalNAc-T2 (nucl. 608-817) was assessed by PCR amplification of genomic DNA using primers EBHC77 (5[prime]-CATGCGCTCACGGGTTCGGGG)/EBHC80 (5[prime]-CAAGTCAGCAGATGCCCCCAC) placed in the most 5[prime] region of exon 7 and the most 3[prime] region of exon 8, respectively (Figure 1). The PCR product was cloned and sequenced.

The entire coding sequence of each GalNAc-transferase was sequenced in full using automated sequencing (ABI377, Perkin Elmer) with dye terminator chemistry. Intron/exon boundaries were determined by comparison with the cDNA sequences of human GalNAc-T1, -T2, and -T3 (White et al., 1995; Bennett et al., 1996) optimizing for the gt/ag rule (Breathnach et al., 1978). Intron sizes of the GalNAc-T2 and -T3 were estimated by Expand PCR kit (Boehringer Mannheim) using primers flanking the respective introns and products verified by hybridization.

Identification and characterization of the 3[prime] UTRs

3[prime] RACE for each gene was performed using two sense primers for each gene to assess differential usage of polyadenylation boxes: GalNAc-T1: EBHC127 (5[prime]-AGCAGTGGCTTCTTCGAAACG) and EBHC129 (5[prime]- ACTGGAACCAGATTCAGAATCATG); GalNAc-T2: EBHC47 (5[prime]-TCGAATTCCACAAAGCCGAGTCGTGTCA) and EBHC88 (5[prime]-TCCGGGAGAAGGG- GCCAGAGC); and GalNAc-T3: EBHC216 (5[prime]-GACTAGGCATACACTGTAGTT) and EBHC244 (5[prime]-AATGGATTCTTTTCATCAAAAAGCC), in combination with the anti-sense oligo dT primer (5[prime]-AACAGCTATGACCATGTTTTTTTTTTTTTT). RT was performed with 0.5 mg mRNA from the Colo205 cell line using MuMLV-RT (Perkin Elmer) at 42°C under standard conditions, and the PCR by use of the Expand PCR kit. RT-PCR products were blotted onto nylon membranes and probed with the following gene specific oligonucleotide probes: GalNAc-T1, EBHC131 (5[prime]-AGCGGATCCAAGATTCATGCTACTGTTCCAC) and EBHC134 (5[prime]-ACAGGAAGGCTGGTTCACAGC); GalNAc-T2, EBHC48 (5[prime]-TCGAATTCGAATGGAGGAGCAGAGAGAG) and EBHC91 (5[prime]-TGTGCGTATCTGTGAACCTGG); and GalNAc-T3, EBHC217 (5[prime]-GGACACCTTTTCAACAGATAG) and EBHC278 (5[prime]-AAGCCTGCATTCTGAGCTGGAC). Products were gel purified (Prep-A-gene, Bio-Rad) and sequenced.

In situ hybridization to metaphase chromosomes

Fluorescence in situ hybridization (FISH) was performed on normal human lymphocyte metaphase chromosomes, using essentially the procedures as described previously (Suijkerbuijk et al., 1991). Briefly, P1 DNA was labeled with biotin-14-dATP using the bioNICK labeling system (Life Technologies). The labeled DNA was precipitated with ethanol in the presence of herring sperm DNA. A total of 300 ng P1 DNA was precipitated with 50× human Cot 1 DNA (Gibco) and dissolved in 12 ml hybridization solution (2× SSC, 10% dextran sulfate, 1% Tween-20, and 50% formamide, pH 7.0). Prior to hybridization the probe was heat-denatured at 80°C for 10 min, chilled on ice, and incubated at 37°C to allow reannealing of highly repetitive sequences. After denaturation of the slides, probe incubations were carried out under a 18 × 18 mm coverslip in a moist chamber for 45 h. Immunochemical detection of the probe was achieved using avidin fluorescein-isothiocyanate (FITC) (Vector Laboratories) and several successive steps with rabbit-anti-FITC and mouse-rabbit FITC-conjugated antibodies. For evaluation of the chromosomal slides a Zeiss epifluorescence microscope equipped with appropriate filters for visualization of FITC was used. Hybridization signals and DAPI-counterstained chromosomes were transformed into pseudocolored images using image analysis software. For precise localization and chromosome identification DAPI-converted banding patterns were generated using the BDS-image software package (ONCOR).

Cloning and sequencing of a CA-repeat microsatellite close to the GalNAc-T3 gene

In search of a CA-repeat within or close to the GalNAc-T3 gene, a HindIII digest of the P1 clone, T3-4118, was separated by 0.8% agarose gel electrophoresis, blotted onto Hybond N+ (Amersham), and hybridized with the oligonucleotide probe, CA-Rep (5[prime]-CACACACACACACACACACA). A 6 kbp fragment was subcloned into the HindIII site of pT7T3U19 and sequenced.

Linkage analysis of the GalNAc-T3 gene with D2S2363 microsatellite marker

Seven normal families with an average of 10 children from the Copenhagen Family Bank (Eiberg et al., 1989) were analyzed for the following short tandem repeat polymorphisms: D2S71, D2S156, D2S124, D2S138, D2S152 (Dib et al., 1996), and D2S2363. A radioactive PCR was performed in a volume of 10 ml in microtiter plates (Hybaid) (50 ng of template DNA, 1-3 mM of nonlabeled and 32P end-labeled primer, 0.1 mM of each dNTP, 1.5 mM MgCl2, and 0.30 U of Taq DNA polymerase in buffer (Promega). The amplification was run in a programmable heating block (Omnigene, Hybaid) for 27 cycles at 94°C for 30 sec, 55°C for 0.30 s, and 72°C for 30 sec. The amplified fragments were separated by electrophoresis for 1-3 h at (100 W) in 6% denaturing polyacrylamide sequencing gel (25 × 42 × 0.4 cm). Gels were fixed for 10 min (10% acetic acid), washed for 20 min., dried, and exposed to x-ray film (XAR-5 Kodak or Fuji-RX) overnight. The order and the distances for these chromosome 2 markers were drawn from the Généthon Linkage Map (Dib et al., 1996) to be D2S71-0.1-D2S156-0.1-D2S124-0.1-D2S138-0.1-D2S152. Multipoint lod score for D2S2363 in this fixed map were calculated with the LINKMAP routine of the FASTLINK software version 2.2 (Schaffer et al., 1994).

Acknowledgments

We are grateful to Dr. Michael A. Hollingsworth for helpful advice and critical reading of the manuscript, and Drs. Jens H. Nielsen and Elisabeth Douglas Galsgaard from the Hagedorn Research Institute for supplying RNA from human islets. This work was supported by The Danish Cancer Society, the Ingeborg Roikjer Foundation, the Velux Foundation, the Danish Medical Research Council, the Danish Natural Science Research Council, the Lundbeck Foundation, the Novo Nordisk Foundation, NIH Grant 1 RO1 CA66234, funds from the EU Biotech 4th Framework, and the Dutch Cancer Society.

Abbreviations

GalNAc-transferase, UDP-N-acetyl-[alpha]-d-galactosamine: Polypeptide N-acetylgalac-tosaminyltransferase; GalNAc-T1, -T2, and -T3 represents human GalNAc-transferases reported previously (White et al., 1995; Bennett et al., 1996) with GenBank accession numbers are X85018, X85019, X92689, respectively; C.elegans homologous gene with accession number L16621encodes ZK688.8; EST, expressed sequence tags; FISH, fluorescence in situ hybridization; RACE, rapid amplification of cDNA ends, UTR, untranslated region.

References

Almeida,R., Amado,M., David,L., Levery,S.B., Holmes,E.H., Merkx,G., Geurts van Kessel,A., Rygaard,E., Hassan,H., Bennett,E.P. and Clausen,H. (1997) A family of human [beta]4-galactosyltransferases: cloning and expression of two novel UDP-galactose: [beta]-N-acetyl-glucosamine [beta]1,4galactosyltransferases, [beta]4Gal-T2 and [beta]4Gal-T3. J. Biol. Chem., 272, 31979-31991. MEDLINE Abstract

Bennett,E.P., Steffensen,R., Clausen,H., Weghuis,D.O. and Geurts van Kessel,A. (1995) Genomic cloning of the human histo-blood group ABO locus. Biochem. Biophys. Res. Commun., 211, 347. MEDLINE Abstract

Bennett,E.P., Hassan,H. and Clausen,H. (1996) cDNA cloning and expression of a novel human UDP-N-acetyl-alpha-d-galactosamine: polypeptide N-acetylgalactosaminyltransferase, GalNAc-T3. J. Biol. Chem., 271, 17006-17012. MEDLINE Abstract

Bierhuizen,M.F., Maemura,K., Kudo,S. and Fukuda,M. (1995) Genomic organization of core 2 and I branching beta-1,6-N-acetylglucosaminyltransferases. Implication for evolution of the beta-1,6-N-acetylglucosaminyltransferase gene family. Glycobiology, 5, 417-425. MEDLINE Abstract

Breathnach,R., Benoist,C., O'Hare,K., Gannon,F. and Chambon,P. (1978) Ovalbumin gene: evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries. Proc. Natl. Acad. Sci. USA, 75, 4853-4857. MEDLINE Abstract

Clausen,H. and Bennett,E.P. (1996) A family of UDP-GalNAc: polypeptide N-acetylgalactosaminyl-transferases control the initiation of mucin-type O-linked glycosylation. Glycobiology, 6, 635-646. MEDLINE Abstract

Copeman,J.B., Cucca,F., Hearne,C.M., Cornall,R.J., Reed,P.W., Ronningen,K.S., Undlien,D.E., Nistico,L., Buzzetti,R., Tosi,R. et al. (1995) Linkage disequilibrium mapping of a type 1 diabetes susceptibility gene (IDDM7) to chromosome 2q31-q33. Nature Genetics, 9, 80-85. MEDLINE Abstract

Dib,C., Faure,S., Fizames,C., Samson,D., Drouot,N., Vignal,A., Millasseau,P, Marc,S., Hazan,J., Seboun,E., Lathrop,M., Gyapay,G., Morissette,J. and Weissenbach,J. (1996) A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature, 380, 152-154. MEDLINE Abstract

Eiberg,H., Nielsen,L.S., Klausen,J., Dahlen,M., Kristensen,M., Bisgaard,M.L., Moller,N. and Mohr,J. (1989) Linkage between serum cholinesterase 2 (CHE2) and gamma-crystallin gene cluster (CRYG): assignment to chromosome 2. Clin. Genet., 35, 313-321. MEDLINE Abstract

Hagen,F.K., Gregoire,C.A. and Tabak,L.A. (1995) Cloning and sequence homology of a rat UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. Glycoconjugate J., 12, 901-909.

Hagen,F.K., Hagen,T.K.G., Beres,T.M., Balys,M.M., VanWuyckhuyse,B.C. and Tabak,L.A. (1997) cDNA cloning and expression of a novel UDP-N-acetyl-d-galactosamine: polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem., 272, 13843-13848. MEDLINE Abstract

Haslam,D.B. and Baenziger,J.U. (1996) Expression cloning of Forssman glycolipid synthetase: a novel member of the histo-blood group ABO gene family. Proc. Natl. Acad. Sci. USA, 93, 10697-10702. MEDLINE Abstract

Homa,F.L., Hollander,T., Lehman,D.J., Thomsen,D.R. and Elhammer,A.P. (1993) Isolation and expression of a cDNA clone encoding a bovine UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem., 268, 12609-12616. MEDLINE Abstract

Joziasse,D.H. (1992) Mammalian glycosyltransferases: genomic organization and protein structure. Glycobiology, 2, 271-277. MEDLINE Abstract

Joziasse,D.H., Shaper,N.L., Kim,D., van den Eijnden,D.H. and Shaper,J.H. (1992) Murine alpha 1,3-galactosyltransferase. A single gene locus specifies four isoforms of the enzyme by alternative splicing. J. Biol. Chem., 267, 5534-5541. MEDLINE Abstract

Kitagawa,H., Mattei,M.G. and Paulson,J.C. (1996) Genomic organization and chromosomal mapping of the Gal beta 1, 3GalNAc/Gal beta 1,4GlcNAc alpha 2,3-sialyltransferase. J. Biol. Chem., 271, 931-938. MEDLINE Abstract

Kozak,M. (1992) Regulation of translation in eukaryotic systems. Annu. Rev. Cell Biol., 8, 197-225. MEDLINE Abstract

Lowe,J.B. (1997) Selectin ligands, leukocyte trafficking, and fucosyltransferase genes. Kidney Int., 51, 1418-1426. MEDLINE Abstract

Luo,D.F., Bui,M.M., Muir,A., Maclaren,N.K., Thomson,G. and She,J.X. (1995) Affected-sib-pair mapping of a novel susceptibility gene to insulin-dependent diabetes mellitus (IDDM8) on chromosome 6q25-q27. Am. J. Hum. Genet., 57, 911-919. MEDLINE Abstract

McGuire,E.J. and Roseman,S. (1967) Enzymatic synthesis of the protein-hexosamine linkage in sheep submaxilliary mucin. J. Biol. Chem., 242, 3745-3755. MEDLINE Abstract

Meijlink,F., Curran,T., Miller,A.D. and Verma,I.M. (1985) Removal of a 67-base-pair sequence in the noncoding region of protooncogene fos converts it to a transforming gene. Proc. Natl. Acad. Sci. USA, 82, 4987-4991. MEDLINE Abstract

Meurer,J.A., Naylor,J.M., Baker,C.A., Thomsen,D.R., Homa,F.L. and Elhammer,A.P. (1995) cDNA cloning, expression, and chromosomal localization of a human UDP-GalNAc:polypeptide, N-acetylgalactosaminyltransferase. J. Biochem., 118, 568-574. MEDLINE Abstract

Meurer,J.A., Drong,R.F., Homa,F.L., Slightom,J.L. and Elhammer,A.P. (1996) Organization of a human UDP-GalNAc:polypeptide, N-acetylgalactosaminyltransferase gene and a related processed pseudogene. Glycobiology, 6, 231-241. MEDLINE Abstract

Natsuka,S., Gersten,K.M., Zenita,K., Kannagi,R. and Lowe,J.B. (1994) Molecular cloning of a cDNA encoding a novel human leukocyte alpha-1,3-fucosyltransferase capable of synthesizing the sialyl Lewis x determinant. J. Biol. Chem., 269, 16789-16794. MEDLINE Abstract

Reguigne,I., James,M.R., Richard,C.W.,3rd, Mollicone,R., Seawright,A., Lowe,J.B., Oriol,R. and Couillin,P. (1994) The gene encoding myeloid alpha-3-fucosyl-transferase (FUT4) is located between D1 1S388 and D11S919 on 11q21. Cytogenet. Cell. Genet., 66, 104-106. MEDLINE Abstract

Reguigne-Arnould, I., Couillin, P., Mollicone, R., Faure, S., Fletcher, A., Kelly, R.J., Lowe, J.B., and Oriol, R. (1995) Relative positions of two clusters of human alpha-l-fucosyltransferases in 19q (FUT1-FUT2) and 19p (FUT6-FUT3-FUT5) within the microsatellite genetic map of chromosome 19. Cytogenet. Cell. Genet., 71, 158-162. MEDLINE Abstract

Schaffer,A.A., Gupta,S.K., Shriram,K. and Cottingham,R.W.,Jr. (1994) Avoiding recomputation in linkage analysis. Hum. Hered., 44, 225-237. MEDLINE Abstract

Schiavi,S.C., Wellington,C.L., Shyu,A.B., Chen,C.Y., Greenberg,M.E. and Belasco,J.G. (1994) Multiple elements in the c-fos protein-coding region facilitate mRNA deadenylation and decay by a mechanism coupled to translation. J. Biol. Chem., 269, 3441-3448. MEDLINE Abstract

Shaw,G. and Kamen,R. (1986) A conserved AU sequence from the 3[prime] untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell., 46, 659-667. MEDLINE Abstract

Suijkerbuijk,R.F., van de Veen,A.Y., van Echten,J., Buys,C.H., de Jong,B., Oosterhuis,J.W., Warburton,D.A., Cassiman,J.J., Schonk,D. and Geurts van Kessel,A. (1991) Demonstration of the genuine iso-12p character of the standard marker chromosome of testicular germ cell tumors and identification of further chromosome 12 aberrations by competitive in situ hybridization. Am. J. Hum. Genet., 48, 269-273. MEDLINE Abstract

Sutherlin,M.E., Nishimori,I., Caffrey,T., Bennett,E.P., Hassan,H., Mandel,U., Mack,D., Iwamura,T., Clausen,H. and Hollingsworth,M.A. (1997) Expression of three UDP-N-acetyl-[alpha]-d galactosamine: polypeptide N-acetyl-galactosaminyltransferases in adenocarcinoma cell lines. Cancer Res., 57, 4744-4748. MEDLINE Abstract

Tsuji,S., Datta,A.K. and Paulson,J.C. (1996) Systematic nomenclature for sialyltransferases. Glycobiology, 6, v-vii. MEDLINE Abstract

Wandall,H.H., Hassan,H., Mirgorodskaya,E., Kristensen,A.K., Roepstorff,P., Bennett,E.P., Nielsen,P.A., Hollingsworth,M.A., Burchell,J., Taylor-Papadamitriou,J. and Clausen,H. (1997) Substrate specificities of three members of the human UDP-N-acetyl-[alpha]-d-galactosamine: polypeptide N-acetylgalactosaminyltransferase family, GalNAc-T1, -T2, and -T3. J. Biol. Chem., 272, 23503-23514. MEDLINE Abstract

Wang,X., O'Hanlon,T.P., Young,R.F. and Lau,J.T. (1990) Rat beta-galactoside alpha 2,6-sialyltransferase genomic organization: alternate promoters direct the synthesis of liver and kidney transcripts. Glycobiology, 1, 25-31. MEDLINE Abstract

White,T., Bennett,E.P., Takio,K., Sorensen,T., Bonding,N. and Clausen,H. (1995) Purification and cDNA cloning of a human UDP-N-acetyl-alpha-d-galactosamine:polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem., 270, 24156-24165. MEDLINE Abstract

Wilson,T. and Treisman,R. (1988) Removal of poly(A) and consequent degradation of c-fos mRNA facilitated by 3[prime] AU-rich sequences. Nature, 336, 396-399. MEDLINE Abstract

Yoshida,Y., Kurosawa,N., Kanematsu,T., Kojima,N. and Tsuji,S. (1996a) Genomic structure and promoter activity of the mouse polysialic acid synthase gene (mST8Sia II). Brain-specific expression from a TATA-less GC-rich sequence. J. Biol. Chem., 271, 30167-30173. MEDLINE Abstract

Yoshida,Y., Kurosawa,N., Kanematsu,T., Taguchi,A., Arita,M., Kojima,N. and Tsuji,S. (1996b) Unique genomic structure and expression of the mouse alpha 2,8-sialyltransferase (ST8Sia III) gene. Glycobiology, 6, 573-580. MEDLINE Abstract

Zara,J., Hagen,F.K., Ten Hagen,K.G., Van Wuyckhuyse,B.C. and Tabak,L.A. (1996) Cloning and expression of mouse UDP-GalNAc: polypeptide N-acetylgalactosaminyltransferase-T3. Biochem. Biophys. Res. Commun, 228, 38-44. MEDLINE Abstract

Zubiaga,A.M., Belasco,J.G. and Greenberg,M.E. (1995) The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol. Cell. Biol., 15, 2219-2230. MEDLINE Abstract

3To whom correspondence should be addressed at: School of Dentistry, Nørre Alle 20, DK-2200 Copenhagen N, Denmark


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 18 May 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 IOVSHome page
P. Argueso, A. Tisdale, U. Mandel, E. Letko, C. S. Foster, and I. K. Gipson
The Cell-Layer- and Cell-Type-Specific Distribution of GalNAc-Transferases in the Ocular Surface Epithelia Is Altered during Keratinization
Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 86 - 92.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
N. Kociok, A. Hueber, P. Esser, U. Schraermeyer, G. Thumann, T. T. Luther, J. Jordan, G. Welsandt, and B. Kirchhof
Vitreous Treatment of Cultured Human RPE Cells Results in Differential Expression of 10 New Genes
Invest. Ophthalmol. Vis. Sci., July 1, 2002; 43(7): 2474 - 2480.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Schwientek, E. P. Bennett, C. Flores, J. Thacker, M. Hollmann, C. A. Reis, J. Behrens, U. Mandel, B. Keck, M. A. Schafer, et al.
Functional Conservation of Subfamilies of Putative UDP-N-acetylgalactosamine:Polypeptide N-Acetylgalactosaminyltransferases in Drosophila, Caenorhabditis elegans, and Mammals. ONE SUBFAMILY COMPOSED OF l(2)35Aa IS ESSENTIAL IN DROSOPHILA
J. Biol. Chem., June 14, 2002; 277(25): 22623 - 22638.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
A. E. Manzi, K. Norgard-Sumnicht, S. Argade, J. D. Marth, H. van Halbeek, and A. Varki
Exploring the glycan repertoire of genetically modified mice by isolation and profiling of the major glycan classes and nano-NMR analysis of glycan mixtures
Glycobiology, July 1, 2000; 10(7): 669 - 689.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Schwientek, M. Nomoto, S. B. Levery, G. Merkx, A. G. van Kessel, E. P. Bennett, M. A. Hollingsworth, and H. Clausen
Control of O-Glycan Branch Formation. MOLECULAR CLONING OF HUMAN cDNA ENCODING A NOVEL beta 1,6-N-ACETYLGLUCOSAMINYLTRANSFERASE FORMING CORE 2 AND CORE 4
J. Biol. Chem., February 19, 1999; 274(8): 4504 - 4512.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. P. Bennett, H. Hassan, U. Mandel, E. Mirgorodskaya, P. Roepstorff, J. Burchell, J. Taylor-Papadimitriou, M. A. Hollingsworth, G. Merkx, A. G. van Kessel, et al.
Cloning of a Human UDP-N-Acetyl-alpha -D-Galactosamine:Polypeptide N-Acetylgalactosaminyltransferase That Complements Other GalNAc-Transferases in Complete O-Glycosylation of the MUC1 Tandem Repeat
J. Biol. Chem., November 13, 1998; 273(46): 30472 - 30481.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Bennett, E. P.
Right arrow Articles by Clausen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bennett, E. P.
Right arrow Articles by Clausen, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?