Glycobiology Advance Access originally published online on October 25, 2008
Glycobiology 2009 19(2):160-171; doi:10.1093/glycob/cwn118
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The yeast oligosaccharyltransferase complex can be replaced by STT3 from Leishmania major
2 Lehrstuhl für Zellbiologie und Pflanzenphysiologie, Universität Regensburg, Regensburg
3 Medizinische Hochschule Hannover, Zentrum Biochemie, Hannover, Germany
1 To whom correspondence should be addressed: E-mail: ludwig.lehle{at}biologie.uni-regensburg.de
Received on September 25, 2008; revised on October 20, 2008; accepted on October 21, 2008
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
The key step of protein N-glycosylation is catalyzed by the multimeric oligosaccharyltransferase complex (OST). Biochemical and genetic studies have revealed that OST from Saccharomyces cerevisiae consists of nine subunits: Wbp1, Swp1, Stt3, Ost1, Ost2, Ost3, Ost4, Ost5, and Ost6. With the exception of Stt3, assumed to contain the catalytic site, little is known about the function of other OST subunits. The existence of the OST complex is suggested to allow substrate specificity and efficient transfer, a close interaction with the translocon and the prevention of protein folding to ensure the efficient co-translational modification of proteins. However, in the recently completed genome of the trypanosomatid parasite Leishmania major STT3 (of which four paralogs exist, STT3-1, STT3-2, STT3-3, and STT3-4) is the only OST subunit that can be identified. Here we report that L.m.STT3 proteins, except STT3-3, are able to complement stt3 deficiency in yeast during vegetative growth, but only poorly during sporulation. By blue native electrophoresis we demonstrate that the L.mSTT3 is active mainly as a free, monomeric enzyme. In cell-free assays and also in vivo we find that L.mSTT3, expressed in yeast, has a broad specificity for nonglucosylated lipid-linked mannose-oligosaccharides, typical for several protists. But when incorporated into the OST complex, L.mSTT3 transfers also the common eukaryotic Glc3Man9GlcNAc2-PP-Dol donor. Finally, three L.m.STT3 paralogs were shown to complement not only stt3 but also ost1, ost2, wbp1, or swp1 mutants. Thus, STT3 from Leishmania can substitute for the whole OST complex.
Key words: Leishmania / lipid-linked oligosaccharide / N-glycosylation / oligosaccharyltransferase / Saccharomyces
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
Asparagine-linked glycosylation of eukaryotic secretory and membrane-bound proteins in the lumen of the endoplasmic reticulum is the most ubiquitous, complex and at the same time energetically most-costly protein modification. It is essential and evolutionary highly conserved, serving different functions such as being important for protein folding and stability as well as for distinct molecular recognition events and development (Kornfeld R and Kornfeld S 1985
; Helenius and Aebi 2004; Lehle et al. 2006; Caramelo and Parodi 2007). The key step of this pathway is the transfer of the dolicholphosphate-linked core oligosaccharide, Glc3Man9GlcNAc2, to selected Asn-X-Ser/Thr sequences of the nascent polypeptide chain. The enzyme that catalyzes this process is a heteromeric, multisubunit membrane complex, called oligosaccharyltransferase (OST) (Knauer and Lehle 1999b; Dempski and Imperiali 2002; Yan and Lennarz 2005b; Kelleher and Gilmore 2006). Purification of OST from yeast and genetic methods identified nine proteins. Five of them, Wbp1, Swp1, Stt3, Ost1, and Ost2, are essential for viability of the cell, whereas Ost4, Ost5, Ost3, and Ost6 are not essential but are required for maximal OST activity. The specific function of the various subunits and the organization in the complex is largely enigmatic. Subunits Ost3 and Ost6 are alternatively present in the yeast OST complex; they modify the transfer specificity toward protein to be glycosylated and they specify the interaction with different translocation complexes (Schwarz et al. 2005; Spirig et al. 2005; Yan and Lennarz 2005). In mammals, two OST complexes exist that contain either one of two isoforms of Stt3, which display tissue-specific expression (Kelleher et al. 2003).
Several lines of evidence suggest that the essential Stt3 is the catalytic subunit of OST and is responsible for the transfer of the oligosaccharide. By a combination of photolabeling experiments, active site modification and site-directed mutagenesis, three OST subunits (Ost1, Ost3, and Stt3) were labeled with photoreactive acceptor peptides (Yan and Lennarz 2002a; Yan and Lennarz 2002b; Bause et al. 1997). In the mammalian system, a highly selective cross-linking of Stt3 to an N-glycosylation site of the nascent polypeptide chain was achieved (Nilsson and von Heijne 2000; Nilsson et al. 2003). The most direct evidence for its catalytic role is the finding of an Stt3 homolog (PglB) in the eubacteria Campylobacter catalyzing an N-linked-type glycosylation, in the absence of other OST homologs (Wacker et al. 2002). Similarly, a recent study in the thermophilic archeon Pyrococcus furiosus indicated that OST in this organism is composed exclusively of the Stt3 protein and catalyzes the transfer of a heptasaccharide, albeit structurally different from the eukaryotic core oligosaccharide, to a synthetic peptide in an Asn-X-Ser/Thr-dependent manner (Igura et al. 2008).
To add further experimental proof that Stt3 is indeed the catalytic subunit, we previously tried to functionally replace Stt3 from S. cerevisiae by the Campylobacter PglB homolog. However, we failed (unpublished results), since the bacterial PglB turned out to have an altered N-glycosylation acceptor site specificity compared to the eukaryotic OST, requiring in addition an acidic amino acid residue at the minus 2 position of the consensus sequence, extending it to D/E-X1-N-X2-S/T (Glover et al. 2005; Kowarik et al. 2006). Furthermore, the Campylobacter N-linked glycosylation pathway has a preference for unsaturated polyisoprenols rather than for the eukaryotic dolichol-type lipid carrier (Chen et al. 2007).
In eukaryotes, the existence of an OST complex is suggested to allow substrate specificity, a close interaction with the translocon and the prevention of protein folding to ensure the efficient co-translational modification of proteins. However, Stt3 is the only subunit that could be identified from the recently completed genomes of several protists including the trypanosomatid parasite Leishmania major. Here we report that STT3 from Leishmania is able to complement stt3 deficiency in yeast during vegetative growth, but only poorly during sporulation. We also show that the Leishmania STT3 homolog is functional mainly as a free enzyme with a broad specificity for the glycosyl donor, but when incorporated into the OST complex, it accepts the common Glc3Man9GlcNAc2-PP-Dol donor. Finally, three out of the four STT3 paralogs were able to functionally complement not only an stt3 mutant but also ost1, ost2, wbp1, or swp1 mutants supporting the one-subunit model predicted from genetic studies.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
Leishmania major STT3 proteins complement the growth and glycosylation defect of a yeast stt3 mutant
The Leishmania genome discloses four consecutive open reading frames located on chromosome 35 (accession numbers LmjF35.1130, LmjF35.1140, LmjF35.1150, and LmjF35.1160) which have homology to Stt3 from yeast and other higher eukaryotes and were named STT3-1, STT3-2, STT3-3, and STT3-4 following their order of appearance (Figure 1). The overall sequence identity to yeast is only about 26%, but the membrane topology containing 11–12 transmembrane spanning domains, according to topology predictions (Krogh et al. 2001
), is strikingly conserved as well as signature motifs, such as WWDYG and DXXK, shown to be important for Stt3 activity (Yan and Lennarz 2002; Igura et al. 2008). The homology of the L.m.STT3 paralogs STT3-1, STT3-2, STT3-3, and STT3-4 among each other amounts to about 80%, in which the nonfunctional L.m.STT3-3 (see below) has the shortest reading frame and diverges by a 25-amino-acid insertion at amino acid 693 in the C-terminal domain facing the ER lumen, which is assumed to play a central role in catalysis. We asked whether L.m.STT3 proteins can substitute the yeast Stt3 and expressed them in a yeast strain, in which the STT3 gene is under the control of the GAL1 promotor, which is repressed in the presence of glucose in the medium. The four L.m.STT3 genes were cloned with an N-terminal FLAG-tag for detection purpose into a high copy number yeast plasmid with the CUP1 promotor to drive expression. As depicted in Figure 2A, all clones, except L.m.STT3-3, complemented the growth defect on a glucose medium, when the yeast STT3 was turned off. We also examined the growth complementation in a liquid medium (Figure 2B). There is a marginal lower growth rate by the expression of L.m.STT3-2 compared to L.m.STT3-4 and L.m.STT3-1 by comparable protein expression (see below). The functional role of L.m.STT3 to replace S.c.STT3 has also been demonstrated by analyzing the glycosylation pattern of the well-characterized model glycoprotein carboxypeptidase Y (CPY) by metabolically labeling yeast cells with [35S]methionine/cysteine followed by immunoprecipitation and sodium dodecyl sulfate (SDS) gel electrophoresis. Mature CPY contains four N-linked glycan chains and migrates as a distinct band with a molecular mass of 61 kDa. In cells, in which S.c.STT3 has been repressed for 8 h and transformed with the vector, CPY is severely underglycosylated and lacks up to four chains. Expression of L.m.STT3-4 completely suppresses the underglycosylation as does STT3 from yeast (Figure 2C, lanes 5 and 6). Almost complete restoration of wild-type CPY was achieved by L.m.STT3-1 and L.m.STT3-2, whereas L.m.STT3-3 was inactive, in agreement with their effect on growth. In the lower panel of Figure 2C, the protein expression level of the various constructs is shown, indicating a comparable amount demonstrating that the lack of complementation of L.m.STT3-3 is not due to inefficient expression.
|
|
Low-efficiency complementation by Stt3 from Leishmania during sporulation
Deletion of STT3 in yeast is lethal. We asked whether L.m.STT3 is also able to rescue a complete STT3 knock out. To investigate this, a diploid heterozygote STT3/
stt3 strain was transformed with the expression vector harboring L.m.STT3-1. Diploid cells were induced to sporulate and spore tetrads were isolated by micromanipulation. In the case of complementation, four viable tetrads were expected: two containing wild-type STT3 and two stt3. As shown in Figure 3A, only two spores grew up, indicating that L.m.STT3 is not able to functionally replace the yeast STT3 deletion during sporulation growth. As control, diploids were transformed with a plasmid containing S.c.STT3 and have shown that all four tetrads grew up (Figure 3C). This result could mean that L.m.STT3 is not sufficiently expressed during sporulation, or that specific proteins important for sporulation cannot be glycosylated by L.m.STT3 because of somewhat altered acceptor substrate specificity. It has been shown that N-glycosylation is crucial for cell wall assembly and cell wall integrity, and defects can be suppressed by osmotic stabilizers (Levin 2005; Lesage and Bussey 2006). We, therefore, added 1 M sorbitol to the agar plates during spore growth. In rare cases, we could observe a rescue of the lethal phenotype and growth of four tetrads; two of them were of small size (Figure 3B). DNA was isolated from a large and a small spore and analyzed for the absence and presence of S.c.STT3 (Figure 3D) and complementation of CPY (Figure 3E) and expression of L.m.STT3 (Figure 3F). The results show that the small tetrad is indeed stt3 and displays L.m.STT3 at a higher expression level than the large tetrad carrying the chromosomal yeast STT3.
|
Analysis of the incorporation of L.m.STT3 into the yeast OST complex by blue native (BN) and denaturing polyacrylamide gel electrophoresis (PAGE)
BN electrophoresis is a powerful tool for the analysis of the membrane-bound protein complexes (Schagger and von Jagow 1991
; Wittig et al. 2006), and we have previously used this method to study the OST complex from yeast (Knauer and Lehle 1999; Schwarz et al. 2005). Here we have analyzed with this technique whether STT3 from Leishmania is incorporated into the complex or is active in free form. In yeast expressing a chromosomal C-terminal-tagged S.c.Stt3, the complex, solubilized with 1% digitonin, migrates as a band with a molecular mass higher than 480 kDa, in the gel system and molecular weight standards applied (Figure 4A, lane 1). Similarly a strain with deletions in OST3 and OST6, which are nonessential genes, gives rise to a complex with a slightly higher mobility (Figure 4A, lane 2), in accordance with previous results (Schwarz et al. 2005). The size of the wild-type complex is larger than what one would expect, when all eight subunits are present in equimolar amounts, which would approximate 240 kDa, and thus could reflect a dimeric organization. In contrast, cells expressing L.m.STT3-1FLAG, in which the yeast STT3 under the control of the repressible GAL1-promoter is switched on, present a signal at approximately 180 kDa when probed with anti-Flag antiserum (Figure 4A, lane 3). However, no L.m.STT3 was detectable in the region of the wild-type OST complex. But when the yeast STT3 was shut off, besides the free L.m.STT3, a small amount was integrated in the OST complex (Figure 4A, lane 4). This was not the case of the inactive L.m.STT3-3 paralog (Figure 4A, lanes 5 and 6). The migration of L.m.STT3FLAG does not correspond to the calculated molecular mass of 92 kDa and could represent either a dimer of L.m.STT3FLAG or a subcomplex with other OST subunits. To address this in more detail, we prepared samples with a BN sample buffer containing in addition 1% SDS and separated them by BN–PAGE. All samples presented the same mobility regardless of the presence of SDS (Figure 4A, lanes 8–13). In addition, we performed a series of treatments with solubilized Stt3 from S. cerevisiae and L. major by analyzing the influence of temperature, incubation time, and SDS, and analyzed the samples in parallel both by BN–PAGE (Figure 4B) and by denaturing SDS–PAGE (Figure 4C). With the latter separation method, all bands had a size corresponding to the expected size of the monomeric, denatured tagged Stt3 protein irrespective of the various treatments (Figure 4C). In BN–PAGE (Figure 4B), however, the same proteins had mobilities comparable to that observed under nondenaturing conditions (Figure 4A). This means that the mobility of Stt3 in BN–PAGE of about 180 kDa must represent the monomeric form and possesses anomalous migration behavior. Furthermore, this result indicates that also the size of the wild-type OST complex most probably does not reflect the true molecular mass. Although it has been reported that BN–PAGE allows size determination of complexes, it has been realized that the lack of right molecular weight standards may cause pitfalls. Thus, the standards used here are soluble and not membrane proteins. And even these may differ as documented in Figure 4A, where catalase with a molecular weight of 240 kDa migrates as a diffuse band and more slowly (lane 15) than phycoerythrin assigned to 242 kDa (lane 14).
|
Altogether, independent of the question of the correct molecular mass, the results indicate that STT3 from Leishmania is not incorporated into the complex and most likely functions as a monomeric enzyme. Only in the absence of the yeast Stt3, a small portion is incorporated.
Leishmania major STT3 proteins complement the growth and glycosylation defect of yeast ost1, ost2, wbp1, and swp1 mutants
Like the genetic predictions, the previous results suggest that Leishmania STT3 is able to transfer the glycan chain to protein independent of the presence of other OST subunits. We thus tested if each of the four Leishmania paralogs was able to complement the growth defect of yeast mutants in which one of the essential subunits had been placed under the control of the GAL1 promoter. Like for the functional complementation of the stt3 mutant, the Leishmania STT3 proteins were expressed episomally and induced by the addition of copper to media. The yeast Stt3 that cannot compensate for the function of the other essential subunits was used as negative control. Yeast OST1, OST2, SWB1, and WBP1, respectively, were used as positive control. Remarkably, the three L.m.STT3 paralogs able to complement the growth defect of a yeast stt3 mutant can also functionally complement ost1, ost2, wbp1, or swp1 mutants and allow growth in glucose-based media under which the yeast Stt3 expression is switched off (Figure 5).
|
In vitro and in vivo analysis and glycosyl donor specificity of L.m.STT3-1
Trypanosomatid protozoa synthesize and transfer to protein nonglucosylated glycans from Man5GlcNAc2 to Man9GlcNAc2, depending on the species, in contrast to higher eukaryotes, which have a preference for Glc3Man9GlcNAc2 (Parodi 1993
; Jones et al. 2005; Manthri et al. 2008). Besides having deficiencies in certain Dol-P-Man-dependent mannosyltransferases, trypanosomatids are unable to synthesize Dol-P-Glc (de la Canal and Parodi 1987; McConville et al. 2002; Samuelson et al. 2005). Nevertheless, in cell-free tests it has been shown that, independent of the lipid-linked oligosaccharide synthesized in vivo, trypanosomatid OST transfers Glc1-3Man9GlcNAc2 and Man7–9GlcNAc2 (Bosch et al. 1988). To examine the glycosyl transfer specificity of Leishmania STT3, we measured the OST activity using lipid-linked oligosaccharides of different length, prepared in yeast mutants, and GAYNSTSV as an acceptor peptide with microsomes as an enzyme source. Microsomes were isolated from a strain, in which the yeast STT3 is regulated by the GAL1-promotor and can be turned off by the addition of glucose in the medium. As shown in Table I, the expression of L.m.STT3-1 led to a strong increase in the OST activity with Man6GlcNAc2-PP-Dol and Man9GlcNAc2-PP-Dol, and to a minor extent with Man5GlcNAc2-PP-Dol, compared to a strain harboring an empty vector, whose activity was set to 100%. No significant stimulating effect was measurable with the Glc-containing donor. When the yeast STT3 was turned off for 8 h, the OST activity was reduced in the vector transformed strain, as expected. Interestingly, the heterologous expression of L.m.STT3 under these repressed conditions causes an increase from about 50% to 80% with the Glc3Man9GlcNAc2-PP-Dol substrate. Under these conditions, some L.m.STT3 is incorporated into the complex (Figure 4A) and seems to have an altered specificity. This finding is supported by a recent study of the yeast oligosaccharyltransferase complex containing Trypanosoma cruzi STT3 that shows that the complex determines substrate preference (Castro et al. 2006).
|
In order to substantiate that Man5–9GlcNAc2 glycans are efficiently transferred by L.m.STT3, we investigated whether the expression of L.m.STT3 improves the glycosylation deficiency also in vivo in certain alg strains. It has been demonstrated that
alg3, alg9, or alg5 with defects in LLO assembly causes an underglycosylation, because the truncated glycans of these mutants (Man5GlcNAc2, Man6GlcNAc2 and Man9GlcNAc2, respectively) are nonoptimal substrates for yeast OST (Huffaker and Robbins 1983; Burda et al. 1996, 1999; Sharma et al. 2001). It is shown in Figure 6A that the functional active L.m.STT3-1, but not the inactive L.m.STT3-3 isoform, is able to rescue completely the underglycosylation of CPY in these knockout strains. The mobility of mature CPY with four glycan chains (Figure 6A, lanes 3, 6, and 9) corresponds to the size of the respective truncated oligosaccharides transferred by L.m.STT3. The results indicate that L.m.STT3 indeed transfers efficiently shortened lipid-linked-mannose oligosaccharides lacking glucose in contrast to S.c.Stt3.
|
Site-directed mutagenesis of L.m.STT3-1 to analyze amino acids important for activity
Despite low sequence homologies, all Stt3 proteins identified in the three kingdoms conserve a short invariant WWDYG motif, in which the aspartate residue is assumed to play a role in catalysis (Wacker et al. 2002
; Yan and Lennarz 2002a). In addition, a DXXK motif close to the WWDYG in the secondary structure was recently identified in the Stt3 homolog from Pyrococcus and suggested to be part of the active site (Igura et al. 2008). Finally, Stt3 was identified as a member of a new glycosyltransferase family classified as the GT-C superfamily, containing 8–13 predicted transmembrane spanning domains that display a DXD/EXD motif in the first extracellular loop (Liu and Mushegian 2003). It may be related to the binding of the LLO donor substrate. We have replaced in L.m.STT3-1 residue E95 and D97 of the EXD motif, D647 within the sequence WWDYG, or D706 and K709 of the DXXK motif by an alanine and found that they are all necessary for cell growth in the glucose medium, when yeast Stt3 is not expressed (Figure 7A). Similarly, the underglycosylation of CPY is not rescued by these L.m.STT3 mutant alleles (Figure 7B, compare lanes 1 and 2 with 8–12). We have also tested the function of the EXD motif in the yeast S.c.Stt3, corresponding to E45 and D47. Whereas D47 was found to be essential for growth (Figure 7A) and does not support CPY glycosylation in vivo (Figure 7B, lanes 1, 2 and 4), mutation of E45 led to a reduced OST activity, which did not fully complement CPY glycosylation (Figure 7B, lanes 1, 2, and 3), but was sufficient to allow growth of yeast cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
It is still unclear why the catalysis of the asparagine-linked protein glycosylation reaction requires several different subunits in eukaryotes. Besides the mechanistic complexity to recognize the glycosylatable Asn-X-Ser/Thr consensus sequence on the nascent protein, to activate the Asn amide nitrogen, and to bring in the correctly assembled lipid-linked oligosaccharide donor, OST has to regulate selective glycosylation of sequons and interact with the translocon as well as with the subsequent protein folding process. Thus the discovery of an ancient N-glycosylation machinery in the Gram-negative bacteria Campylobacter depending only on PglB, homologous to the eukaryotic Stt3, was unexpected (Szymanski et al. 1999
; Wacker et al. 2002; Szymanski and Wren 2005; Weerapana and Imperiali 2006). Meanwhile, genomic and bioinformatics studies have suggested that also some eukaryotic OST can consist of a single Stt3 subunit. Here we present several evidences supporting this one-subunit model in the protozoan Leishmania major. During evolution to this catalytic core, further subunits were added to compose the elaborated complex of yeast and higher eukaryotes (Samuelson et al. 2005). The first units to be added may have been Ost1 followed by Wbp1 and Ost2. Further enlargement involved the addition of Ost3/Ost6, Ost4, Swp1, and Ost5 (Kelleher et al. 2007). Recent studies of the function of OST1/ribophorin I indicate that it is not essential for N-glycosylation per se and acts as a chaperon or escort to promote the N-glycosylation of selected substrates by the catalytic Stt3 subunit (Wilson et al. 2005).
We show in this report that three out of four paralogous STT3 proteins from Leishmania major were able to functionally replace the endogenous yeast Stt3 during vegetative growth and could correct the underglycosylation of CPY caused by depletion of yeast Stt3. However, L.m.STT3 was inefficient during sporulation growth. Only by osmotic stabilization of the medium, and obviously when L.m.STT3 was expressed in sufficient amounts, spores were able to grow. Complementation seems to require high level of protein expression like previously observed with the Toxoplasma gondi enzyme (Shams-Eldin et al. 2005). Since we have only investigated isoform L.m.STT3-1 in this context, it is conceivable that the other STT3 proteins from Leishmania may be more effective assuming that the different isoforms serve a somewhat different protein substrate or individual glycosylation site specificity. Such site-specific transfer of glycans have been reported in the case of Trypanosoma brucei (Jones et al. 2005).
Remarkably L.m.STT3 seems to fulfill its function as an enzyme outside of the OST complex. By BN gel electrophoresis, we were able to demonstrate that L.m.STT3 migrates as a monomer, albeit it displayed a higher molecular mass than expected. By several control experiments we could exclude a dimeric complex in the digitonin-solubilized OST extract for the unusual migration behavior. This observation does not necessarily exclude the possibility that it forms a dimer in the ER membrane, where it presumably interacts with ribosomes and the translocon. The oligomeric state of a membrane protein or a membrane protein complex is notoriously difficult to determine as the contribution of the detergent and lipid molecules surrounding the complex particle is difficult to estimate. In case of OST also nine oligosaccharide chains on the three glycosylated subunits contribute and may lead additionally to anomalous migration. For example the translocon was reported by various biochemical and biophysical studies to have a monomeric (Van den Berg et al. 2004), dimeric (Osborne and Rapoport 2007), or tetrameric state (Menetret et al. 2005). For OST from yeast, a dimeric organization was originally proposed (Chavan et al. 2006). A reinvestigation of the digitonin-solubilized OST now suggests that it is monomeric having a mass of 
360 kDa. Again this number does not agree with the size determined here. The additional pitfalls caused by inappropriate standards have been discussed already.
Furthermore, we have shown that the three active L.major STT3s (STT3-1, STT3-2, and STT3-4) were able to complement the growth defect of yeast mutants in which one of the essential subunits was depleted. This ability to compensate for the function of any of the essential subunits also provides evidence that Leishmania STT3 proteins act on their own outside of a complex and highlights a profound difference with the yeast Stt3. Such differences are of particular importance, since N-glycosylation seems important for the survival of Leishmania major (Naderer et al. 2008).
Although not essential for single-cell viability, a characteristic of OST from yeast and higher eukaryotes is the preferential utilization of Glc3Man9GlcNAc2-PP-Dol. It has been shown that this occurs by allosteric interactions between a regulatory LLO-binding site and the active site subunit, as well as by oligosaccharide structure-mediated alteration of the acceptor-binding site affinity (Karaoglu et al. 2001). Addition of this second, regulatory dolichol-linked oligosaccharide binding site correlates with the acquisition of ribophorin II/SWP1 (Kelleher et al. 2007), which seems absent from Leishmania. We investigated the glycosyl donor specificity of L.m.STT3 both in vitro and in vivo. Like several other kinetoplastids, Leishmania major is unable to synthesize Dol-P-Glc, lacks several Alg glycosyltransferases, and is likely to synthesize Man7GlcNAc2-PP-Dol. In agreement with this observation, our results suggest that OST measured in microsomes from cells expressing L.m.STT3 preferentially transfers nonglucosylated LLO donors (Table I). Similarly, in alg mutants, characterized by an underglycosylation caused by the inefficient transfer of truncated LLOs by the yeast OST, a complete rescue can be observed by L.m.STT3 (Figure 6). This was not the case when the nonfunctional L.m.STT3-3 was expressed. These results corroborate the proposal that organisms assembling nonglucosylated LLOs seem to have a rudimentary, but less stringent, donor substrate selection than other eukaryotes. In the latter case, terminal mannose residues on the LLO are important for donor substrate recognition by the OST and the in vivo oligosaccharide donor is utilized in preference to certain larger and/or smaller oligosaccharide donors (Kelleher et al. 2007). On the other hand, under conditions when the endogenous yeast Stt3 is depleted and L.m.STT3 is incorporated in minor amounts into the OST complex, we detect a significant stimulation of transfer of the glucose-containing LLO. This last result is in agreement with a recent study of the STT3 from Trypanosoma cruzi in yeast, which have revealed that it is the complex and not the catalytic subunit that determines the preferential specificity of the OST for the complete glycan (Castro et al. 2006). In contrast to the Leishmania protein, STT3 from T. cruzi seemed to be efficiently incorporated into the complex.
Finally, we investigated amino acids required for the activity of the L.m.STT3. We could demonstrate the importance of the aspartate residue of the highly conserved WWDYG sequence, presumably the catalytic base during glycosylation reaction, as well as the recently identified DXXK motif that together with an EXD motif in the first extracellular loop may be involved in the binding of the pyrophosphate group of lipid-linked oligosaccharide donors through a transiently bound Mg/Mn cation.
Altogether our results demonstrate that the leishmanial OST, represented by a single protein, is able to replace the whole heterooligomeric OST from the yeast. This may help in the future to further our understanding of the basic features and role not only of individual subunits but also the complex organization of the eukaryotic OST. When this work has been finished, a paper appeared dealing with the same issue (Nasab et al. 2008). We not only partly confirm but also extend this study. In contrast to their findings, we were able to demonstrate among others that L.m.STT3 is not only functional as a monomeric enzyme but can also incorporate into the yeast OST complex, and as a consequence its LLO specificity is altered.
|
Material and methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
Yeast strains, plasmids, and growth conditions
The following yeast strains were used: SS328 (MAT
ade2-101 ura3-52 his3200 lys2-801), KHY328 (MAT ade2-101 ura3-52 his3200 lys2-801 STT3-ZZ-kanMX4), KHY327 (MAT ade2-101 ura3-52 his3200 ost3::HIS3 ost6 STT3-ZZ-kanMX), Y24390 (STT3/stt3) (MATa/ his31/his31 leu20/leu20 lys20/LYS2 MET15/met150 ura30/ ura30 YGL022w::kanMX4/YGL022w), KHY157 (MAT ade2-101 lys2-801 GAL1-STT3 stt3::HIS3 his3200 ura3::kanMX), alg3 (MATa his31 leu20 met150 ura30 YBL082c::kanMX4), alg5 (MATa his31 leu20 met150 ura30 YPL227c::kanMX4), alg9 (MATa his31 leu20 met150 ura30 YNL219c::kanMX4), YPH500 (MAT ura3-52 lys-801 ade2-101 trp1-6, leu1). Strains were grown in YPD (1% yeast extract, 2% bacto peptone, 2% glucose) or YNBD dropout medium (0.67% yeast nitrogen base, 2% glucose) supplemented with amino acids and nucleotide bases, as required. In case of strain KHY157, cells were grown in the presence of 2% galactose, and in order to repress genomic STT3 cells were shifted in the mid-log phase to a glucose medium. To induce the gene expression from plasmid pYES-Cup1-H-Flag-K medium was also supplemented with 0.5 mM copper sulfate. To regain uracil auxotrophy of strain YG157, disruption of URA3 was carried out with a kanMX4 cassette amplified by PCR from plasmid pUG6. Recombinants were selected for growth on G418 sulfate and positive clones were verified by PCR as well as for nongrowth on a medium lacking uracil. For the generation of C-terminal ProteinA (ZZ)-tagging of genomic STT3, a cassette was amplified by PCR using the primers 5'-CCAGAACCTCCATAAAGAGACCTGAATTAGGCTTGAG AGTC GGAGCAGGGGCGGGTGC-3' and 5'-CGATCCGT CACGAGCGATCATAATAACGGGAAGGGAAACCAAACT TATACAG GTCGACGGTATCG-3' and plasmid pZZ-KanMX as a template. Transformants were selected on a medium containing G418 sulfate and correct integration was confirmed by PCR amplification and expression of the tagged protein by western analysis.
Ost1, ost2, wpb1, and swp1 mutants were generated by chromosomal promoter replacement according to Mazhari-Tabrizi et al. (1999). The selection marker/promoter HIS3/PGAL1 cassette was amplified by PCR with the following primer pairs 5'-TGACTCAAGGAAACGGACTATGTCTTGTACTGAATA CTGTCTTCAATTGCGGGCGAATTGGAGCTCCAC-3'/5'-G TTGAAAAAACATAGGAACAATCCCACAATCCAAGAGA ACCAAACCTGCCTCATGGGGATCCACTAGTTC TAG-3', 5'-ACTGGAAATAACGAGTCGATAGAAGCTTGTTGGTTC TATTTGGCGAGTACGGGCGAATTGGAGCTCCAC-3'/5'-G ATGACGTGTGGTTACTTTTGGTGTGTTTGCCTTTGGTG CTTTTGCCATGGGGATCCACTAGTTCTAG-3', 5'-CTCTC ATTGTTTTATAGATACATATTAGTATACTACAATTAAAGA TATCCGGGCGAATTGGAGCTCCAC-3'/5'-CGAAAATGG CCTGCAGAAGGATACAAAAGAAAAAATTCCAATCGGT CCGCATGGGGATCCACTAGTTCTAG-3', and 5'-TCGCAA GTTTAGCAGGTCAATAATAATAATATCCTTATAAATTAC ACTCAGGGCGAATTGGAGCTCCAC-3'/5'-ACGAACGAT ATGCACGACACCAAGGCCGCAAGTGTTTTGAAGAATT GCATGGGGATCCACTAGTTCTAG-3' and transformed in the yeast strain YPH500. Transformants were selected on media lacking histidine and checked by PCR as well as for nongrowth on a glucose medium. The following primer pairs were used for confirmation by PCR of ost1, ost2, wbp1, and swp1 mutants, respectively: 5'-GTGTTGAAGAGCTTGGCACT-3'/5'-TCGTA TTGGGCAGCAGAAGAC-3', 5'-ACGCCAGCCAATTGAGG ATC-3'/5'-CAAGAAGAGTGCCACTGTCA-3', 5'-AGGTTC CGTAGATTGGTCGT-3'/5'-CTGTTAAGACTGCAGATGAC GT-3', and 5'-AGTTCCAGCTCTCTTAACCTC-3'/5'-GAAC ATCTTGTGCCACGTAAG-3'.
To generate the expression plasmid pVT100-S.c.STT3-ZZ, STT3 was amplified by PCR using genomic DNA of wild- type strain SS328 as a template and the primer 5'-CCCAA GCTTGGG ATGGGCTCCGACCGGTCGTGTG-3' introd- ucing a 5'-HindIII-site and 5'-CGCGGATCCGACTCTCAA GCCTAATTCAGGTCTC-3' for a 3'-BamHI-site, respectively. To remove the internal BamHI site of S.c.STT3 after the start codon ATG, the 5'-oligonucleotide contained a point mutation removing the restriction site but encoding the same amino acids. The fragment was ligated into the HindIII/BamHI cut vector pVT100-ZZ and constructs were sequenced. The correct fusion to a C-terminal ZZ epitope was verified by western analysis.
Plasmids containing the four STT3-isoforms from Leishmania, or the OST essential subunits from yeast, were constructed as follows. Vector pYES-Cup1 is derived from pYES2 NT/C (Invitrogen) by exchanging the GAL1 with the CUP1 promotor from pYEX (Clontech). A Flag-tag was then cloned into the restriction sites 5'-HindIII and 3'-KpnI to obtain the vector pYES-Cup1-H-Flag-K (Ashikov et al. 2005). To express the STT3 proteins with an N-terminal Flag-tag, Leishmania STT3-1, STT3-2, STT3-3, and STT3-4 were amplified from genomic DNA (strain MHOM/SU/73/ 5ASKH) with the following primer pairs: 5'-TGTCAAG CTTACCATGCCGGCGGCCAAGAACCAGCA-3'/5'-TCAG TCTAGACTTCACCCAGTGTTCTGCTG-3', 5'-TGACGGAT CCGGATCGAAAGGCACGACAGC-3'/5'-TGACTCTAGAG CTTCAGAACACGGCTACCT-3', 5'-TGACGGATCCACAA CGAGAAGTGCCGTTGCGC-3'/5'-TGTCTCTAGATGTCTG CAGGTTCGCTTGCT-3', and 5'-TGACGGATCCGGCAAG CGGAAGGGAAATTC-3'/5'-ACTGTCTAGAACACCGACC ACTGCACATGT-3', respectively, and inserted in the BamHI and XbaI restriction sites of pYES-Cup1-H-Flag-K. S. cerevisiae STT3 was amplified with the primers 5'-TGACGGAT CCGGATCGACCGGTCGTGTGT-3' and 5'-GACACTCGA GTTAGACTCTCAAGCCTAATT-3' and inserted in the BamHI and XhoI in pYES-Cup1-H-Flag-K. The essential subunits OST1, OST2, WPBI, and SWPI were cloned from yeast with the following primer pairs:
5'-TGTCAAGCTTACCATGAGGCAGGTTTGGTTCTC-3'/5'-TGTCCTCGAGTATTGCTCTGCATCATAAGGT-3', 5'- TGTCAAGCTTACCATGGCAAAAGCACCAAAGGC-3'/5'- TCAGCTCGAGTACAAGCATGCATGCAAGCA-3', 5'-TGT CAAGCTTACCATGCGGACCGATTGGAATTT-3'/5'-TCAG CTCGAGTGCAGTACTTAGTTTGGCAA-3', and 5'-TGTCA AGCTTACCATGCAATTCTTCAAAACACTTGC-3'/5'-TCA GCTCGAGGCTAAGAGCAACTGATTCGT-3', respectively, and inserted in the HindIII and XbaI or XhoI sites of pYES-Cup1. Transformation into yeast and E. coli was carried out using standard techniques.
Site-directed mutagenesis
Site-directed mutagenesis was performed by PCR according to the manufacturer protocol (Stratagene). For all the mutations in this paper, pYES-Cup1-H-Flag-K-L.m.STT3-1 and pVT100-S.c.STT3-ZZ were used as the template. Primer sequences can be received on inquiry. The correct sequences were verified in all cases by sequencing of the whole reading frame. Plasmids were transformed into KHY157.
Spotting assay for growth
Yeast cells were grown in the YNB galactose medium overnight at 30°C to mid-log-phase and subsequently washed with a glucose medium. Serial 1:10 dilutions of 106 cells mL–1 in YNB glucose were made, of which 3 µL were spotted on plates containing galactose or glucose, respectively. Incubation was at 30°C for times indicated.
Sporulation and tetrad dissection
For the generation of a stt3 strain, expressing L.m.STT3-1Flag, a diploid strain STT3/stt3 (Euroscarf Frankfurt) was transformed with pYES-Cup1-H-Flag-K-L.m.STT3-1. After induction of sporulation on plates containing potassium acetate plus L-histidine and L-leucine for 4 days at 25°C, tetrads were digested with Zymolyase (Seikagaku Kogyo, Tokio, Japan) and dissected on YEPD plates and YEPD plates containing 1 M sorbitol, respectively. Desired haploid strains were identified for growth on the minimal medium minus uracil but G418. Furthermore, the expression of L.m.STT3-1Flag was verified by western analysis, while the absence of S.c.STT3 was verified by PCR using the primers 5'-AGCGGCCGC ATGGGATCCGACCGGTCGTG-3' and 5'-AGCGGCCGCT TAGACTCTCAAG CCTAATTCAGG-3'.
In vivo labeling of lipid-linked oligosaccharides with [3H]mannose
Cells were grown overnight at 30°C and subsequently labeled with [2-3H]mannose (15 Ci/mmol; GE Healthcare). Labeling, extraction, and analysis of lipid-linked oligosaccharides by HPLC were performed as described previously (Knauer and Lehle 1999).
In vivo labeling of CPY with [35S]methionine/cysteine
Cells were grown in YNB galactose overnight at 30°C to mid-log phase, and then shifted to a glucose medium. After repression of genomic S.c.STT3 for 8 h at 30°C, cells were labeled with 75 µCi [35S]methionine/cysteine (1000 Ci/mmol; GE Healthcare) for 45 min at 30°C. Further processing, immunoprecipitation, and PAGE analysis of CPY were performed as described previously (Knauer and Lehle 1999).
OST activity assay
Rough microsomal membranes were isolated as described (Knauer and Lehle 1999). The following assays were performed according to Sharma et al. (1981) and Zufferey et al. (1995) using different LLOs as glycosyl donor, as indicated, and the synthetic octapeptide GAYNSTSV as N-glycosylation acceptor. The reaction volume was 60 µL and consisted of 7.9 mM Tris–HCl, pH 7.4, 0.9% Triton X-100, 7.9 mM MnCl2, 2.8% DMSO, 1.25 mM octapeptide, 100 µg membrane protein, 10,000 cpm Dol-PP-GlcNAc2 [3H] Man5,6, or 9, and Dol-PPGlcNAc2[3H]Man9Glc3, respectively. Reaction was started by the addition of the glycosyl donor and incubated for 7.5 min at 24°C. Determining the oligosaccharyl transfer from DolPP-GlcNAc2Man9Glc3, 1.3 mM glucosidase I-inhibitor deoxynojirimycin was added. Reaction was stopped with 2 x 0.9 mL chloroform/methanol 2:1 (v/v) and processed by Folch partitioning (Folch et al. 1957). 0.6 mL of the supernatant was removed and the residual inter- and upper phase was extracted three times with synthetic upper phase (chloroform/methanol/H2O 1:32:48 (v:v:v)). The combined supernatants were dried and radioactivity was measured in a scintillation counter. The various glycosyl donors were synthesized by metabolic labeling alg3, alg9, and alg6 mutants accumulating the defined incomplete lipid-linked oligosaccharides Dol-PP-GlcNAc2[3H]Man5, Dol-PP-GlcNAc2[3H]Man6, and Dol-PP-GlcNAc2[3H]Man9, respectively.
BN–PAGE analysis
BN–PAGE was carried out according to the method of Schagger and von Jagow (1991) and Wittig et al. (2006) using the NativePAGE system from Invitrogen. For solubilization, 270 µg microsomal membranes (12 mg/mL protein) were mixed with 1x NativePAGE sample buffer and digitonin at a final concentration of 1% in a total volume of 56 µL. After incubation for 20 min on ice, the solubilized extract was separated from insoluble material by centrifugation at 150,000 x g for 40 min at 4°C. After the addition of 1/20 volume of 5% Coomassie G-250, the supernatant was analyzed on a 4–16% Bis–Tris gel and immunoblotted on a PVDF membrane according to the manufacturer protocol. All steps were carried out at 4°C. To investigate denatured samples, specimen were adjusted to 1% SDS prior the addition of G-250 and incubated at 45°C and 95°C, respectively, as indicated. Marker proteins were: NativeMarkTM unstained protein standard mixture from Invitrogen, containing apoferritin band 1, 720 kDa; apoferritin band 2, 480 kDa; phycoerythrin, 242 kDa; lactate dehydrogenase, 146 kDa; bovine serum albumin, 66 kDa; and bovine catalase, 240 kDa (Serva). After immunoblotting, proteins were fixed to the membrane by incubation for 15 min in 8% acetic acid, and excessive G-250 subsequently removed by washing with 100% methanol. Immunodetection was performed using specific antibodies as indicated.
|
Funding |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
The Deutsche Forschungsgemeinschaft and the Körber-Stiftung.
|
Conflict of interest statement |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
None declared.
|
Acknowledgements |
|---|
We acknowledge the excellent technical assistance of Angelika Rechenmacher.
|
Footnotes |
|---|
This paper is dedicated to Widmar Tanner on the occasion of his 70th birthday.
|
Abbreviations |
|---|
BN–PAGE, blue native–polyacrylamide gel electrophoresis; CPY, carboxypeptidase Y; LLO, lipid-linked oligosaccharide; OST, oligosaccharyltransferase; SDS, sodium dodecyl sulfate
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsFundingConflict of interest statementReferences |
|---|
Ashikov A, Routier F, Fuhlrott J, Helmus Y, Wild M, Gerardy-Schahn R, Bakker H. The human solute carrier gene SLC35B4 encodes a bifunctional nucleotide sugar transporter with specificity for UDP-xylose and UDP-N-acetylglucosamine. J Biol Chem (2005) 280:27230–27235.
Bause E, Wesemann M, Bartoscheck A, Breuer W. Epoxyethylglycyl peptides as inhibitors of oligosaccharlytransderase; double-labelling of the active site. J Biochem. (1997) 322:95–202.
Bosch M, Trombetta S, Parodi AJ. Synthesis of dolichol derivatives and protein glycosylation in trypanosomatids. Biochem Soc Trans (1988) 16:268–271.[Medline]
Burda P, Jakob CA, Beinhauer J, Hegemann JH, Aebi M. Ordered assembly of the asymmetrically branched lipid-linked oligosaccharide in the endoplasmic reticulum is ensured by the substrate specificity of the individual glycosyltransferases. Glycobiology (1999) 9:617–625.
Burda P, te Heesen S, Brachat A, Wach A, Dusterhoft A, Aebi M. Stepwise assembly of the lipid-linked oligosaccharide in the endoplasmic reticulum of Saccharomyces cerevisiae: Identification of the ALG9 gene encoding a putative mannosyl transferase. Proc Natl Acad Sci USA (1996) 93:7160–7165.
Caramelo JJ, Parodi AJ. How sugars convey information on protein conformation in the endoplasmic reticulum. Semin Cell Dev Biol (2007) 18:732–742.[CrossRef][Medline]
Castro O, Movsichoff F, Parodi AJ. Preferential transfer of the complete glycan is determined by the oligosaccharyltransferase complex and not by the catalytic subunit. Proc Natl Acad Sci USA (2006) 103:14756–14760.
Chavan M, Chen Z, Li G, Schindelin H, Lennarz WJ, Li H. Dimeric organization of the yeast oligosaccharyl transferase complex. Proc Natl Acad Sci USA (2006) 103:8947–8952.
Chen MM, Weerapana E, Ciepichal E, Stupak J, Reid CW, Swiezewska E, Imperiali B. Polyisoprenol specificity in the Campylobacter jejuni N-linked glycosylation pathway. Biochemistry (2007) 46:14342–14348.[CrossRef][Medline]
de la Canal L, Parodi AJ. Synthesis of dolichol derivatives in trypanosomatids. Characterization of enzymatic patterns. J Biol Chem (1987) 262:11128–11133.
Dempski RE Jr, Imperiali B. Oligosaccharyl transferase: Gatekeeper to the secretory pathway. Curr Opin Chem Biol. (2002) 6:844–850.[CrossRef][Web of Science][Medline]
Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem (1957) 226:497–509.
Glover KJ, Weerapana E, Imperiali B. In vitro assembly of the undecaprenylpyrophosphate-linked heptasaccharide for prokaryotic N-linked glycosylation. Proc Natl Acad Sci USA (2005) 102:14255–14259.
Helenius A, Aebi M. Roles of N-linked glycans in the endoplasmic reticulum. Annu Rev Biochem (2004) 73:1019–1049.[CrossRef][Web of Science][Medline]
Huffaker TC, Robbins PW. Yeast mutants deficient in protein glycosylation. Proc Natl Acad Sci USA (1983) 80:7466–7470.
Igura M, Maita N, Kamishikiryo J, Yamada M, Obita T, Maenaka K, Kohda D. Structure-guided identification of a new catalytic motif of oligosaccharyltransferase. Embo J (2008) 27:234–243.[CrossRef][Web of Science][Medline]
Jones DC, Mehlert A, Guther ML, Ferguson MA. Deletion of the glucosidase II gene in Trypanosoma brucei reveals novel N-glycosylation mechanisms in the biosynthesis of variant surface glycoprotein. J Biol Chem (2005) 280:35929–35942.
Karaoglu D, Kelleher DJ, Gilmore R. Allosteric regulation provides a molecular mechanism for preferential utilization of the fully assembled dolichol-linked oligosaccharide by the yeast oligosaccharyltransferase. Biochemistry (2001) 40:12193–12206.[CrossRef][Web of Science][Medline]
Kelleher DJ, Banerjee S, Cura AJ, Samuelson J, Gilmore R. Dolichol-linked oligosaccharide selection by the oligosaccharyltransferase in protist and fungal organisms. J Cell Biol (2007) 177:29–37.
Kelleher DJ, Gilmore R. An evolving view of the eukaryotic oligosaccharyltransferase. Glycobiology (2006) 16:47R–62R.
Kelleher DJ, Karaoglu D, Mandon EC, Gilmore R. Oligosaccharyltransferase isoforms that contain different catalytic STT3 subunits have distinct enzymatic properties. Mol Cell (2003) 12:101–111.[CrossRef][Web of Science][Medline]
Knauer R, Lehle L. The oligosaccharyltransferase complex from Saccharomyces cerevisiae. Isolation of the OST6 gene, its synthetic interaction with OST3, and analysis of the native complex. J Biol Chem (1999) 274:17249–17256.
Knauer R, Lehle L. The oligosaccharyltransferase complex from yeast. Biochim Biophys Acta (1999) 1426:259–273.[Medline]
Kornfeld R, Kornfeld S. Assembly of asparagine-linked oligosaccharides. Annu Rev Biochem (1985) 54:631–664.[CrossRef][Web of Science][Medline]
Kowarik M, Young NM, Numao S, Schulz BL, Hug I, Callewaert N, Mills DC, Watson DC, Hernandez M, Kelly JF, et al. Definition of the bacterial N-glycosylation site consensus sequence. Embo J (2006) 25:1957–1966.[CrossRef][Web of Science][Medline]
Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J Mol Biol (2001) 305:567–580.[CrossRef][Web of Science][Medline]
Lehle L, Strahl S, Tanner W. Protein glycosylation, conserved from yeast to man: A model organism helps elucidate congenital human diseases. Angew Chem Int Ed Engl (2006) 45:6802–6818.[CrossRef][Medline]
Lesage G, Bussey H. Cell wall assembly in Saccharomyces cerevisiae. Microbiol Mol Biol Rev (2006) 70:317–343.
Levin DE. Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol Mol Biol Rev (2005) 69:262–291.
Liu J, Mushegian A. Three monophyletic superfamilies account for the majority of the known glycosyltransferases. Protein Sci (2003) 12:1418–1431.[CrossRef][Web of Science][Medline]
Manthri S, Guther ML, Izquierdo L, Acosta-Serrano A, Ferguson MA. Deletion of the TbALG3 gene demonstrates site-specific N-glycosylation and N-glycan processing in Trypanosoma brucei. Glycobiology (2008) 18:367–383.
Mazhari-Tabrizi R, Blank M, Mumberg D, Funk M, Schwarz RT, Eckert V. Chromosomal promoter replacement in Saccharomyces cerevisiae: Construction of conditional lethal strains for the cloning of glycosyltransferases from various organisms. Glycoconj J (1999) 16:673–679.[CrossRef][Medline]
McConville MJ, Mullin KA, Ilgoutz SC, Teasdale RD. Secretory pathway of trypanosomatid parasites. Microbiol Mol Biol Rev (2002) 66:122–154.
Menetret JF, Hegde RS, Heinrich SU, Chandramouli P, Ludtke SJ, Rapoport TA, Akey CW. Architecture of the ribosome-channel complex derived from native membranes. J Mol Biol (2005) 348:445–457.[CrossRef][Web of Science][Medline]
Naderer T, Wee E, McConville MJ. Role of hexosamine biosynthesis in Leishmania growth and virulence. Mol Microbiol (2008) 69:858–869.[Medline]
Nasab FP, Schulz BL, Gamarro F, Parodi AJ, Aebi M. All in one: Leishmania major STT3 proteins substitute for the whole oligosaccharyltransferase complex in Saccharomyces cerevisiae. Mol Biol Cell (2008) 19:3758–3768.
Nilsson I, Kelleher DJ, Miao Y, Shao Y, Kreibich G, Gilmore R, von Heijne G, Johnson AE. Photocross-linking of nascent chains to the STT3 subunit of the oligosaccharyltransferase complex. J Cell Biol (2003) 161:715–725.
Nilsson I, von Heijne G. Glycosylation efficiency of Asn-Xaa-Thr sequons depends both on the distance from the C terminus and on the presence of a downstream transmembrane segment. J Biol Chem (2000) 275:17338–17343.
Osborne AR, Rapoport TA. Protein translocation is mediated by oligomers of the SecY complex with one SecY copy forming the channel. Cell (2007) 129:97–110.[CrossRef][Web of Science][Medline]
Parodi AJ. N-Glycosylation in trypanosomatid protozoa. Glycobiology (1993) 3:193–199.
Samuelson J, Banerjee S, Magnelli P, Cui J, Kelleher DJ, Gilmore R, Robbins PW. The diversity of dolichol-linked precursors to Asn-linked glycans likely results from secondary loss of sets of glycosyltransferases. Proc Natl Acad Sci USA (2005) 102:1548–1553.
Schagger H, von Jagow G. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal Biochem (1991) 199:223–231.[CrossRef][Web of Science][Medline]
Schwarz M, Knauer R, Lehle L. Yeast oligosaccharyltransferase consists of two functionally distinct sub-complexes, specified by either the Ost3p or Ost6p subunit. FEBS Lett (2005) 579:6564–6568.[CrossRef][Web of Science][Medline]
Shams-Eldin H, Blaschke T, Anhlan D, Niehus S, Muller J, Azzouz N, Schwarz RT. High-level expression of the Toxoplasma gondii STT3 gene is required for suppression of the yeast STT3 gene mutation. Mol Biochem Parasitol (2005) 143:6–11.[CrossRef][Medline]
Sharma CB, Knauer R, Lehle L. Biosynthesis of lipid-linked oligosaccharides in yeast: The ALG3 gene encodes the Dol-P-Man:Man5GlcNAc2-PP-Dol mannosyltransferase. Biol Chem (2001) 382:321–328.[CrossRef][Web of Science][Medline]
Sharma CB, Lehle L, Tanner W. N-Glycosylation of yeast proteins. Characterization of the solubilized oligosaccharyl transferase. Eur J Biochem (1981) 116:101–108.[Web of Science][Medline]
Spirig U, Bodmer D, Wacker M, Burda P, Aebi M. The 3.4-kDa Ost4 protein is required for the assembly of two distinct oligosaccharyltransferase complexes in yeast. Glycobiology (2005) 15:1396–1406.
Szymanski CM, Wren BW. Protein glycosylation in bacterial mucosal pathogens. Nat Rev Microbiol (2005) 3:225–237.[CrossRef][Web of Science][Medline]
Szymanski CM, Yao R, Ewing CP, Trust TJ, Guerry P. Evidence for a system of general protein glycosylation in Campylobacter jejuni. Mol Microbiol (1999) 32:1022–1030.[CrossRef][Web of Science][Medline]
Van Den Berg B, Clemons WM Jr, Collinson I, Modis Y, Hartmann E, Harrison SC, Rapoport TA. X-ray structure of a protein-conducting channel. Nature (2004) 427:36–44.[CrossRef][Medline]
Wacker M, Linton D, Hitchen PG, Nita-Lazar M, Haslam SM, North SJ, Panico M, Morris HR, Dell A, Wren BW, et al. N-Linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science (2002) 298:1790–1793.
Weerapana E, Imperiali B. Asparagine-linked protein glycosylation: From eukaryotic to prokaryotic systems. Glycobiology (2006) 16:91R–101R.
Wilson CM, Kraft C, Duggan C, Ismail N, Crawshaw SG, High S. Ribophorin I associates with a subset of membrane proteins after their integration at the sec61 translocon. J Biol Chem (2005) 280:4195–4206.
Wittig I, Braun HP, Schagger H. Blue native PAGE. Nat Protoc (2006) 1:418–428.[CrossRef][Web of Science][Medline]
Yan A, Lennarz WJ. Two oligosaccharyl transferase complexes exist in yeast and associate with two different translocons. Glycobiology (2005) 15:1407–1415.
Yan A, Lennarz WJ. Unraveling the mechanism of protein N-glycosylation. J Biol Chem (2005) 280:3121–3124.
Yan Q, Lennarz WJ. Studies on the function of oligosaccharyl transferase subunits. Stt3p is directly involved in the glycosylation process. J Biol Chem (2002) 277:47692–47700.
Yan Q, Lennarz WJ. Studies on the function of oligosaccharyl transferase subunits: A glycosylatable photoprobe binds to the luminal domain of Ost1p. Proc Natl Acad Sci USA (2002) 99:15994–15999.
Zufferey R, Knauer R, Burda P, Stagljar I, te Heesen S, Lehle L, Aebi M. STT3, a highly conserved protein required for yeast oligosaccharyl transferase activity in vivo. Embo J (1995) 14:4949–4960.[Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  N. Maita, J. Nyirenda, M. Igura, J. Kamishikiryo, and D. Kohda Comparative Structural Biology of Eubacterial and Archaeal Oligosaccharyltransferases J. Biol. Chem., February 12, 2010; 285(7): 4941 - 4950. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||