Glycobiology Advance Access originally published online on October 25, 2008
Glycobiology 2009 19(2):153-159; doi:10.1093/glycob/cwn117
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Complete chemoenzymatic synthesis of the Forssman antigen using novel glycosyltransferases identified in Campylobacter jejuni and Pasteurella multocida
2 Institute for Biological Sciences, National Research Council Canada, Ottawa, Ontario, K1A 0R6, Canada
3 US Department of Agriculture, Agricultural Research Service, Produce Safety and Microbiology Research Unit, Albany, CA, USA
1 To whom correspondence should be addressed: Tel: +1-613-991-9956; Fax: +1-613-952-9092; e-mail: michel.gilbert{at}nrc-cnrc.gc.ca
Received on July 1, 2008; revised on October 21, 2008; accepted on October 22, 2008
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
We have identified an
1,4-galactosyltransferase (CgtD) and a β1,3-N-acetylgalactosaminyltransferase (CgtE) in the lipooligosaccharide (LOS) locus of Campylobacter jejuni LIO87. Strains that carry these genes may have the capa- bility of synthesizing mimics of the P blood group antigens of the globoseries glycolipids. We have also identified an 1,3-N-acetylgalactosaminyltransferase (Pm1138) from Pasteurella multocida Pm70, which is involved in the synthesis of an LOS-bound Forssman antigen mimic and represents the only known bacterial glycosyltransferase with this specificity. The genes encoding the three enzymes were cloned and expressed in Escherichia coli as soluble recombinant proteins that can be used to chemoenzymatically synthesize the Forssman antigen, and its biosynthetic precursors, in high yields. Key words: Campylobacter jejuni / Forssman antigen / glycosyltransferase / Pasteurella multocida
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
The Forssman glycolipid is a glycosylceramide possessing a neutral pentasaccharide head group, referred to as the Forssman antigen (Fa) and is a member of the globoseries glycolipid family. The Fa has been identified in a number of mammals and exhibits heterogeneity with respect to developmental and cell-type expression among species. Some studies have reported the presence of the Fa in certain human embryonic and tumor cells (Yokota et al. 1981
; Ono et al. 1994). However, the human Forssman synthetase gene has been shown to encode an inactive enzyme (Xu et al. 1999; Elliott et al. 2003) which suggests that humans are not capable of synthesizing the Forssman glycolipid. Immunological methods used to detect the presence of the Fa may not effectively discriminate between authentic Fa and similar glycoconjugates.
The Pk and P blood group antigens, known as globotriose (Gb3) and globotetraose (Gb4), respectively, are biosynthetic precursors of the Fa (Figure 1). The glycosphingolipid Gb4 is synthesized from Gb3 through the addition of an N-acetylgalactosaminyl (GalNAc) residue catalyzed by a β1,3-GalNAc-transferase. The Forssman glycolipid is synthesized from Gb4 by adding a terminal GalNAc residue, catalyzed by an 1,3-GalNAc-transferase. The gene encoding the latter enzyme, referred to as the Forssman synthetase, was first identified in canine kidney cells (Haslam and Baenziger 1996). Its amino acid (aa) sequence is homologous with 1,3-Gal/GalNAc-transferases that are involved in the synthesis of related glycans, such as the AB histo-blood group antigens (Yamamoto et al. 1990; Keusch et al. 2000).
|
Bacteria often synthesize glycans found at the surface of host cells as a method to evade immune targeting. For instance, Campylobacter jejuni has been shown to synthesize ganglioside mimics as part of its lipooligosaccharide (LOS) (Yuki et al. 1993
); Haemophilus influenzae can incorporate Gb4 units in its LOS (Risberg et al. 1999); and Neisseria meningitidis and Escherichia coli synthesize capsular polysaccharides similar to polysialic acid found in mammals (Finne et al. 1983; Troy et al. 1975). Several genes encoding glycosyltransferases involved in the synthesis of these molecular mimics have been cloned and expressed in E. coli, and the enzymes have been successfully used to synthesize these glycans (Antoine et al. 2005; Blixt et al. 2005; Willis et al. 2008). This in turn has provided investigators in both academia and industry with readily available oligosaccharides that have been traditionally difficult to synthesize and/or purify. It is now generally recognized that bacterial glycosyltransferases are optimally suited for chemoenzymatic glycan synthesis because of the ease with which their genes can be cloned and expressed and their improved solubility over eukaryotic glycosyltransferases.
We have identified an 1,4-Gal-transferase and a β1,3-GalNAc-transferase from C. jejuni LIO87, and an 1,3-GalNAc-transferase from Pasteurella multocida Pm70. The three enzymes were produced as soluble recombinant proteins and used sequentially to synthesize the Fa in multimilligram quantities starting from p-nitrophenyl lactose.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
The LOS locus of C. jejuni LIO87 contains
1, 4-Gal-transferase and β1,3-GalNAc-transferase genesThe core glycan structure from C. jejuni is known to be highly variable primarily due to significant genetic heterogeneity within its LOS biosynthesis locus. The loci from over 70 strains have been sequenced to date and grouped into 19 classes based on their component genes (Gilbert et al. 2008
). Strains belonging to classes "A," "B," and "C" have received considerable attention because within their loci are enzymes that direct the synthesis of LOS-bound ganglioside mimics, which have been implicated in triggering autoimmune disease (Godschalk et al. 2004). Strain LIO87, which belongs to class "D," does not carry sialyltransferase or sialic acid biosynthesis genes in its LOS locus. Five genes among its 10 open reading frames (ORFs) are likely involved in the synthesis of the inner core, while the remaining five are putative outer core glycosyltransferases of unknown specificity (GenBank accession number AF400669
[GenBank]
).
We cloned the five putative class "D" outer core glycosyltransferases into E. coli and performed enzymatic activity screens. This entails adding different combinations of activated sugar donors (UDP-Glc, UDP-Gal, UDP-GlcNAc, and UDP-GalNAc) with fluorescently tagged acceptors (GalNAc-, Glcβ-, GlcNAcβ-, Lac-, LacNAc-, and Gb3-FCHASE) to lysates of transformed cells expressing the heterologous protein. Capillary-electrophoresis (CE) is then used to detect transferase activity. Two genes were found to be active in our screen. CgtD (C. jejuni glycosyltransferase D, protein sequence AAM90647
[GenBank]
) was found to transfer a galactosyl residue (from UDP-Gal) to both lactose (Lac) and N-acetyl-lactosamine (LacNAc) acceptors. A β1,3-N-acetylgalactosaminyltransferase (CgtE; protein sequence AAM90646
[GenBank]
) was found to transfer GalNAc (from UDP-GalNAc) to an Gal(1–4)-Lac substrate (i.e., Gb3). This indicates that in vivo the product of the CgtD enzymatic addition serves as the target for CgtE (Figure 1).
In order to scale up their production, both genes were cloned into a maltose-binding protein (MalE) expression vector (pCWori+), as C-terminal fusion constructs. Only CgtD gave rise to strong activity as a MalE–CgtD fusion (200– 300 units per liter) and an apparent inducible band on sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) (Figure 2). The analogous MalE–CgtE fusion did not express well (10–15 units per liter), indicating that the fusion with MalE appears to inhibit CgtE. CgtE expressed better without a fusion partner with a production of 100–150 units per liter of culture. In addition, we did not observe an IPTG inducible band on SDS–PAGE for either CgtE or MalE–CgtE. It is unclear why recombinant CgtE does not accumulate in the E. coli cytoplasm. It is possible that it is sensitive to proteolytic degradation and cannot accumulate to give a visible band by SDS–PAGE. Both CgtD and CgtE were found to require divalent cations, with the presence of Mn2+ yielding higher transferase levels than with Mg2+ (Table I). Using p-nitrophenyl-Lac (pNP-Lac) as an acceptor, CgtD was found to synthesize the Gb3 antigen, while Gb4 is produced by CgtE with pNP-Gb3 as its substrate. The structures of both derivatives were confirmed by NMR spectroscopy (Figure 3 and Table II), establishing that CgtD is an 1,4-Gal-transferase and CgtE a β1,3-GalNAc-transferase. pNP-LacNAc was also found to be a viable acceptor for CgtD, to produce pNP-Gal(1–4)LacNAc (Table I); this was also confirmed by NMR spectroscopy (supplementary Table I).
|
|
|
|
Surprisingly, the aa sequence of CgtD does not show significant homology with any characterized or putative glycosyltransferases, not even with LgtC, an
1,4-Gal-transferase grouped into GT8 of the CAZy database (Coutinho et al. 2003) that is found in H. influenzae, N. meningitidis, and N. gonorrhoeae. It shares significant aa sequence identity (57–97%) with hypothetical proteins in the LOS locus of other C. jejuni strains. CgtE is homologous (47–48% identity) with CgtB, a β1,3-Gal-transferase present in several C. jejuni strains (Bernatchez et al. 2007). However, the CgtE sequence shares very low sequence identity with glycosyltransferases possessing similar activities previously identified in other bacteria; it possesses only 20% identity with the β1,3-GalNAc-transferase LgtD found in H. influenzae and N. gonorrhoeae, both of which have been assigned to family GT2 in the CAZy database. Clearly, activity assays were essential to assign the functionality of both CgtD and CgtE.
P. multocida Pm70 carries an 1,3-GalNAc-transferase associated with LOS biosynthesis
The glycan component of the LOS from P. multocida Pm70 was found to incorporate the complete Fa at its nonreducing end (St. Michael et al. 2005). This observation correlates with the fact that this pathogen is frequently isolated from mammals that are known to express the Forssman glycolipid. Several putative LOS-associated glycosyltransferases are closely clustered within the P. multocida Pm70 genome. One of those, designated Pm1138, was hypothesized to be an 1,3-GalNAc-transferase that adds the terminal -GalNAc residue to the LOS outer core (St. Michael et al. 2005). Pm1138 shares aa sequence similarity with several putative Gal-transferases including an 1,3-Gal-transferase (GenBank accession number AF143904
[GenBank]
) from Actinobacillus pleuropneumoniae (Ramjeet et al. 2005). Pm1138 also shows weak homology with PglH and PglJ, two 1,4-GalNAc-transferases involved in C. jejuni protein glycosylation (Glover et al. 2005). Pm1138 belongs to CAZy family GT4 and does not possess sequence similarity with mammalian Forssman synthetases which belong to CAZy family GT6. Clearly, sequence homology is not sufficient to confirm the proposed specificity of Pm1138.
The gene encoding Pm1138 was cloned into a maltose-binding protein (MalE) expression vector (pCWori+) and expressed as a C-terminal fusion construct in E. coli (Figure 2). Subsequent activity screening indicated that it possesses transferase activity in the presence of an UDP-GalNAc donor and a βGalNAc-FCHASE substrate. Pm1138 has very low activity on GalNAc-FCHASE (Table I). The purified MalE–Pm1138 fusion was used to synthesize preparative quantities of the GalNAc-βGalNAc-FCHASE product. The reaction product was analyzed by mass spectrometry; the masses of the singly charged (985.5 m/z) and doubly charged (492.3 m/z) molecular ions are consistent with the expected molecular weight of a GalNAc-GalNAc-FCHASE molecule (data not shown). Analysis by NMR spectroscopy confirmed that the product of Pm1138 was GalNAc(1–3)βGalNAc-FCHASE (supplementary Table II), which confirms that Pm1138 is an 1,3-GalNAc-transferase. It would appear that its role in vivo is to add the terminal GalNAc residue to complete the LOS-bound Fa mimic produced by P. multocida Pm70, and currently it is the only known bacterial enzyme possessing this specificity.
Chemoenzymatic synthesis of the Fa pentasaccharide
The availability of recombinant and soluble forms of an 1,4-Gal-transferase, a β1,3-GalNAc-transferase, and an 1,3-GalNAc-transferase provides the means to synthesize the complete Fa glycan starting with a lactosyl derivative. A one-pot synthesis was not attempted because the β1,3-GalNAc-transferase (CgtE) can transfer both GalNAc and Gal which would result in a mixed product, although the activity with UDP-GalNAc is higher than with UDP-Gal (Table I). Starting with 107 µmol (50 mg) of pNP-Lac, we synthesized and isolated 66 µmol (61.7% yield) of pNP-Gb3. Analysis of the reaction by thin layer chromatography (TLC) suggested that the conversion of pNP-Lac to pNP-Gb3 went to completion, but some material was lost during purification on the C18 SepPak column. Starting with 40 µmol (25 mg) of pNP-Gb3, we synthesized and isolated 38 µmol (95% yield) of pNP-Gb4. In the final step of the synthesis, we synthesized and isolated 13.5 µmol of pNP-Fa from 15 µmol (12.4 mg) of pNP-Gb4 (90% yield). Both of the latter two reactions resulted in complete conversion of the substrates as judged by TLC analysis, which was consistent with the excellent recovery yield for the final two steps of the synthesis. The structure of the final product (pNP-Fa) was confirmed by NMR spectroscopy (Figure 3, Table II
).
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
The Fa is expressed in a variety of animals in a species-specific pattern, usually as a complex carbohydrate associated with cell-surface antigens. Gb4, the precursor of the Fa, serves as an attachment site for bacteria, viruses, and toxins in humans and other species. The conversion of a Gb4 precursor into the Fa will have an impact on the adherence of pathogenic organisms, directly affecting microbial ecology and modifying host susceptibility to infectious diseases in some species (Elliot et al. 2003
). Understanding binding interactions of the Fa with proteins such as toxins, antibodies, and selectins would be facilitated by the availability of large amounts of soluble Fa derivatives. Although the Fa pentasaccharide has been chemically synthesized (Nilsson et al. 1994), we believe that the glycosyltransferases described in this work could be usefully applied to enable rapid and efficient synthesis of this cell-surface antigen for future investigations.
A recombinant 1,4-Gal-transferase (LgtC) from N. meningitidis has been used previously in high-yield syntheses of the Gb3 trisaccharide (Zhang et al. 2002; Antoine et al. 2005) and of the P1 trisaccharide (Gal(1–4)βGal(1–4)βGlcNAc) (Liu et al. 2003). Zhang et al. (2002) obtained the production of 300 units per liter of culture for the recombinant LgtC 1,4-Gal-transferase, while we report the production of 200–300 units per liter for the recombinant CgtD. It is difficult, however, to compare directly these production levels because the assay conditions and acceptor labeling groups were different. Both enzymes achieved quantitative conversion of lactosyl derivatives to the corresponding products and are potentially useful in large-scale syntheses of Gb3 derivatives.
Shao et al. (2002) and Antoine et al. (2005) have used a recombinant β1,3-GalNAc-transferase (LgtD) from H. influenzae in high-yield syntheses of the Gb4 tetrasaccharide. The production of LgtD in units per liter was not reported in these two publications and it is difficult to determine if the recombinant CgtE represents an improvement as a source of β1,3-GalNAc-transferase activity. The recombinant LgtD was produced as a highly soluble form at a high level by Shao et al. (2002). An IPTG inducible band was clearly visible by SDS–PAGE and a purification protocol has been developed for LgtD. Considering that we did not observe an inducible band with CgtE and could not develop a purification protocol, it is likely that LgtD has more potential as a reagent for large-scale syntheses of Gb4 analogs.
The complete structure of the LOS core glycan of C. jejuni LIO87 has not been determined, although we know that it does not contain a Gb3 or Gb4 mimic. Mass spectrometry analysis has shown that it possesses a truncated LOS outer core with only a HexNAc residue attached to the inner core (supplementary Table III). The truncated LOS of C. jejuni LIO87 indicates that the activities of CgtD and CgtE are limited, probably by an inactive and yet unidentified glycosyltransferase that prevents the production of a glycan template that can serve as a substrate for further elongation by CgtD and CgtE. In contrast, the LOS core glycan of C. jejuni RM1221, which has identical copies of cgtD and cgtE (NCBI protein sequences AAW35603
[GenBank]
and AAW35602
[GenBank]
, respectively), has been elucidated recently and found to contain a Gb4 mimic (Mandrell et al. 2007). Both cgtD and cgtE from C. jejuni RM1221 were found to contain homopolymeric G-tracts, which lead to the phase-variable expression of these genes. As a consequence, the LOS outer core structure in C. jejuni RM1221 possesses a heterogeneous mixture of glycans including P (Gb4), P1, and possibly Pk (Gb3) antigen mimics (Mandrell et al. 2007). Strains carrying cgtD and cgtE, therefore, have the potential to synthesize LOS-bound P blood group antigen mimics, which represents another glycan antigen mimicry strategy to evade the immune response, similar to the well-described ganglioside mimicry (Aspinall et al. 1994; Moran et al. 1996).
|
Material and methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
Bacterial cells
The genes encoding CgtD (
1,4-Gal-transferase) and CgtE (β1,3-GalNAc-transferase) were cloned from C. jejuni strain LIO87. Cells were grown on Mueller–Hinton agar (Becton Dickinson, Sparks, MD) under microaerophilic conditions at 37°C. Pm1138 (1,3-GalNAc-transferase) was cloned from P. multocida strain Pm70 which was grown on chocolate agar at 37°C.
Gene cloning and transformation
Genomic DNA from both C. jejuni and P. multocida was obtained using a DNeasy Tissue Kit (QIAGEN, Mississauga, Canada). The cgtE gene was amplified from C. jejuni LIO87 genomic DNA using Pwo polymerase (Roche Applied Science, Laval, Canada) and the following two primers containing NdeI and SalI restriction sites (italicized), respectively: CJ-640 (5'-TTTAAGAAAACATATG CGTAAAA TTTCAATCATC-3' 34-mer) and CJ-641 (5'-GGTAATCTA GTCGACAATTATAACACATTC-3'). Similarly, Pm1138 was amplified from P. multocida Pm70 genomic DNA using the primers PML-1 (5'-GCTACTCTTCATATGAATATTCTATT- TGTACATAAAAGCCTTG-3' 44-mer) and PML-2 (5'-CTT AGCGTCGACTTAACTATTGAATTTTTG TAAATGAGA-3' 40-mer). The gene encoding CgtD in C. jejuni LIO87 was amplified in two stages in order to introduce silent mutations to an heterogeneous homopolymeric G-tract and to obtain an in-frame ORF. Two separate PCR reactions were performed to generate two overlapping gene fragments containing the silent mutations due to either the 5' or the 3' primers (underlined bases in primers CJ-637 and CJ-638). Two PCR products were obtained using either primers CJ-636 (5'-TAAAAGGCTACATATG ACTGAAATTTCAAGTTTTTGG-3' 37-mer) and CJ-637 (5'-CCCATACGCCTCCTCTGAGATA AAGTAG-3') or primers CJ-638 (5'-CTACTTTATCTCAGAG GAGGCGTATGGG-3') and CJ-639 (5'-GGCAAGATGATT GTCGACTTAGGCATTGTTTTTC-3' 34-mer). The two PCR products were then used with primers CJ-636 and CJ-639, containing NdeI and SalI restriction sites, to amplify the full-length cgtD gene containing an in-frame homogeneous ORF. The PCR products were digested with NdeI and SalI and cloned into pCWori+(–lacZ) and in a version of pCWori+(–lacZ) containing the sequence encoding the E. coli maltose-binding protein (without the leader peptide) and the thrombin cleavage site. The resulting plasmids were electroporated into E. coli AD202.
Enzyme expression and purification
The strains carrying the constructs for the expression of the glycosyltransferases were grown in 2 YT medium containing 150 µg/mL ampicillin and 2 g/L glucose. The cultures were incubated at 37°C until A600 = 0.35, induced with 1 mM isopropyl-1-thio-β-D-galactopyranoside, and then incubated overnight at 20°C. The cells were broken using an Avestin C5 Emulsiflex cell disruptor (Avestin, Ottawa, Canada). The fusion proteins MalE–CgtD and MalE–Pm1138 were purified by affinity chromatography on amylose resin following the manufacturer's instructions (New England Biolabs, Beverly, MA). Since CgtE could not be produced with a purification tag, we centrifuged the cell extract at 27,000 x g and used the supernatant directly in syntheses of Gb4 derivatives.
Enzyme assays
FCHASE-labeled oligosaccharides (Wakarchuk et al. 1996) were incubated with cell lysates prepared by sonication or with recombinant enzymes purified as described above. Enzyme screening assays were performed at 37°C for 5–30 min using a 1 mM donor and a 0.5 mM acceptor. All reactions were stopped with 10 µL of 50% acetonitrile, 10 mM EDTA, and 1% SDS and diluted with H2O to obtain 10–15 µM of the FCHASE-labeled compounds. The samples were analyzed by CE as described previously (Wakarchuk and Cunningham 2003) except that a P/ACE MDQ CE System equipped with a Laser module 488 (Beckman Coulter, Fullerton, CA) was used. Quantification of activity was performed by integration of the trace peaks using the MDQ 32 Karat software. Transferase activity to acceptor glycans was also verified by CE-mass spectrometry using previously described methods (Li et al. 2004).
Chemoenzymatic synthesis of pNP-Gb3, pNP-Gb4, and pNP-Fa
For the synthesis of pNP-Gb3, 50 mg (107 µmol) of pNP-Lac was dissolved in 10 mL of H2O. The reaction was started in a volume of 14.7 mL containing 50 mM Hepes, pH 7.5, 10 mM MnCl2, 195 µmol of UDP-Gal, and five units of MalE-CgtD (1,4-Gal-transferase). The reaction was >95% complete after 2 h of incubation at 37°C, as judged by TLC analysis. The reaction was supplemented with 0.85 unit of MalE–CgtD and 20 µmol of UDP-Gal, and incubated for another 1 h at 37°C. The conversion of pNP-Lac to pNP-Gb3 was complete after a total of 3 h of incubation at 37°C. The reaction was diluted with 120 mL of H2O and loaded on a C18 SepPak column (5 g) equilibrated with H2O. Hydrophilic material was washed off with water and the product was eluted with 100% methanol. Appropriate fractions were collected and evaporated to give 41.2 mg (66 µmol) of pNP-Gb3.
For the synthesis of pNP-Gb4, 25 mg (40 µmol) of pNP-Gb3 was dissolved in 0.8 mL of H2O. The reaction was performed in an 8 mL volume containing 50 mM Hepes, pH 7.5, 10 mM MnCl2, 80 µmol of UDP-GlcNAc, 15 units of UDP-GlcNAc 4-epimerase (Bernatchez et al. 2005), and 1.7 units of CgtE (β1,3-GalNAc-transferase). The reaction was complete after 2 h of incubation at 37°C, as judged by TLC analysis. The reaction was diluted with 100 mL of H2O and purified on a C18 SepPak column (5 g) as described above, except that the product was eluted with 60% methanol. Appropriate fractions were collected and evaporated to give 31.6 mg (38 µmol) of pNP-Gb4.
For the synthesis of pNP-Fa, 12.4 mg (15 µmol) of pNP-Gb4 was dissolved in 0.3 mL of H2O. The reaction was performed in 3 mL containing 50 mM Hepes, pH 8, 10 mM MgCl2, 30 µmol of UDP-GlcNAc, 5.3 units of UDP-GlcNAc 4-epimerase (Bernatchez et al. 2005), and 0.12 units of MalE-Pm1138 (1,3-GalNAc-transferase). The reaction was complete after 60 min of incubation at 37°C, as judged by TLC analysis. The reaction was diluted with 35 mL of H2O and loaded on two C18 SepPak columns (1 g) equilibrated with H2O. Hydrophilic material was washed off with water and the product was eluted with 60% methanol. Appropriate fractions were collected and evaporated to give 13.5 µmol of pNP-Fa.
Structural characterization of the glycan derivatives
NMR spectroscopy was used to confirm the composition and structure of CgtD, CgtE, and Pm1138 enzymatic products, which included GalNAc(1–3)βGalNAc-FCHASE, pNP-Gal(1–4)LacNAc, pNP-βGal(1–3)Gal(1–4)LacNAc as well as pNP-Gb3, pNP-Gb4, and pNP-Fa. The spectra of the compounds were acquired in 100% D2O at 25°C at concentrations of 3–6 mM on Varian spectrometers operating at 500 and 600 MHz (Varian, Palo Alto, CA). Standard 1H–1H COSY, TOCSY and NOESY spectra and 1H-13C HSQC and HMBC spectra were acquired as previously described (Gilbert et al. 2000), to make resonance assignments and to verify the linkage position between component monosaccharides. Chemical shifts were referenced with respect to the methyl group of an internal acetone standard appearing at 2.23 and 31.1 ppm for 1H and 13C, respectively.
|
Supplementary data |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
Supplementary data for this article is available online at http://glycob.oxfordjournals.org/.
|
Funding |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
The Human Frontier Science Program (RGP 38/2003) and NEOSE Technologies, Horsham, PA, USA.
|
Conflict of interest statement |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
None declared.
|
Acknowledgements |
|---|
We thank Dr. Jianjun Li for the mass spectrometry analysis of
GalNAc(1–3)βGalNAc-FCHASE. |
Abbreviations |
|---|
Aa, amino acid; CE, capillary electrophoresis; Fa, Forssman antigen; FCHASE, 6-(fluorescein-5-carboxamido)-hexanoic acid; Gal, galactose; GalNAc, N-acetylgalactosamine; Gb3, globotriose; Gb4, globotetraose; Lac, lactose; LOS, lipooligo- saccharide; ORFs, open reading frames; pNP, p-nitrophenol; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; TLC, thin layer chromatography
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterial and methodsSupplementary dataFundingConflict of interest statementReferences |
|---|
Antoine T, Bosso C, Heyraud A, Samain E. Large scale in vivo synthesis of globotriose and globotetraose by high cell density culture of metabolically engineered Escherichia coli. Biochimie (2005) 87:197–203.
Aspinall GO, Fujimoto S, McDonald AG, Pang H, Kurjanczyk LA, Penner JL. Lipopolysaccharides from Campylobacter jejuni associated with Guillain–Barré syndrome patients mimic human gangliosides in structure. Infect Immun. (1994) 62:2122–2125.
Bernatchez S, Gilbert M, Blanchard MC, Karwaski MF, Li J, Defrees S, Wakarchuk WW. Variants of the β1,3-galactosyltransferase CgtB from the bacterium Campylobacter jejuni have distinct acceptor specificities. Glycobiology. (2007) 17:1333–1343.
Bernatchez S, Szymanski CM, Ishiyama N, Li J, Jarrell HC, Lau PC, Berghuis AM, Young NM, Wakarchuk WW. A single bifunctional UDP-GlcNAc/Glc 4-epimerase supports the synthesis of three cell surface glycoconjugates in Campylobacter jejuni. J Biol Chem. (2005) 280:4792–4802.
Blixt O, Vasiliu D, Allin K, Jacobsen N, Warnock D, Razi N, Paulson JC, Bernatchez S, Gilbert M, Wakarchuk W. Chemoenzymatic synthesis of 2-azidoethyl-ganglio-oligosaccharides GD3, GT3, GM2, GD2, GT2, GM1, and GD1a. Carbohydr Res. (2005) 340:1963–1972.[CrossRef][Web of Science][Medline]
Coutinho PM, Deleury E, Davies GJ, Henrissat B. An evolving hierarchical family classification for glycosyltransferases. J Mol Biol. (2003) 328:307–317.[CrossRef][Web of Science][Medline]
Elliott SP, Yu M, Xu H, Haslam DB. Forssman synthetase expression results in diminished Shiga toxin susceptibility: A role for glycolipids in determining host–microbe interactions. Infect Immun. (2003) 71:6543–6552.
Finne J, Leinonen M, Makela PH. Antigenic similarities between brain components and bacteria causing meningitis. Implications for vaccine development and pathogenesis. Lancet. (1983) 322:355–357.[CrossRef]
Gilbert M, Brisson JR, Karwaski MF, Michniewicz J, Cunningham AM, Wu Y, Young NM, Wakarchuk WW. Biosynthesis of ganglioside mimics in Campylobacter jejuni OH4384: Identification of the glycosyltransferase genes, enzymatic synthesis of model compounds, and characterization of nanomole amounts by 600-MHz 1H and 13C NMR analysis. J Biol Chem. (2000) 275:3896–3906.
Gilbert M, Parker CT, Moran AP. Campylobacter jejuni lipooligosaccharides: Structures and biosynthesis. In: Campylobacter (2008) 3rd ed. Washington (DC): ASMPress. 483–504.
Glover KJ, Weerapana E, Imperiali B. In vitro assembly of the undecaprenylpyrophosphate-linked heptasaccharide for prokaryotic N-linked glycosylation. Proc Natl Acad Sci USA. (2005) 102:14255–14259.
Godschalk PC, Heikema AP, Gilbert M, Komagamine T, Ang CW, Glerum J, Brochu D, Li J, Yuki N, Jacobs BC, et al. The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody induction in Guillain–Barré syndrome. J Clin Invest. (2004) 114:1659–1665.[CrossRef][Web of Science][Medline]
Haslam DB, Baenziger JU. Expression cloning of Forssman glycolipid synthetase: A novel member of the histo-blood group ABO gene family. Proc Natl Acad Sci USA. (1996) 93:10697–10702.
Keusch JJ, Manzella SM, Nyame KA, Cummings RD, Baenziger JU. Expression cloning of a new member of the ABO blood group glycosyltransferases, iGb3 synthase, that directs the synthesis of isoglobo-glycosphingolipids. J Biol Chem. (2000) 275:25308–25314.
Li J, Cox AD, Hood D, Moxon ER, Richards JC. Application of capillary electrophoresis-electrospray-mass spectrometry to the separation and characterization of isomeric lipopolysaccharides of Neisseria meningitidis. Electrophoresis. (2004) 25:2017–2025.[CrossRef][Medline]
Liu Z, Lu Y, Zhang J, Pardee K, Wang PG. P1 trisaccharide (Gal1–4Galβ1–4GlcNAc) synthesis by enzyme glycosylation reactions using recombinant Escherichia coli. Appl Environ Microbiol. (2003) 69:2110–2115.
Mandrell RE, Partker CT, Bates AH, Vinogradov E, Li J, St. Michael F, Gilbert M. Campylobacter jejuni strain RM1221 lipooligosaccharide mimics globo- and lactoneo-series P blood group antigens. (2007) 107th General Meeting of the American Society for Microbiology. D-027.
Moran AP, Prendergast MM, Appelmelk BJ. Molecular mimicry of host structures by bacterial lipopolysaccharides and its contribution to disease. FEMS Immunol Med Microbiol. (1996) 16:105–115.[CrossRef][Web of Science][Medline]
Nilsson U, Ray AK, Magnusson G. Synthesis of the Forssman pentasaccharide and terminal tetra-, tri-, and di-saccharide fragments. Carbohydr Res. (1994) 252:137–148.[Medline]
Ono K, Hattori H, Uemura K, Nakayama J, Ota H, Katsuyama T. Expression of Forssman antigen in human large intestine. J Histochem Cytochem. (1994) 42:659–665.[Abstract]
Ramjeet M, Deslandes V, St. Michael F, Cox AD, Kobisch M, Gottschalk M, Jacques M. Truncation of the lipopolysaccharide outer core affects susceptibility to antimicrobial peptides and virulence of Actinobacillus pleuropneumoniae serotype 1. J Biol Chem. (2005) 280:39104–39114.
Risberg A, Masoud H, Martin A, Richards JC, Moxon ER, Schweda EK. Structural analysis of the lipopolysaccharide oligosaccharide epitopes expressed by a capsule-deficient strain of Haemophilus influenzae Rd. Eur J Biochem. (1999) 261:171–180.[Web of Science][Medline]
Shao J, Zhang J, Kowal P, Lu Y, Wang PG. Overexpression and biochemical characterization of β-1,3-N-acetylgalactosaminyltransferase LgtD from Haemophilus influenzae strain Rd. Biochem Biophys Res Commun. (2002) 295:1–8.[CrossRef][Medline]
St. Michael F, Vinogradov E, Li J, Cox AD. Structural analysis of the lipopolysaccharide from Pasteurella multocida genome strain Pm70 and identification of the putative lipopolysaccharide glycosyltransferases. Glycobiology. (2005) 15:323–333.
Troy FA, Vijay IK, Tesche N. Role of undecaprenyl phosphate in synthesis of polymers containing sialic acid in Escherichia coli. J Biol Chem. (1975) 250:156–163.
Wakarchuk W, Martin A, Jennings MP, Moxon ER, Richards JC. Functional relationships of the genetic locus encoding the glycosyltransferase enzymes involved in expression of the lacto-N-neotetraose terminal lipopolysaccharide structure in Neisseria meningitidis. J Biol Chem. (1996) 271:19166–19173.
Wakarchuk WW, Cunningham AM. Capillary electrophoresis as an assay method for monitoring glycosyltransferase activity. Methods Mol Biol. (2003) 213:263–274.[Medline]
Willis LM, Gilbert M, Karwaski MF, Blanchard MC, Wakarchuk WW. Characterization of the -2,8-polysialyltransferase from Neisseria meningitidis with synthetic acceptors, and the development of a self-priming polysialyltransferase fusion enzyme. Glycobiology. (2008) 18:177–186.
Xu H, Storch T, Yu M, Elliott SP, Haslam DB. Characterization of the human Forssman synthetase gene. An evolving association between glycolipid synthesis and host-microbial interactions. J Biol Chem. (1999) 274:29390–29398.
Yamamoto F, Clausen H, White T, Marken J, Hakomori S. Molecular genetic basis of the histo-blood group ABO system. Nature. (1990) 345:229–233.[CrossRef][Medline]
Yokota M, Warner GA, Hakomori S. Blood group A-like glycolipid and a novel Forssman antigen in the hepatocarcinoma of a blood group O individual. Cancer Res. (1981) 41:4185–4190.
Yuki N, Taki T, Inagaki F, Kasama T, Takahashi M, Saito K, Handa S, Miyatake T. A bacterium lipopolysaccharide that elicits Guillain–Barré syndrome has a GM1 ganglioside-like structure. J Exp Med. (1993) 178:1771–1775.
Zhang J, Kowal P, Fang J, Andreana P, Wang PG. Efficient chemoenzymatic synthesis of globotriose and its derivatives with a recombinant -(1
4)-galactosyltransferase. Carbohydr Res (2002) 337:969–976.[CrossRef][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||