Glycobiology Advance Access originally published online on October 24, 2008
Glycobiology 2009 19(2):126-134; doi:10.1093/glycob/cwn110
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The N-linked oligosaccharide at Fc
RIIIa Asn-45: an inhibitory element for high Fc
RIIIa binding affinity to IgG glycoforms lacking core fucosylation
2 Tokyo Research Laboratories, Kyowa Hakko Kogyo Co., Ltd, 3-6-6 Asahi-machi, Machida-shi, Tokyo 194-8533
3 Graduate School of Pharmaceutical Sciences, Nagoya City University, Mizuho-ku, Nagoya 467-8603
4 Okazaki Institute for Integrative Bioscience and Institute for Molecular Science, National Institutes of Natural Sciences, 5-1 Higashiyama, Myodaiji, Okazaki, Aichi 444-8787, Japan
1 To whom correspondence should be addressed: Tel: +81-42-725-2556; Fax: +81-42-726-8330; e-mail: msatoh{at}kyowa.co.jp
Received on August 22, 2008; revised on October 9, 2008; accepted on October 10, 2008
| Abstract |
|---|
|
|
|---|
Human leukocyte receptor IIIa (Fc
RIIIa) plays an important role in mediating therapeutic antibodies antibody-dependent cellular cytotoxicity (ADCC), which is closely related to the clinical efficacy of anticancer processes in humans in vivo. The removal of the core fucose from oligosaccharides attached to the Fc region of antibodies improves Fc
RIIIa binding, allowing the antibodies to enhance dramatically the antibody effector functions of ADCC. In this study, the contribution of Fc
RIIIa oligosaccharides to the strength of the Fc
RIIIa/antibody complex was analyzed using a serial set of soluble human recombinant Fc
RIIIa lacking the oligosaccharides. A nonfucosylated antibody IgG1 appeared to have a significantly higher affinity to the wild-type Fc
RIIIa fully glycosylated at its five N-linked oligosaccharide sites than did the fucosylated IgG1, and this increased binding was almost abolished once all of the Fc
RIIIa glycosylation was removed. Our gain-of-function analysis in the Fc
RIIIa oligosaccharide at Asn-162 (N-162) confirmed that N-162 is the element required for the high binding affinity to nonfucosylated antibodies, as previously revealed by loss-of-function analyses. Interestingly, beyond our expectation, the Fc
RIIIa modified by N-162 alone showed a significantly higher binding affinity to nonfucosylated IgG1 than did the wild-type Fc
RIIIa. Attachment of the other four oligosaccharides, especially the Fc
RIIIa oligosaccharide at Asn-45 (N-45), hindered the high binding affinity of Fc
RIIIa to nonfucosylated IgG1. Our data clearly demonstrated that N-45 is an inhibitory element for the high Fc
RIIIa binding affinity mediated by N-162 to nonfucosylated antibodies. This information can be exploited for the structural-based functional study of Fc
RIIIa.
Key words:
Fc
RIIIa Asn-45
/
Fc
RIIIa binding affinity
/
IgG1 lacking core fucosylation
/
N-linked Fc oligosaccharides
/
N-linked Fc
RIIIa oligosaccharides
| Introduction |
|---|
|
|
|---|
Most therapeutic antibodies that have been licensed and developed as medical agents are of the human IgG1 isotype. Human IgG1 is a heavily fucosylated glycoprotein bearing two N-linked biantennary complex-type oligosaccharides bound to the antibody constant region (Fc) via Asn-297, and it exercises biological activities referred to as "effector functions" of antibody-dependent cellular cytotoxicity (ADCC) and complement- dependent cytotoxicity (CDC) through the interaction of the Fc with either leukocyte receptors (Fc
Rs) or complement components. Genetic analyses of Fc
R polymorphisms of cancer patients have demonstrated that ADCC is one of the major critical mechanisms responsible for the clinical efficacy of therapeutic antibodies such as anti-CD20 rituximab (Rituxan®) and anti-Her2 trastuzumab (Herceptin®) (Cartron et al. 2002
RIIIa allotype (Fc
RIIIa-Val-158), in contrast to those carrying the low-affinity allotype (Fc
RIIIa-Phe-158), superior clinical responses have also been demonstrated in cases such as rituximab-treated systemic lupus erythematosus (SLE) and Waldenstrom's macroglobulinemia, Crohn's disease treatment with anti-TNF-
infliximab (Remicade®), and pregnant women with fetal hemolytic disease treated with anti-RhD (Anolik et al. 2003
Interestingly, the Fc oligosaccharide structures of therapeutic antibodies greatly influence Fc
RIIIa binding, and the removal of the core fucose from Fc oligosaccharides dramatically enhances the effector functions of ADCC via improved Fc
RIIIa binding both in vitro and in vivo (Shields et al. 2002
; Shinkawa et al. 2003
; Niwa, Hatanaka, et al. 2004
; Niwa, Shoji-Hosaka, et al. 2004
; Yamane-Ohnuki et al. 2004
; Niwa et al. 2005
; Iida et al. 2006
; Kanda et al. 2006
; Satoh et al. 2006
; Suzuki et al. 2007
). Although fucose depletion from the Fc oligosaccharides of antibodies is found to improve binding affinity to Fc
RIIIa via an enthalpy-driven and association-rate-assisted mechanism (Okazaki et al. 2004
), the precise, structurally based mechanisms of the affinity enhancement remain to be elucidated. In the Fc
RIIIa/IgG complexes, the interaction sites on the Fc for binding to Fc
RIIIa form protein portions in the hinge and CH2 regions only (Morgan et al. 1995
; Clark 1997
). The generation of the essential Fc tertiary conformation for binding to Fc
RIIIa depends on the presence of the Fc oligosaccharides attached to the CH2 domains, and the antibody effector functions mediated via Fc
RIIIa are severely abrogated in aglycosylated forms of antibodies (Tao and Morrison 1989; Krapp et al. 2003
). The crystal structure analysis of human IgG1 has revealed that the antibody oligosaccharides linked to the Fc are integral to the protein portion of the Fc and form multiple noncovalent interactions with the CH2 domains (Huber et al. 1976
; Harris et al. 1998
; Radaev et al. 2001
). Thus, multiple noncovalent interactions between the oligosaccharides and the protein exert a reciprocal influence of each on the conformation of the other, and these complexities of human IgG1, along with the core fucose heterogeneity of the Fc oligosaccharides, delicately affect the binding affinity with Fc
RIIIa.
Human Fc
RIIIa is also a glycoprotein bearing five N-linked oligosaccharides bound to the asparagine residues at positions 38, 45, 74, 162, and 169 (Ravetch and Perussia 1989
). Recently, based on the crystal structure analysis, the ADCC enhancement by IgG1 lacking core fucosylation was attributed to a subtle conformational change in a limited region of the Fc of IgG1 (Matsumiya et al. 2007
), and the high affinity of nonfucosylated antibodies for Fc
RIIIa is partially mediated by interactions formed between the Fc
RIIIa oligosaccharide at Asn-162 and regions of the Fc that are only accessible when the Fc oligosaccharides are nonfucosylated (Ferrara et al. 2006
). In this study, we focused on the Fc
RIIIa oligosaccharides to elucidate their functions in the complex interaction between Fc
RIIIa and IgG1 antibody molecules more precisely. The results give us new and important insights for better understanding the efficacy of antibody therapies, especially therapeutic antibodies lacking core fucosylation.
| Results |
|---|
|
|
|---|
Purification of N-linked oligosaccharide-depleted Fc
RIIIaA serial set of the hexa-His-tagged soluble human recombinant Fc
RIIIa (shFc
RIIIa-His) lacking the N-linked oligosaccharides was generated by altering asparagine of the N-glycosylation sites into glutamine using the wild-type Fc
RIIIa-Val-158 bearing five N-linked glycosylation sites as a template. These included shFc
RIIIa-His lacking all five N-linked oligosaccharides (No-oligo-shFc
RIIIa-His), shFc
RIIIa-His bearing only one oligosaccharide at Asn-162 (N162-shFc
RIIIa-His), shFc
RIIIa-His bearing oligosaccharides at both Asn-45 and Asn-162 (N45-N162-shFc
RIIIa-His), shFc
RIIIa-His lacking only one oligosaccharide at Asn-45 (No-N45-shFc
RIIIa-His), and the wild-type shFc
RIIIa-His bearing all five N-linked oligosaccharides (Figure 1). The N-terminal amino acid of these shFc
RIIIa-His proteins was unified to Glu3 by directly connecting to a signal peptide to avoid the N-terminal amino acid heterogeneity observed in the expression of original Fc
RIIIa cDNA. The mammalian expression vector carrying each cDNA for the wild-type and mutants was introduced into Chinese hamster ovary (CHO) cell line CHO/DG44, and the expressed products were purified from the culture medium by Ni-NTA chromatography. The wild-type shFc
RIIIa-His migrated as a broadband of a glycoprotein with the appropriate molecular weight of about 37 kDa (Figure 2, lane 1). In the expression of N162-shFc
RIIIa-His, degraded products were observed (Figure 2, lane 2), and the N-terminal amino acid sequence analysis revealed that the lowest SDS–PAGE band under the reducing condition contained the four degraded products whose N-terminal amino acid sequences were Glu3-Asp-Leu-Lys-Pro-Lys-Ala-Val-Val-Phe-Leu13, Lys131-Tyr-Phe-His-His-Asn136, Ala144-Thr-Leu-Lys-Asp-Ser-Gly-Ser-Tyr152, and Asp148-Ser-Gly-Ser-Tyr-Phe153 (Figure 3). The N-terminal amino acid sequence of the highest and middle bands was Glu3-Asp-Leu-Lys-Pro-Lys-Ala-Val-Val-Phe-Leu13 (Figure 3). This degradation was not inhibited even though the culture medium was prepared in the presence of protease inhibitors including 0.5 mM PMSF, 3.6 µM pepstatin A, 0.3 µM aprotinin, 16.1 µM bestatin, 5.6 µM E-64, and 4.6 µM leupeptin. Comparable degraded products were also observed in No-oligo-shFc
RIIIa-His, although no such degraded product was observed among the other three shFc
RIIIa-His recombinants (data not shown). Subsequent gel filtration chromatography excluded the degraded products to yield almost homogeneously purified (over 95%) products in SDS–PAGE analysis under the nonreducing condition (Figure 4A). All purified shFc
RIIIa-His products migrated as bands with almost the same sizes as we had expected in SDS–PAGE (Figure 4).
|
|
|
|
Characterization of N-linked oligosaccharide-depleted Fc
RIIIaSDS–PAGE analysis under the reducing condition revealed that two purified samples, that of No-oligo-shFc
RIIIa-His and that of N162-shFc
RIIIa-His, each still contained a band with a lower molecular weight than the expected products, which was observed in the products purified by Ni-NTA chromatography (Figure 4B). Interestingly, IgG affinity chromatography analysis showed that the band retained the ability to bind IgG1 (Figure 5). The majority of the attached oligosaccharides of N162-shFc
RIIIa-His were of the sialylated biantennary complex-type oligosaccharides containing two galactoses with a fucosylated core structure, and the nonsialylated neutral oligosaccharide form was a minor component of the oligosaccharides attached to N162-shFc
RIIIa-His (Figure 6). The oligosaccharide structure of the wild type and other shFc
RIIIa-His mutants produced by CHO/DG44 was confirmed to be of the complex type (data not shown).
|
|
IgG1 binding activity
The IgG1 binding activity of the wild-type and of each purified mutant shFc
RIIIa lacking the N-linked oligosaccharides was estimated by Fc
RIIIa-binding ELISA and by surface plasmon resonance measurement using shFc
RIIIa-His. Compared with the binding to fucosylated IgG1, the wild-type Fc
RIIIa showed superior binding affinity to nonfucosylated IgG1. This phenomenon was also observed in the three Fc
RIIIa mutants lacking the N-linked oligosaccharides except for the Fc
RIIIa mutant lacking all five N-linked oligosaccharides of No-oligo-shFc
RIIIa-His (Figure 7). No-oligo-shFc
RIIIa-His showed mostly equivalent binding to IgG1 irrespective of core fucosylation and weaker binding than the other glycosylated Fc
RIIIas to nonfucosylated IgG1. A binding kinetics analysis using a BIAcoreTM biosensor system T100 (BIAcore, Uppsala, Sweden) confirmed the differences observed in Fc
RIIIa-binding ELISA (Figure 8). The sensorgrams clearly showed that N162-shFc
RIIIa-His carrying only one N-linked oligosaccharide at Asn-162 had the strongest binding affinity to nonfucosylated IgG1 rather than the wild-type shFc
RIIIa-His (Figure 8B and F) and that the additional attachment of N-linked oligosaccharide at Asn-45 decreased the high binding affinity (Figure 8F and G). The deletion of the N-linked oligosaccharide at Asn-45 in the wild-type shFc
RIIIa-His also exhibited its negative effect on the binding affinity to nonfucosylated IgG1 to increase the binding affinity of No-N45-shFc
RIIIa-His (Figure 8B and H). N45-N162-shFc
RIIIa-His carrying two N-linked oligosaccharides at Asn-45 and Asn-162 showed higher binding affinity to nonfucosylated IgG1 than the wild-type shFc
RIIIa-His having three more N-linked oligosaccharides (Figure 8B and G). The Fc
RIIIa mutant lacking all five N-linked oligosaccharides of No-oligo-shFc
RIIIa-His had the weakest binding affinity to nonfucosylated IgG1 among all tested shFc
RIIIa-His (Figure 8D). The interaction of fucosylated IgG1 with Fc
RIIIa was not as strong as that observed between nonfucosylated IgG1 and Fc
RIIIa as a whole. The affinity of N162-shFc
RIIIa-His to fucosylated IgG1 was slightly weaker than that of No-oligo-shFc
RIIIa-His, and N45-N162-shFc
RIIIa-His showed the weakest affinity to fucosylated IgG1.
|
|
| Discussion |
|---|
|
|
|---|
Recently, ADCC enhancement technology has been expected to play key roles in improving the efficacy of current therapeutic antibodies, especially anticancer antibodies. Enhancement of the binding of therapeutic antibodies for Fc
RIIIa has received considerable attention for the development of next-generation therapeutic antibodies with the improved clinical efficacy of ADCC. Indeed, several clinical trials using such therapeutics are ongoing. To understand the physiological functions and to examine in detail the efficacy of these new types of therapies in vivo, it is very important to understand the interactions between the therapeutics and the target molecule for the effector functions. Thus, in this study, we focused on the interaction between Fc
RIIIa and therapeutic antibodies, especially on the effects of the Fc
RIIIa oligosaccharides on the high binding affinity of Fc
RIIIa to IgG1 lacking core fucosylation.
Fc
RIIIa of mammalian origin is well known as a highly glycosylated protein with five N-linked glycosylation sites. However, only a few observations are available on the influences of the Fc
RIIIa oligosaccharides on the functions of Fc
RIIIa, namely, monomeric fucosylated IgG binds to Fc
RIIIa lacking the N-linked oligosaccharide at Asn-162 with higher affinity than to the wild-type Fc
RIIIa (Ferrara et al. 2006
). This finding has also been reported in the loss-of-function analysis of Fc
RIIIb, the highly homologous Fc
R having the oligosaccharide at the same position as Fc
RIIIa, by means of prokaryotic expression, glycosylation site mutation, and tunicamysin-treatment glycosylation depletion in mammalian cell expression (Galon et al. 1997
; Drescher et al. 2003
). In this study, first we found that it is hard to stably express aglycosylated Fc
RIIIa without any degradation by mammalian CHO/DG44 cells as host cells (Figure 2). This degradation seemed to be caused by some intracellular event(s) because the exogenous addition of protease inhibitors, including PMSF, pepstatin A, aprotinin, bestatin, E-64, and leupeptin, into culture medium did not affect the phenomenon. Fc
RIIIa carrying just one N-linked oligosaccharide at Asn-162 (N-162) was also degraded when expressed in mammalian CHO/DG44 cells, as was aglycosylated Fc
RIIIa. The cleavage sites were located in a lysine and arginine cluster region of the Fc
RIIIa D2 domain, and the cathepsin-like proteases appeared to be responsible for the cleavages (Figure 3). Interestingly, this degradation was not observed in the Fc
RIIIa carrying N-162 and one more N-linked oligosaccharide at Asn-45 (N-45), which means that the attachment of N-45 to the Fc
RIIIa D1 domain affects the D2 domain protease sensitivity despite the different domain location. The N-45 attachment in the D1 domain might cause a conformational change of Fc
RIIIa to further stabilize the D2 domain structure.
We succeed in removing the degraded products from the samples by gel filtration chromatography, and the purified samples migrated as a homogeneous band with over 95% purity when subjected to nonreducing SDS–PAGE analysis (Figure 4A). However, the two purified samples of aglycosylated Fc
RIIIa and Fc
RIIIa carrying one N-162 still contained a band with a relatively lower molecular weight than the intact products we had expected (Figure 4B). This unexpected band seemed to be Fc
RIIIa with a nick or a small fragment deletion in the D2 domain because the band, which was also observed before gel filtration purification, had a comparable molecular weight of the intact product under nonreducing condition with the intact Fc
RIIIa amino acid sequence (Figure 3). Interestingly, both the intact and derivative Fc
RIIIa products showed a capability to bind IgG1 (Figure 5). The cleavage of the Fc
RIIIa D2 domain at the lysine and arginine cluster region might not necessarily abolish the binding affinity to IgG antibodies.
In this study, we prepared a set of Fc
RIIIa recombinants produced by CHO/DG44 cells, in which all of the attached oligosaccharides were of the complex type. Firstly, we confirmed that nonfucosylated antibody IgG1 shows significantly higher binding affinity to the fully glycosylated wild-type Fc
RIIIa than does the fucosylated IgG1 and that this increased binding is almost abolished once all of the Fc
RIIIa glycosylation is removed (Ferrara et al. 2006
). Moreover, our gain-of-function analysis in the Fc
RIIIa oligosaccharides also confirmed that N-162 is the element required for the high binding affinity to nonfucosylated antibodies and slightly reduces the affinity to fucosylated IgG1, as previously revealed by loss-of-function analyses (Galon et al. 1997
; Drescher et al. 2003
; Ferrara et al. 2006
). It is worth noting that, beyond our expectation, the glycosylation at Asn-162 in Fc
RIIIa significantly enhanced binding affinity to nonfucosylated IgG1 compared to the wild-type Fc
RIIIa, and attachment of the other four oligosaccharides, especially N-45, hinders the high binding affinity to nonfucosylated IgG1. The crystal structure of aglycosylated Fc
RIIIa, in complex with the Fc fragment of human IgG1, indicates that an oligosaccharide moiety at Asn-162 of Fc
RIIIa could point into the central cavity within the Fc fragment (Sondermann et al. 2000
), where the rigid core oligosaccharides attached to the Fc of IgG at Asn-297 are also located (Huber et al. 1976
). The high affinity of antibodies lacking core fucosylation to Fc
RIIIa is partially mediated by interactions formed between N-162 and regions of the Fc that are accessible only when the Fc oligosaccharide is nonfucosylated (Ferrara et al. 2006
). Our data clearly demonstrated that the glycosylation at Asn-45 in Fc
RIIIa reduces its high binding affinity mediated by N-162 to antibody IgG1 lacking core fucosylation. The conformational change of the D2 domain and the hinge region known to directly contact IgG (Sondermann et al. 2000
) might be caused by N-45 modification of the Fc
RIIIa D1 domain.
| Material and methods |
|---|
|
|
|---|
Cell line
The CHO/DG44 cell line, in which the dihydrofolate reductase (DHFR) gene locus is deleted, was obtained from Drs. Lawrence Chasin and Gail Urlaub Chasin, Columbia University, New York (Urlaub et al. 1980
Antibodies
Mouse/human chimeric nonfucosylated and fucosylated anti-human CD20 IgG1s were generated as described previously (Yamane-Ohnuki et al. 2004
; Iida et al. 2006
). Rituximab (Rituxan®), purchased from Genentech, Inc. (South San Francisco, CA), was used for the controls. Table I shows the oligosaccharide structures of the Fc of each prepared IgG1, characterized by modified high-performance anion exchange chromatography (HPAEC) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) in positive-ion mode. Anti-human CD20s have an amino acid sequence equivalent to that of rituximab, which is widely used for the treatment of non-Hodgkin's lymphoma, and thus they exhibit identical binding activity to the specific antigen on antigen-binding ELISA and flow cytometric analyses, regardless of the Fc oligosaccharide structure (Iida et al. 2006
). Antibodies were stored in a 0.01 M citrate buffer, pH 6.0, with 0.15 M NaCl. The concentration of purified antibodies was measured by absorbance at 280 nm.
|
Wild-type and oligosaccharide-depleted Fc
RIIIa mutantsThe hexa-His-tagged soluble human recombinant Fc
RIIIa (shFc
RIIIa-His) was prepared as described previously (Niwa, Hatanaka, et al. 2004
RIIIa was isolated by reverse transcription-PCR (Superscript Preamplification System, Invitrogen) of oligo(dT)-primed RNA from human leukocyte 5'-stretch plus cDNA library (Clontech, Palo Alto, CA) using specific primers that generated the fragment encoding an extracellular domain, and the transmembrane and intracellular domains were replaced by DNA encoding a hexa-His-tag. Using PCR with specific primers, 5'-CGGAA TTCGCCTCCTCAAAATGAACCTCGGGCTCAGTTTGATT TTCCTTGCCCTCATTTTAAAAGGTGTCCAGTGTGAAGA TCTCCCAAAGGCTG-3' and 5'-TCATCATTGACAGGATCC CG-3', the N-terminal amino acid of the shFc
RIIIa-His was unified to Glu3 (residue numbers excluding the signal peptide) by directly connecting to the signal peptide to avoid the N-terminal amino acid heterogeneity observed in the expression of original Fc
RIIIa cDNA. Thus, the expected protein is composed of the extracellular domain of Fc
RIIIa-Val-158 (a high-affinity Fc
RIIIa allotype) linking hexa-His-tag at its C-terminus Gly-175. To mutate asparagine of the Fc
RIIIa N-glycosylation sites into glutamine, a site-directed PCR mutagenesis kit (Stratagene, La Jolla, CA) was employed. The constructed cDNA fragments were inserted into a mammalian cell expression vector, pKANTEX93 (Nakamura et al. 2000
N-Terminal amino acid sequence analysis
Samples were subjected to 12% SDS–PAGE analysis, followed by electroblotting onto a polyvinylidine difluoride (PVDF) membrane using a semidry blotting system (model AE-6675; Atto). Each band on the PVDF membrane was excised by a cutter and subjected to N-terminal amino acid sequencing via the Edman degradation method using a PPSQ-10 sequencer (Shimazu Co., Kyoto, Japan).
IgG affinity chromatography
Nonfucosylated anti-CD20 IgG1 (0.95 mg) was immobilized onto 0.4 mL of NHS-activated Sepharose 4 Fast Flow (GE Healthcare) according to the manufacturer's instructions. The IgG1-immobilized Sepharose was washed and equilibrated with 4 mL of running buffer, and 133 µg of purified N162-shFc
RIIIa-His (270 µL in running buffer) was loaded onto the column. After incubation at 4°C for 1 h, 400 µL of flowthrough fraction was collected. The adsorbed materials were eluted with a citrate-NaOH buffer, pH 4.0, after washing the column with 4 mL of the equilibration buffer. A sample (2 µg) of each fraction was subjected to SDS–PAGE analysis.
Fc
RIIIa-derived N-linked oligosaccharide analysis
N-Linked oligosaccharides were released by digestion of the purified N162-shFc
RIIIa-His (60 µg) with two units of recombinant peptide-N-glycosidase F (PNGase F; Sigma-Aldrich) for 16 h at 37°C in 0.01 M Tris–acetate buffer, pH 8.3. The released oligosaccharides were recovered after precipitation of the protein with 75% ethanol. After the recovered supernatant was dried, the oligosaccharides were dissolved in 13 mM acetic acid and incubated at room temperature for 2 h. The acid-treated samples were desalted with cation-exchange resin (AG50W-X8, hydrogen form; BioRad Laboratories) and dried in vacuum. The dried samples were dissolved in deionized water and mixed with a matrix to be characterized by a MALDI-TOF MS spectrometer Reflex III (Bruker Daltonik GmbH, Bremen, Germany) equipped with delayed extraction. The released carbohydrates were analyzed both in a positive-ion mode using the super-DHB solution (Bruker Daltonik) as a matrix and in a negative-ion mode using 2',4',6'-trihydroxyacetophenon (THAP) as a matrix as described previously (Papac et al. 1996
; Kanda et al. 2006
).
IgG1-binding assay
The binding affinity of anti-CD20 IgG1 to each purified Fc
RIIIa was measured by an Fc
RIIIa-binding ELISA assay using plates coated with each shFc
RIIIa-His via anti-tetra-His antibodies (Qiagen) as described previously (Niwa, Hatanaka, et al. 2004
). The binding kinetics of IgG1 to each of the purified shFc
RIIIa-His was measured using a T100 biosensor system instrument (BIAcore) as follows. Anti-tetra-His antibodies were immobilized onto the BIAcore sensor chip CM5 using an amine-coupling kit (BIAcore) according to the manufacturer's instructions. Each shFc
RIIIa-His was captured by the immobilized anti-tetra-His antibodies by the injection of shFc
RIIIa-His in a HBS-EP buffer (0.15 M NaCl, 3 mM EDTA, 0.005% Surfactant P20, 0.01 M HEPES, pH 7.4) at a flow rate of 5 µL/min. The HBS-EP buffer lacking shFc
RIIIa-His was injected over the anti-tetra-His immobilized sensor surface; samples treated in this manner were used as a reference. The anti-CD20 IgG1 was diluted in the HBS-EP buffer at six different concentrations (ranging from 4.17 to 133.3 nM). Each diluted IgG1 was injected over the receptor-capture sensor surface at a flow rate of 30 µL/min. The experiments were performed at 25°C with the HBS-EP buffer as the running buffer. To obtain a blank control, the buffer solution lacking IgG1 was injected over the receptor-capture sensor surface. Prior to analysis, the data obtained by the injection of IgG1 were corrected for the reference and blank control. The dissociation constant (KD) for each Fc
RIIIa was calculated by steady-state analysis using the T100 biosensor system evaluation software version 1.0 (BIAcore). To repeat experiments, shFc
RIIIa-His and IgG1 were removed from the sensor tips by injection of 0.01 M Glycine–HCl, pH 1.5, at a flow rate of 60 µL/min for 1 min.
| Conflict of interest statement |
|---|
|
|
|---|
None declared.
| Abbreviations |
|---|
ADCC, antibody-dependent cellular cytotoxicity; CDC, complement-dependent cytotoxicity; CHO, Chinese hamster ovary; DHFR, dihydrofolate reductase; ELISA, enzyme-linked immunosorbent assay; HPAEC, high-performance anion exchange chromatography; IgG1, immunoglobulin G1; MALDI-TOF MS, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry; NK, natural killer; PCR, polymerase chain reaction; PMSF, phenylmethylsulfonyl fluoride; PNGase F, peptide-N-glycosidase F; PVDF, polyvinylidine difluoride; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; THAP, 2',4',6'-trihydroxyacetophenon
| References |
|---|
|
|
|---|
Anolik JH, Campbell D, Felgar RE, Young F, Sanz I, Rosenblatt J, Looney RJ. The relationship of FcgammaRIIIa genotype to degree of B cell depletion by rituximab in the treatment of systemic lupus erythematosus. Arthritis Rheum. (2003) 48:455–459.[CrossRef][Web of Science][Medline]
Cartron G, Dacheux L, Salles G, Solal-Celigny P, Bardos P, Colombat P, Waitier H. Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor Fc
RIIIa gene. Blood. (2002) 99:754–758.
Clark MR. IgG effector mechanisms. Chem Immunol. (1997) 65:88–110.[Web of Science][Medline]
DallOzzo S, Tartas S, Paintaud G, Carton G, Colonbat P, Bardos P, Watier H, Thibaut G. Rituximab-dependent cytotoxicity by natural killer cells: Influence of FCGR3A polymorphism on the concentration-effect relationship. Cancer Res. (2004) 64:4664–4669.
Dresher B, Witte T, Schimidt RE. Glycosylation of Fc
RIII in N163 as mechanism of regulating receptor affinity. Immunol. (2003) 110:335–340.[CrossRef][Medline]
Ferrara C, Stuart F, Sondermann P, Brunker P, Umana P. The carbohydrate at Fc
RIIIa Asn-162: An element required for high affinity binding to non-fucosylated IgG glycoforms. J Biol Chem. (2006) 281:5032–5036.
Galon J, Robertson MW, Galinha A, Mazieres N, Spagnoli R, Fridman WF, Sautes C. Affinity of the interaction between Fc gamma receptor type III (Fc
RIIIa) and monomeric human IgG subclasses. Role of Fc
RIII glycosylation. Eur J Immunol (1997) 27:1928–1932.[Web of Science][Medline]
Gennari R, Menard S, Fagnoni F, Ponchio L, Scelsi M, Tagliabue E, Castiglioni F, Villani L, Magalotti M, Gibelli N, et al. Pilot study of the mechanism of action of preoperative trastuzumab in patients with primary operable breast tumors overexpressing HER2. Clin Cancer Res. (2004) 10:5650–5655.
Harris LJ, Skaletsky E, Mcpherson A. Crystallographic structure of an intact IgG1 monoclonal antibody. J. Mol. Biol. (1998) 275:861–872.[CrossRef][Web of Science][Medline]
Huber R, Deisenhofer J, Colman PM. Crystallographic structure studies of an IgG molecule and an Fc fragment. Nature. (1976) 264:415–420.[CrossRef][Medline]
Iida S, Misaka H, Inoue M, Sibata M, Nakano R, Yamane-Ohnuki N, Wakitani M, Yano K, Shitara K, Satoh M. Non-fucosylated therapeutic IgG1 antibody can evade the inhibitory effect of serum IgG on antibody-dependent cellular cytotoxicity through its high binding to Fc
RIIIa. Clin Cancer Res. (2006) 12(9):2879–2887.
Kanda Y, Yamada T, Mori K, Okazaki A, Inoue M, Kitajima-Miyama K, Kuni-Kamochi R, Nakano R, Yano K, Kakita S, et al. Comparison of biological activity among nonfucosylated therapeutic IgG1 antibodies with three different N-linked Fc oligosaccharides: The high-mannose, hybrid, and complex types. Glycobiology. (2006) 17:104–118.
Kim DH, Jung HD, Kim JG, Lee JJ, Yang DH, Park YH, Do YR, Shin HJ, Kim MK, Hyun MS, et al. FCGR3A gene polymorphisms may correlate with response to frontline R-CHOP therapy for diffuse large B-cell lymphoma. Blood. (2006) 108:2720–2725.
Krapp S, Mimura Y, Jefferis R, Huber R, Sondermann PJ. Structural analysis of human IgG-Fc glycoforms reveals a correlation between glycosylation and structural integrity. Mol Biol. (2003) 325:979–989.
Louis E, El Ghoul Z, Vermeire S, DallOzzo S, Rutgeerts P, Paintaud G, Belaiche J, De Vos M, Van Gossum A, Colombel JF, et al. Association between polymorphism in IgG Fc receptor IIIa coding gene and biological response to infliximab in Crohn's disease. Aliment Pharmacol Ther. (2004) 19:511–519.[CrossRef][Web of Science][Medline]
Matsumiya S, Yamaguchi Y, Saito J, Nagano M, Sasakawa H, Otaki S, Satoh M, Shitara K, Kato K. Structural comparison of fucosylated and nonfucosylated Fc fragments of human immunoglobulin G1. J Mol Biol. (2007) 368(3):767–779.[CrossRef][Web of Science][Medline]
Miescher S, Spycher MO, Amstutz H, De Haas M, Kleijer M, Kalus UJ, Radtke H, Hubsch A, Andresen I, Martin RM, et al. A single recombinant anti-RhD IgG prevents RhD immunization: Association of RhD-positive red blood cell clearance rate with polymorphisms in the Fc
RIIA and Fc
IIIA genes. Blood. (2004) 103:4028–4035.
Morgan A, Jones ND, Nesbitt AM, Chaplin L, Bodmer MW, Emtage JS. The N-terminal end of the CH2 domain of chimeric human IgG1 anti-HLA-DR is necessary for Ci1q, FcRI and FcRIII binding. Immunology. (1995) 86:319–324.[Medline]
Nakanuma K, Tanaka Y, Fujino I, Hirayama N, Shitara K, Hanai N. Dissection and optimization of immune effector function of humanized anti-ganglioside GM2 monoclonal antibody. Mol Immunol. (2000) 37:1035–4106.[CrossRef][Web of Science][Medline]
Niwa R, Hatanaka S, Shoji-Hosaka E, Sakurada M, Kobayashi Y, Uehara A, Yokoi H, Nakamura K, Shitara K. Enhancement of the antibody-dependent cellular cytotoxicity of low-fucose IgG1 is independent of Fc
RIIIa functional polymorphism. Clin Cancer Res. (2004) 10:6248–6255.
Niwa R, Sakurada M, Kobayashi Y, Uehara A, Matsushima K, Ueda R, Nakamura K, Shitara K. Enhanced natural killer cell binding and activation by low-fucose IgG1 antibody results in potent antibody-dependent cellular cytotoxicity induction at lower antigen density. Clin Cancer Res. (2005) 11:2327–2336.
Niwa R, Shoji-Hosaka E, Sakurada M, Uchida K, Nakamura K, Matsushima K, Ueda R, Hanai N, Shitara K. Defucosylated chimeric anti-CC chemokine receptor 4 IgG1 with enhanced antibody-dependent cellular cytotoxicity shows potent therapeutic activity to T-cell leukemia and lymphoma. Cancer Res. (2004) 64:2127–2133.
Okazaki A, Shoji-Hosaka E, Nakamura K, Wakitani M, Uchida K, Kakita S, Tsumato K, Kumagai I, Shitara K. Fucose depletion from human IgG1 oligosaccharide enhances binding enthalpy and association rate between IgG1 and Fc
RIIIa. J Mol Biol. (2004) 336:1239–1249.[CrossRef][Web of Science][Medline]
Papac D, Wong A, Jones AJ. Analysis of acidic oligosaccharides and glycopeptides by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Anal Chem. (1996) 68:3215–3223.[Medline]
Radaev S, Motyka S, Fridman W, Sautes-Fridman C, Sun PD. The structure of a human type III Fc
receptor in complex with Fc. J Biol Chem. (2001) 276:16469–16477.
Ravetch JV, Perussia B. Alternative membrane forms of Fc
RIII (CD16) on human natural killer cells and neutrophils. J Exp Med. (1989) 170:481–497.
Satoh M, Iida S, Shitara K. Non-fucosylated therapeutic antibodies as next-generation therapeutic antibodies. Exp Opin Biol Ther. (2006) 6:1161–1173.
Shields RL, Lai J, Keck R, Oconnell LY, Hong K, Meng YG, Weikert SH, Presta LG. Lack of fucose on human IgG1 N-linked oligosaccharide improves binding to human Fc
RIII and antibody-dependent cellular toxicity. J Biol Chem. (2002) 277:26733–26740.
Shinkawa T, Nakamura K, Yamane N, Shoji-Hosaka E, Kanda Y, Sakurada M, Uchida K, Anazawa H, Satoh M, Yamasaki M, et al. The absence of fucose but not the presence of galactose or bisecting N-acetylglucosamine of human IgG1 complex-type oligosaccharides shows the critical role of enhancing antibody-dependent cellular cytotoxicity. J Biol Chem. (2003) 278:3466–3673.
Sondermann P, Huber R, Oosthyzen V, Lacob U. The 3.2-A crystal structure of the human IgG1 Fc fragment-Fc gammaRIII complex. Nature. (2000) 406:267–273.[CrossRef][Medline]
Suzuki A, Niwa R, Saji S, Muta M, Hirose M, Iida S, Shiotsu Y, Satoh M, Shitara K, Kondo M, et al. A nonfucosylated anti-HER2 antibody augments antibody-dependent cellular cytotoxicity in breast cancer patients. Clin Cancer Res. (2007) 13:1875–1882.
Treon SP, Hansen M, Branagan AR, Verselis S, Emmanouilides C, Kimby E, Frankel SR, Touroutoglou N, Turnbull B, Anderson KC, et al. Polymorphisms in Fc
RIIIA (CD16) receptor expression are associated with clinical response to rituximab in Waldenström's macroglobulinemia. J Clin Oncol. (2005) 23:474–481.
Urlaub G, Chasin LA. Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity. Proc Natl Acad Sci USA (1980) 77:4216–4220.
Weng WK, Levy R. Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab in patients with follicular lymphoma. J Clin Oncol. (2003) 21:3940–3947.
Yamane-Ohnuki N, Kinoshita S, Inoue-Urakubo M, Kusunoki M, Iida S, Nakano R, Wakitani M, Niwa R, Sakurada M, Uchida K, et al. Establishment of FUT8 knockout Chinese hamster ovary cells: An ideal host cell line for producing completely defucosylated antibodies with enhanced antibody-dependent cellular cytotoxicity. Biotechnol Bioeng. (2004) 87:614–622.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. H. Lim, S. A. Beers, R. R. French, P. W.M. Johnson, M. J. Glennie, and M. S. Cragg Anti-CD20 monoclonal antibodies: historical and future perspectives Haematologica, January 1, 2010; 95(1): 135 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hossler, S. F Khattak, and Z. J. Li Optimal and consistent protein glycosylation in mammalian cell culture Glycobiology, September 1, 2009; 19(9): 936 - 949. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









