Glycobiology Advance Access originally published online on October 14, 2008
Glycobiology 2009 19(2):118-125; doi:10.1093/glycob/cwn108
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural and mutational studies on the importance of oligosaccharide binding for the activity of yeast PNGase
2 Department of Biochemistry and Cell Biology, Stony Brook University, Stony Brook, NY 11794-5215, USA
3 RIKEN (The Institute of Physical and Chemical Research), 2-1 Hirosawa, Wako, Saitama 351-0198, Japan
4 21st COE (Center of Excellence) Program, Osaka University Graduate School of Medicine, Japan
5 Rudolf Virchow Center for Experimental Biomedicine and Institute of Structural Biology, University of Würzburg, Versbacher Str. 9, 97078 Würzburg, Germany
1 To whom correspondence should be addressed: Tel: +49-931-201-48320; Fax: +49-931-201-48309; e-mail: hermann.schindelin{at}virchow.uni-wuerzburg.de
Received on May 21, 2008; revised on October 7, 2008; accepted on October 8, 2008
 |
Abstract |
|---|
 Top Abstract IntroductionMaterial and methodsResults and discussionFundingConflict of interest statementReferences |
|---|
Peptide:N-glycanase (PNGase) is an important component of the endoplasmic reticulum-associated protein degradation pathway in which it de-glycosylates misfolded glycoproteins, thus facilitating their proteasomal degradation. PNGase belongs to the transglutaminase superfamily and features a Cys, His, and Asp catalytic triad, which is essential for its enzymatic activity. An elongated substrate-binding groove centered on the active site Cys191 was visualized in the crystal structure of apo-PNGase, whereas its complex with Z-VAD-fmk, a peptide-based inhibitor of PNGase, revealed that the inhibitor occupied one end of the substrate-binding groove while being covalently linked to the active site Cys. Recently, haloacetamidyl-containing carbohydrate-based inhibitors of PNGase were developed and shown to specifically label the active site Cys. In this study, we describe the crystal structure of yeast PNGase in complex with N,N'-diacetylchitobiose (chitobiose). We found that the chitobiose binds on the side opposite to the peptide binding site with the active site Cys191 being located approximately midway between the carbohydrate and peptide binding sites. Mutagenesis studies confirm the critical role of the chitobiose-interacting residues in substrate binding and suggest that efficient oligosaccharide binding is required for PNGase activity. In addition, the N-terminus of a symmetry-related PNGase was found to bind to the proposed peptide-binding site of PNGase. Together with the bound chitobiose, this enables us to propose a model for glycoprotein binding to PNGase. Finally, deleting the C-terminal residues of yeast PNGase, which are disordered in all structures of this enzyme, results in a significant reduction in enzyme activity, indicating that these residues might be involved in binding of the mannose residues of the glycan chain.
Key words: chitobiose / glycoproteins / peptide:N-glycanase
|
Introduction |
|---|
|
TopAbstractIntroductionMaterial and methodsResults and discussionFundingConflict of interest statementReferences |
|---|
Peptide:N-glycanase (PNGase) catalyzes the de-glycosylation of unfolded glycoproteins by hydrolyzing the amide bond between the N-linked oligosaccharide chain and the Asn side chain to which it is linked (Suzuki et al. 2002
). Structurally and functionally distinct from the previously characterized PNGases in plants and prokaryotes (Norris et al. 1994; Altmann et al. 1998; Suzuki et al. 2002; Lee et al. 2005; Zhao et al. 2006), the cytoplasmic PNGase activity was first identified in Saccharomyces cerevisiae (Suzuki et al. 2000) and later found to be highly conserved from yeast to human (Suzuki et al. 2002). It is notable that in addition to the conserved catalytic core domain, PNGase in higher eukaryotes carries additional domains at both the N-terminus and C-terminus, which are involved in protein recognition (Park et al. 2001; Li et al. 2006) and binding to the oligo-mannose moiety of the N-linked glycan (Zhou et al. 2006), respectively.
Recently, PNGase was shown to participate in the endoplasmic reticulum-associated glycoprotein degradation (ERAD) pathway (Kim et al. 2006; Li et al. 2006). ERAD is part of the ER quality control system and is responsible for scavenging misfolded proteins from the secretory pathway. PNGases in both yeast and mammals associate with the proteasome via the RAD23/HR23 proteins, thus coupling de-glycosylation and polypeptide degradation of misfolded substrates (Kim et al. 2006). In higher species, the role of PNGase in ERAD is further enhanced by interacting via its N-terminal domain with the AAA ATPase P97/VCP. P97 has been proposed to extract misfolded ERAD substrates through the retro-translocon (Ye et al. 2001; Rabinovich et al. 2002; Bar-Nun 2005; Li et al. 2006). Through this interaction, PNGase becomes part of a large degradation complex consisting of AMFR (a ubiquitin E3 ligase), P97, Y33K, PNGase, and RAD23 (Li et al. 2006).
Structural studies revealed that the core domain of PNGase consists of a transglutaminase-like domain, a zinc-binding domain, and a RAD23/HR23 binding module (Lee et al. 2005; Zhao et al. 2006). Like other transglutaminase family members, PNGase contains a Cys-His-Asp catalytic triad, which is essential for its activity (Suzuki et al. 2002). As shown in the crystal structures of yeast and mouse PNGase, the transglutaminase-like domain and the smaller zinc-binding domain together form a substrate-binding groove (Lee et al. 2005; Zhao et al. 2006). The groove is divided by the active site cysteine into two parts, one of which has been proposed to bind the peptide moiety of the substrate since it accommodates Z-VAD, a peptide-based PNGase inhibitor (Lee et al. 2005; Zhao et al. 2006). Presumably, the other half of the groove binds at least a portion of the extended oligosaccharide chain. In the apo-structure of yeast PNGase as well as in its complex with the Z-VAD inhibitor, its C-terminal tails (residues 329 to 341) are disordered, and their contribution to enzyme activity has been ignored so far.
Previous studies have identified GlcNAc2-iodoacetoamide and its derivatives as potential inhibitors of PNGase because they specifically react with the active site cysteine (Suzuki et al. 2006). To study the interaction of GlcNAc2 (also referred to as chitobiose) with PNGase in atomic detail and to explain the role of oligosaccharide binding on enzymatic activity, crystals of yeast PNGase were reacted with GlcNAc2-iodoacetoamide and the resulting complex was structurally characterized. In this structure, chitobiose fits snugly into the proposed oligosaccharide binding site and interacts extensively with the surrounding residues. Further mutagenesis studies suggest that efficient chitobiose binding in the immediate vicinity of the active site cysteine is critical for the activity of PNGase, but also point to a potential role of the C-terminal residues in substrate-recognition.
|
Material and methods |
|---|
|
TopAbstractIntroductionMaterial and methodsResults and discussionFundingConflict of interest statementReferences |
|---|
Protein expression and purification
The gene encoding the core domain of yeast PNGase (residues 8–341) was PCR amplified from the full-length gene (Biswas et al. 2004
) using primers ATACCATATGAATAACATAGATTTTGATTCAATA and TACCCTCGAGTCATTTCGAAGCGGCACTGACGCTTTCG and was cloned into the NdeI/XhoI sites of the pET28a vector (Novagen, San Diego, CA). yPNG-mPNG(451–651), yPNG(8–341)-mPNG(451–651), and mPNG(165–450)-yPNG(329–363) fusion protein constructs were prepared by overlapping PCR and cloned into the NdeI/XhoI sites of the pET28a vector. The yRad23-XPCB gene (residues 253–309) was PCR-amplified from full-length Rad23 (Biswas et al. 2004) using primers GTGGACATATGGGTTCAATTGGACTAACTGTAG and TGCATCTCGAGTCACACGGCTTCTAGCAACATGGAC and was cloned into the pTYB12 vector (New England Biolabs, Beverly, MA). The PNGase mutations were introduced with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) using yeast PNGase as template and the resulting constructs were verified by DNA sequencing. All proteins were expressed overnight in BL21DE3 Codon Plus RIL cells at 15°C after induction with 0.3 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at an A600 of 0.6–0.8. PNGase expressing E. coli cells were mixed with equal amounts of Rad23-XPCB expressing cells and both cell types were disrupted in a French press. The lysed cells were clarified by centrifugation at 45,000 x g for 20 min and applied onto chitin beads (New England Biolabs). The bound proteins were extensively washed and cleaved with 100 mM DTT overnight at 4°C. The elution fractions were further purified by MonoQ anion exchange and Superdex 200 size exclusion chromatography (Amersham, Piscataway, NJ). In this purification scheme, only those PNGase mutants capable of tight binding to the XPCB domain of Rad23 are retained after the chitin affinity chromatography step, and the XPCB excess, if present, is removed in the size exclusion chromatography step. The concentration of the purified complexes was determined by the Bradford method.
Crystallization and structure determination
The PNGase/Rad23–XPCB complex was crystallized using the hanging drop vapor diffusion method against a reservoir solution containing 0.1 M Tris–HCl, pH 8.5, and 2.0–2.5 M sodium chloride. The GlcNAc2 derivative was prepared by soaking the crystals in mother liquor containing 1.5 mM GlcNAc2-iodoacetamide (Suzuki et al. 2006) for 20 min followed by transfer of the crystal into mother liquor containing 20% glycerol. Diffraction data were collected on beam line X26C of the National Synchrotron Light Source at Brookhaven National Laboratory at a temperature of 100 K on a Quantum IV ADSC CCD detector. The data were indexed, integrated, and scaled with HKL2000 (Otwinowski and Minor 1997). To maximize the accuracy of the measured reflections derived from crystals diffracting to only limited resolution, a highly redundant dataset (mean redundancy of 8.0) was collected which in turn led to the expected increase in the Rsym. The crystal belongs to space group P3121 with the unit cell dimensions of a = b = 131.5 Å and c = 127.8 Å and was found to be isomorphous to the previously published crystals of the apo-form of yeast PNGase (PDB ID: 1x3W) (Lee et al. 2005). The structure was refined with the programs O (Jones et al. 1991) and Refmac (Murshudov et al. 1997).
PNGase activity and oligosaccharide binding assays
PNGase activity was determined as reported previously (Suzuki et al. 1994) with slight modifications. Briefly, reaction mixtures (10 µL) containing 2 µg purified proteins, 70 mM Hepes-NaOH buffer (pH 7.2), 5 mM DTT, and 1 µL fetuin-derived asialoglycopeptide I ([14C]CH3)2Leu-Asn(GlcNAc5Man3Gal3)-Asp-Ser-Arg) were prepared. The reactions were carried out at 37°C for 1 h and the reaction mixtures were then spotted onto Whatman No. 3MM paper. Peptide:N-glycanase activity was determined by the separation of the de-glycosylated product from the substrate by paper chromatography in a 1-butanol/ethanol/water (4:2:3, v/v/v) mixture for 2 h. Radioactivity was monitored on a PhosphorImager (Molecular Dynamics, Piscataway, NJ), and quantitative analyses were performed with the IMAGEQUANT 1.2 image processing package (Suzuki et al. 1994). The PNGase activity assays using RNase B as a substrate were carried out at room temperature in a buffer containing 20 mM Tris–HCl, pH 8.5, 250 mM NaCl, and 5 mm DTT. RNase B (Sigma, St. Louis, MO) at a concentration of 5 µg/µL was denatured by incubation at 95°C for 15 min prior to the start of the assay. Ten micrograms of RNase B was used in each reaction and the enzyme to substrate molar ratio was 1:200. The reaction was stopped by the addition of the SDS sample buffer and heating at 95°C for 10 min. The reaction mixtures were then resolved on 15% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) gels. The synthesis of Man9GlcNAc2-IAc and its reaction with yeast PNGase were described previously (Suzuki et al. 2006).
|
Results and discussion |
|---|
|
TopAbstractIntroductionMaterial and methodsResults and discussionFundingConflict of interest statementReferences |
|---|
Crystal structure of yeast PNGase in complex with chitobiose
Previously, we identified haloacetamidyl derivatives of GlcNAc2-based oligosaccharides as highly specific and potent inhibitors of PNGase (Suzuki et al. 2006
). Although the affinity of GlcNAc2-iodoacetamide (GlcNAc2-IAc) to PNGase is not as high as that of Man9GlcNAc2-iodoacetamide (Man9GlcNAc2-IAc), it nevertheless binds efficiently to the enzyme. Mass spectrometry unambiguously identified the active site Cys-191 as the site of covalent modification by GlcNAc2-IAc (Suzuki et al. 2006). To gain insights into the detailed inhibitory activity of GlcNAc2-IAc, it was soaked into crystals of yeast PNGase in complex with the XPC binding domain (XPCB) of RAD23. The structure was refined to an R factor of 0.20 and an Rfree value of 0.235 (Figure 1 and Table I). Although the overall structure was refined at only 3.4 Å, the amino acid side chains bound to chitobiose were readily apparent. This is consistent with the fact that the protein structure around the carbohydrate binding site is relatively rigid and resistant to urea up to a concentration of 3.2 M (Suzuki et al. 2006).
|
|
The overall structure of yeast PNGase is not perturbed as a result of chitobiose binding, since the previously published apo-structure (PDB ID: 1x3W) (Lee et al. 2005
) and this complex can be superimposed with a root mean square (rms) deviation of 0.68 Å for 297 C
atoms. However, unambiguous electron density for 11 additional residues at the N-terminus was observed in the chitobiose-modified structure. Those residues are part of the 20-residue long His6-tag derived from the pET28a expression vector. Very interestingly and not previously observed, this N-terminal His6-tag fits into the proposed peptide-binding site of a symmetry-related PNGase molecule (Figure 2). Even though the protein is monomeric in solution (data not shown), the interaction of the two PNGase molecules is extensive and is required for crystallization of the protein. In analogy to the Z-VAD bound structure of yeast PNGase (Figure 2B), we believe that the N-terminal His6-tag mimics the peptide moiety of the glycoprotein substrate in its interaction with PNGase. The heptapeptide Ser-Ser-Gly-Leu-Val-Pro-Arg of the His6-tag (residues 11–17) is in contact with the active site cleft. Of these residues, the Leu and Val seem to engage in significant interactions with PNGase since their side chains are largely buried. Val15 (renamed as residue 1 in the final PDB file) seems especially noteworthy since a valine occupies a similar position in the Z-VAD peptide and the side chain in both cases binds into a partially hydrophilic pocket formed by residues Arg176 and Asn178. If the Z-VAD peptide represents the physiological situation, it apparently mimics the binding of the Asn-X-Ser/Thr sequon to which N-linked oligosaccharides are attached. Consequently, the binding pocket occupied by valine in both peptides would accommodate the similarly sized Ser/Thr residue. Since this binding pocket is formed by Arg176 and Asn178, it can be easily envisioned that a hydrogen bond is formed between the Ser/Thr and PNGase. Accordingly, Gly13 corresponds to the oligosaccharide linked Asn residue, an assumption used in modeling the substrate binding to PNGase (see below).
|
Low sequence specificity of the peptide binding site
Structural analysis showed that the N-terminal peptide interacts with Trp-123, Arg-176, Asn-178, and Asp-217 on one end of the substrate-binding groove. Mutagenesis studies were performed on these residues to investigate their contribution to PNGase activity. It is important to mention that, in order to stabilize PNGase and to preclude the possibility that the point mutations might affect the overall structure, a purification scheme was designed such that all PNGase proteins were copurified with the XPCB domain (see Material and Methods). This assumes that those mutants which result in structural changes extending beyond the site of mutation will have impaired binding to the XPCB domain. In addition, mutants resulting in a significant destabilization of PNGase will reveal themselves during expression and purification by a significantly reduced yield. However, should a mutant only lead to a limited set of conformational changes, one would not be able to detect it with this approach. All PNGase mutants with the exception of the R176E/E193R variant used in this study interact strongly with the XPCB domain, thus indicating that they are properly folded. At the same time, it should be pointed out that the presence of the XPCB domain did not affect enzymatic activity (data not shown).
The mutant that displays the most significant drop in de-glycosylation activity is R176A (Figure 4A). However, since Arg-176 interacts with Glu-193 through an apparently strong salt bridge, the R176A mutation may affect the local conformation of the protein. Therefore, the R176E/E193R double mutant was designed to preserve the salt bridge, but this mutant failed to bind to the XPCB domain, suggesting that it is structurally impaired. Thus, the contribution of Arg-176 to peptide binding cannot be evaluated. On the other hand, the N178A mutant has an activity similar to the wild type, while the W123A and D217A variants each retain about half of the activity (Figure 4A). These results suggest that, despite the similarities in the overall binding of the His-tag-derived peptide and the Z-VAD inhbitor, PNGase is apparently not very specific in recognizing the peptide part of the substrate, which agrees with the fact that PNGase displays a broad specificity for the polypeptide chain linked to the oligosaccharide (Suzuki et al. 2002).
|
The abilities of the aforementioned mutants to interact with N-linked carbohydrate moieties were tested using a Man9GlcNAc2-IAc binding assay. Upon labeling with Man9GlcNAc2-IAc, PNGase increases by about 2 kDa in molecular weight and migrates more slowly on SDS–PAGE (Suzuki et al. 2006
). It has been shown that this phenomenon depends on the proper folding of PNGase (Suzuki et al. 2006). Figure 4B shows that all four mutants efficiently bind to Man9GlcNAc2-IAc, thus suggesting that carbohydrate binding, as expected, is not affected by these mutations.
Interactions between chitobiose and PNGase
It has been known that PNGase interacts tightly with high-mannose-type carbohydrate chains and that chitobiose acts as a competitive inhibitor of the enzyme (Suzuki et al. 1995). In agreement with previous mass spectrometric studies (Suzuki et al. 2006), the crystal structure confirmed that chitobiose specifically labels the active site residue Cys-191 of yeast PNGase (Figure 3). It is thus interesting that the two known PNGase inhibitors, Z-VAD-fmk and GlcNAc2-IAc, covalently attack the active site cysteine from opposite directions by mimicking either the peptide or the oligosaccharide moieties of the substrate. Both N-acetylglucosamine residues of the chitobiose molecule are well defined in the electron density maps (Figure 3A) and reside in the predicted oligosaccharide-binding site of PNGase. As shown in Figure 3B, the chitobiose molecule interacts extensively with PNGase. The GlcNAc closer to Cys-191 (referred to as "proximal GlcNAc") forms hydrogen bonds with the 
-amino group of Lys-253 and the main chain oxygen of Asp-217 via its N-acetyl group, and with the imidazole ring of His-218 using the O5 oxygen atom. In addition to its interaction with the chitobiose moiety of the substrate, His-218 also belongs to the catalytic triad and activates the active site Cys during the catalytic cycle. The distal GlcNAc stacks with Trp-251 and hydrogen bonds with Glu-238. These residues are highly conserved in PNGase from yeast to mammals (data not shown), which presumably reflects their importance in PNGase activity.
|
The initial crystal structure of yeast PNGase (Lee et al. 2005
) revealed three bound sucrose molecules (derived from the cryoprotectant which featured 30% sucrose) bound to the enzyme via a variety of hydrogen bonds and van der Waals interactions. One of the sucrose molecules was in the same general location as the chitobiose. However, none of the ligand–protein hydrogen bonds are conserved between the two protein–ligand complexes. This discrepancy indicates that only the structure presented here provides detailed insights into the mode of carbohydrate recognition by PNGase, which is also corroborated by the site-directed mutagenesis studies described below.
Carbohydrate binding is essential for PNGase activity
The importance of the chitobiose-interacting residues on carbohydrate binding of PNGase was assessed by mutagenesis studies. Since Asp-217 interacts with the chitobiose through its main chain oxygen the D217A mutant, as expected, retained its ability to react with Man9GlcNAc2-IAc (Figure 4B, lane 4). However, the oligosaccharide binding activity was abolished in the H218A, E238A, and K253A mutants and was significantly reduced in the H218F and W251A variants (Figure 4B). These results reveal that His218, Glu238, and Lys253 engage in critical contacts with the chitobiose and since all three residues interact with the proximal GlcNAc, this monosaccharide appears to be preferentially recognized by the enzyme. This conclusion is supported by the fact that there are no hydrogen bonds between the enzyme and the distal GlcNAc which is primarily recognized by Trp251 via van der Waals contacts. However, this interaction does not appear to be critical since the W251A variant still retains residual activity. A comparison between the H218A and H218F variants indicate that the stacking interactions between the imidazole ring and the proximal GlcNAc are still retained in the H218F variant; however, the H218A variant not only loses the stacking interactions but also the hydrogen bond with the O2' atom of the GlcNAc. The results with the W251A variant also indicate that the stacking interaction with the distal GlcNAc is not as critical as the stacking interactions with the proximal GlcNAc which are mediated by His218. Clearly, variations in the chitobiose-interacting amino acid residues showed much more dramatic effects on the enzymatic activity than mutations of PNGase in the peptide binding site (Figure 4A). This suggests that the de-glycosylation activity of PNGase requires very efficient and specific chitobiose-binding.
Even though there is no obvious mannose-binding domain in the yeast enzyme, unlike in PNGase present in higher species (Zhou et al. 2006), yeast PNGase does seem to recognize the oligomannose part of the glycoprotein substrates as indicated by the following facts. Yeast PNGase prefers high-mannose-type substrates over complex-type substrates. Furthermore, yeast PNGase has a higher affinity toward GlcNAc2Man9 than GlcNAc2 (Suzuki et al. 2006), and truncated glycoproteins missing terminal mannose residues (for example, Manβ1-4GlcNAc-GlcNAc) do not act as substrates of PNGase (Hirsch et al. 2003). Based on the position of the nonreducing end of the distal GlcNAc, which is connected to the first mannose in the N-linked oligosaccharide, we speculate that the mannose chain binds into the groove near residues Gln-239 and Gln-243. However, the Q239A and Q243A mutations affected neither the carbohydrate binding nor the catalytic activity of PNGase (Figure 4). How yeast PNGase binds to the mannose molecules of the substrate will thus be the subject of future studies.
Differences in oligomannose recognition between yeast and mouse PNGase
Sequence analysis of yeast and mouse PNGase showed that the core domain of yeast PNGase ends at residue 328. The C-terminal residues (329–363) have no counterparts in the mPNGase sequence and their conformation is unknown since they are either absent (residues 342–363) or disordered (residues 329–341) in all published crystal structures (Lee et al. 2005; Zhao et al. 2006) and the one presented here. We wondered whether these residues contribute to mannose binding and hence affect the de-glycosylation activity. Thus, they would correspond in their function to the C-terminal mannose-binding domain present in higher eukaryotes. Even though yeast PNGase lacks this domain, it has a comparable de-glycosylation activity as mouse PNGase in assays utilizing RNase B as the substrate (Figure 5). On the other hand, the same reaction was significantly slowed down when carried out with the truncated form of the yeast enzyme (composed of residues 8–341), which was used in our crystallographic studies and those described in the literature (Lee et al. 2005). Whereas glycosylated RNaseB has a half-life of less than 10 min in the presence of either full-length enzyme, it still represents the predominant form after 80 min of incubation with C-terminally truncated yeast PNGase indicating a roughly 10-fold reduction in activity. We reason that this decrease in activity may be due to the inability of this construct to efficiently bind to the oligomannose moiety of the substrate, which we predict to be mediated by residues 329–363. In our model of the complex between yeast PNGase and a glycopeptide substrate (Figure 6) residue 328, the last ordered residue is located in relatively close spatial proximity (closest distance of 20 Å) of the mannotetraose. In an attempt to corroborate our hypothesis that the oligomannose is recognized by the C-terminal residues, we generated chimeric PNGases. Fusing the mannose-binding domain of mouse PNGase to either full-length or truncated yeast PNGase did not increase their de-glycosylation activities (data not shown). Likewise, adding residues 328–363 of yeast PNGase to the C-terminus of the mouse PNGase core domain failed to restore its activity (data not shown). Apparently, these simplistic experiments cannot reproduce the different modes with which mouse and yeast PNGase interact with the mannose moiety of the substrates.
|
|
Model of a PNGase–glycopeptide complex
Combining the structural data about the peptide- and carbohydrate-binding properties of yeast PNGase derived in this study, we propose a model of the enzyme in complex with a hypothetical substrate consisting of both the peptide and the carbohydrate moieties including the first four mannose residues (Figure 6). The glycine residue in proximity to the active site Cys was mutated to asparagine, which in glycoproteins is connected to the proximal GlcNac via an N-glycosidic bond. The structure of the branched mannose oligosaccharide was adopted from the complex structure of mouse PNGase with mannopentaose (Zhou et al. 2006
) and arbitrarily linked to the nonreducing end of the distal chitobiose. According to this model, the elongated substrate (with an approximate length of 52 Å) occupies the substrate-binding cleft formed by the transglutaminase domain on one side and the Zn-binding domain on the other, with the N-glycosidic bond located immediately adjacent to the active site Cys-191. The substrate-binding channel is narrow along the bound peptide and the first GlcNAc, but widens considerably immediately after the first carbohydrate residue. Consequently, there are several orientations possible for the remainder of the carbohydrate chain, especially when taking into account the uncertainty about the conformation of the C-terminal residues. The atomic coordinates and structure factors (PDB ID: 3ESW) have been deposited in the Protein Data Bank, Research Collaboratory for Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
|
Funding |
|---|
|
TopAbstractIntroductionMaterial and methodsResults and discussionFundingConflict of interest statementReferences |
|---|
National Institutes of Health (grants GM33814 to W.J.L. and DK54835 to H.S.); Deutsche Forschungsgemeinschaft (FZ-82 to H.S.).
|
Conflict of interest statement |
|---|
|
TopAbstractIntroductionMaterial and methodsResults and discussionFundingConflict of interest statementReferences |
|---|
None declared.
|
Abbreviations |
|---|
ERAD, endoplasmic reticulum associated protein degradation; GlcNAc, N-acetyl- D-glucosamine; PNGase, peptide:N-glycanse; RNase, ribonuclease; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis
|
References |
|---|
|
TopAbstractIntroductionMaterial and methodsResults and discussionFundingConflict of interest statementReferences |
|---|
Altmann F, Paschinger K, Dalik T, Vorauer K. Characterisation of peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A and its N-glycans. Eur J Biochem. (1998) 252:118–123.[Web of Science][Medline]
Bar-Nun S. The role of p97/Cdc48p in endoplasmic reticulum-associated degradation: from the immune system to yeast. Curr Top Microbiol Immunol (2005) 300:95–125.[Web of Science][Medline]
Biswas S, Katiyar S, Li G, Zhou X, Lennarz WJ, Schindelin H. The N-terminus of yeast peptide: N-glycanase interacts with the DNA repair protein Rad23. Biochem Biophys Res Commun. (2004) 323:149–155.[CrossRef][Medline]
Davis IW, Murray LW, Richardson JS, Richardson DC. MOLPROBITY: structure validation and all-atom contact analysis for nucleic acids and their complexes. Nucleic Acids Res. (2004) 32:W615–W619.
Hirsch C, Blom D, Ploegh HL. A role for N-glycanase in the cytosolic turnover of glycoproteins. EMBO J. (2003) 22:1036–1046.[CrossRef][Web of Science][Medline]
Jones TA, Zou JY, Cowan SW, Kjeldgaard M. Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr (1991) A47(Pt 2):110–119.[Web of Science][Medline]
Kim I, Ahn J, Liu C, Tanabe K, Apodaca J, Suzuki T, Rao H. The Png1-Rad23 complex regulates glycoprotein turnover. J Cell Biol. (2006) 172:211–219.
Lee JH, Choi JM, Lee C, Yi KJ, Cho Y. Structure of a peptide: N-glycanase-Rad23 complex: insight into the deglycosylation for denatured glycoproteins. Proc Natl Acad Sci USA (2005) 102:9144–9149.
Li G, Zhao G, Zhou X, Schindelin H, Lennarz WJ. The AAA ATPase p97 links peptide N-glycanase to the endoplasmic reticulum-associated E3 ligase autocrine motility factor receptor. Proc Natl Acad Sci USA. (2006) 103:8348–8353.
Murshudov GN, Vagin AA, Dodson EJ. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D Biol Crystallogr. (1997) 53:240–255.[CrossRef][Medline]
Norris GE, Stillman TJ, Anderson BF, Baker EN. The three-dimensional structure of PNGase F, a glycosylasparaginase from Flavobacterium meningosepticum. Structure. (1994) 2:1049–1059.[Medline]
Otwinowski Z, Minor W. Processing of X-ray Diffraction Data Collected in Oscillation Mode (1997) New York: Academic Press.
Park H, Suzuki T, Lennarz WJ. Identification of proteins that interact with mammalian peptide: N-glycanase and implicate this hydrolase in the proteasome-dependent pathway for protein degradation. Proc Natl Acad Sci USA. (2001) 98:11163–11168.
Rabinovich E, Kerem A, Frohlich KU, Diamant N, Bar-Nun S. AAA-ATPase p97/Cdc48p, a cytosolic chaperone required for endoplasmic reticulum-associated protein degradation. Mol Cell Biol. (2002) 22:626–634.
Suzuki T, Hara I, Nakano M, Zhao G, Lennarz WJ, Schindelin H, Taniguchi N, Totani K, Matsuo I, Ito Y. Site-specific labeling of cytoplasmic peptide: N-glycanase by N,N'-diacetylchitobiose-related compounds. J Biol Chem. (2006) 281:22152–22160.
Suzuki T, Kitajima K, Inoue Y, Inoue S. Carbohydrate-binding property of peptide: N-glycanase from mouse fibroblast L-929 cells as evaluated by inhibition and binding experiments using various oligosaccharides. J Biol Chem. (1995) 270:15181–15186.
Suzuki T, Park H, Hollingsworth NM, Sternglanz R, Lennarz WJ. PNG1, a yeast gene encoding a highly conserved peptide: N-glycanase. J Cell Biol. (2000) 149:1039–1052.
Suzuki T, Park H, Lennarz WJ. Cytoplasmic peptide: N-glycanase (PNGase) in eukaryotic cells: occurrence, primary structure, and potential functions. FASEB J. (2002) 16:635–641.
Suzuki T, Seko A, Kitajima K, Inoue Y, Inoue S. Purification and enzymatic properties of peptide: N-glycanase from C3H mouse-derived L-929 fibroblast cells. Possible widespread occurrence of post-translational remodification of proteins by N-deglycosylation. J Biol Chem. (1994) 269:17611–17618.
Ye Y, Meyer HH, Rapoport TA. The AAA ATPase Cdc48/p97 and its partners transport proteins from the ER into the cytosol. Nature. (2001) 414:652–656.[CrossRef][Medline]
Zhao G, Zhou X, Wang L, Li G, Kisker C, Lennarz WJ, Schindelin H. Structure of the mouse peptide N-glycanase-HR23 complex suggests co-evolution of the endoplasmic reticulum-associated degradation and DNA repair pathways. J Biol Chem. (2006) 281:13751–13761.
Zhou X, Zhao G, Truglio JJ, Wang L, Li G, Lennarz WJ, Schindelin H. Structural and biochemical studies of the C-terminal domain of mouse peptide-N-glycanase identify it as a mannose-binding module. Proc Natl Acad Sci USA. (2006) 103:17214–17219.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Maerz, Y. Funakoshi, Y. Negishi, T. Suzuki, and S. Seiler The Neurospora Peptide:N-Glycanase Ortholog PNG1 Is Essential for Cell Polarity despite Its Lack of Enzymatic Activity J. Biol. Chem., January 22, 2010; 285(4): 2326 - 2332. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||