Skip Navigation


Glycobiology Advance Access originally published online on May 28, 2008
Glycobiology 2008 18(9):686-697; doi:10.1093/glycob/cwn047
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/9/686    most recent
cwn047v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cheng, J.
Right arrow Articles by Chen, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, J.
Right arrow Articles by Chen, X.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Multifunctionality of Campylobacter jejuni sialyltransferase CstII: Characterization of GD3/GT3 oligosaccharide synthase, GD3 oligosaccharide sialidase, and trans-sialidase activities

Jiansong Cheng2, Hai Yu2, Kam Lau2, Shengshu Huang2, Harshal A Chokhawala2, Yanhong Li2, Vinod Kumar Tiwari2 and Xi Chen1,2

2 Department of Chemistry, University of California, One Shields Avenue, Davis, CA 95616, USA


1 To whom correspondence should be addressed: Tel: +1-530-754-6037; Fax: +1-530-752-8995; e-mail: chen{at}chem.ucdavis.edu

Received on February 2, 2008; revised on May 17, 2008; accepted on May 22, 2008


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
CstII from bacterium Campylobacter jejuni strain OH4384 has been previously characterized as a bifunctional sialyltransferase having both {alpha}2,3-sialyltransferase (GM3 oligosaccharide synthase) and {alpha}2,8-sialyltransferase (GD3 oligosaccharide synthase) activities which catalyze the transfer of N-acetylneuraminic acid (Neu5Ac) from cytidine 5'-monophosphate (CMP)-Neu5Ac to C-3' of the galactose in lactose and to C-8 of the Neu5Ac in 3'-sialyllactose, respectively (Gilbert M, Karwaski MF, Bernatchez S, Young NM, Taboada E, Michniewicz J, Cunningham AM, Wakarchuk WW. 2002. The genetic bases for the variation in the lipo-oligosaccharide of the mucosal pathogen, Campylobacter jejuni. Biosynthesis of sialylated ganglioside mimics in the core oligosaccharide. J Biol Chem. 277:327–337). We report here the characterization of a truncated CstII mutant (CstII{Delta}32I53S) cloned from a synthetic gene whose codons are optimized for an Escherichia coli expression system. In addition to the {alpha}2,3- and {alpha}2,8-sialyltransferase activities reported before for the synthesis of GM3- and GD3-type oligosaccharides, respectively, the CstII{Delta}32I53S has {alpha}2,8-sialyltransferase (GT3 oligosaccharide synthase) activity for the synthesis of GT3 oligosaccharide. It also has {alpha}2,8-sialidase (GD3 oligosaccharide sialidase) activity that catalyzes the specific cleavage of the {alpha}2,8-sialyl linkage of GD3-type oligosaccharides and {alpha}2,8-trans-sialidase (GD3 oligosaccharide trans-sialidase) activity that catalyzes the transfer of a sialic acid from a GD3 oligosaccharide to a different GM3 oligosaccharide (3'-sialyllactoside). The donor substrate specificity study of the CstII{Delta}32I53S GD3 oligosaccharide synthase activity indicates that the enzyme is flexible in using different CMP-activated sialic acids and their analogs for the synthesis of GD3 oligosaccharides containing natural and nonnatural modifications at the terminal sialic acid.

Key words: CstII / ganglioside / sialidase / sialyltransferase / trans-sialidase


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
Gangliosides are sialylated glycosphingolipids found in all vertebrate cell types and are the major glycoconjugates in brain (Vyas and Schnaar 2001Go). Ganglioside oligosaccharides (the oligosaccharides in gangliosides), including GM3 [Neu5Ac{alpha}2,3Lac], GD3 [Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3Lac], GM2 [GalNAcβ1,4(Neu5Ac{alpha}2,3)Lac], GM1a [Galβ1,3GalNAcβ1, 4(Neu5Ac{alpha}2,3)Lac], GD1a [Neu5Ac{alpha}2,3Galβ1,3GalNAcβ1, 4(Neu5Ac{alpha}2,3)Lac], and GT1a [Neu5Ac{alpha}2,8Neu5Ac{alpha}2, 3Galβ1,3GalNAcβ1,4(Neu5Ac{alpha}2,3)Lac] oligosaccharides with or without 9-O-acetylation on Neu5Ac(Houliston et al. 2006Go), have been found at the terminus of the lipooligosaccharides (LOS) of various Campylobacter jejuni strains associated with the Guillain–Barré syndrome (Gilbert et al. 2000Go), an autoimmune disorder affecting the peripheral nervous system (Zhu et al. 1998Go). It has been suggested that C. jejuni uses LOS to mimic the gangliosides of host to evade host immune response (Moran et al. 1996Go; Gilbert et al. 2000Go) and some ganglioside oligosaccharides in LOS are possible triggers for developing the Guillain–Barré syndrome (Endtz et al. 2000Go; Nachamkin et al. 2002Go; Yu RK et al. 2006Go).

Sialyltransferases (EC 2.4.99.X) are key enzymes in the biosynthesis of sialosides (sialic acid-containing oligosaccharides) and sialoglycoconjugates (sialic acid-containing glycoconjugates) (Harduin-Lepers et al. 1995). They catalyze the reaction that transfers a sialic acid (N-acetylneuraminic acid or Neu5Ac) residue from its activated sugar nucleotide donor cytidine 5'-monophosphate sialic acid (CMP-sialic acid or CMP-Neu5Ac) to an acceptor, usually a structure terminated with a galactose, an N-acetylgalactosamine (GalNAc), or another sialic acid residue. All sialyltransferases reported to date have been categorized into five glycosyltransferase (GT) families (GT29, GT38, GT42, GT52, and GT80) based on their amino acid sequence similarities (CAZy – Carbohydrate-Active enZyme database, http://www.cazy.org/) (Campbell et al. 1997; Coutinho et al. 2003Go). All known eukaryotic sialyltransferases are grouped in a single CAZY glycosyltransferase family (GT29) and share four highly conserved sialylmotifs "L, S, motif 3, and VS" (Drickamer 1993Go; Livingston and Paulson 1993Go; Geremia et al. 1997Go; Jeanneau et al. 2004Go). In contrast, bacterial sialyltransferases spread into four different GT families. Family GT38 contains bacterial polysialyltransferases from Escherichia coli and Neisseria meningitidis, while families GT42, GT52, and GT80 contain sialyltransferases that sialylate bacterial lipooligosaccharide (LOS). Recently, two short motifs, namely D/E-D/E-G motif and HP motif, have been shown to be conserved throughout the CAZY families GT38, GT52, and GT80 (Freiberger et al. 2007Go). CstII from C. jejuni OH4384, a strain isolated from a patient with the Guillain–Barré syndrome (Aspinall et al. 1994Go), has been identified as a bifunctional sialyltransferase which catalyzes the formation of both {alpha}2,3 and {alpha}2,8-sialyl linkages in the synthesis of GD3 and GT1a ganglioside oligosaccharides (Gilbert et al. 2000Go). It belongs to CAZY glycosyltransferase family GT42. The protein crystal structures of a truncated mutant of CstII from C. jejuni strain OH4384 (CstII{Delta}32I53S), in which the predicted C-terminal membrane association domain of 32 amino acids was removed and an I53S mutation was introduced to enhance {alpha}2,8-sialyltransferase specificity and to stabilize the enzyme (Gilbert et al. 2002Go), have been reported in the presence and absence of CMP or CMP-3F(axial)Neu5Ac (Chiu et al. 2004Go). CstII{Delta}32I53S has been overexpressed in E. coli AD202 and used in the synthesis of GD3 and GT3 oligosaccharides (Blixt et al. 2005Go). It has been shown that this enzyme can use para-nitrophenyl β-D-galactopyranoside, but not D-galactose, as an acceptor to produce {alpha}2,3-linked sialylgalactoside (Lairson et al. 2006Go). It has also been shown that CstII{Delta}32I53S can use para-nitrophenyl {alpha}-D-Neu5Ac as an alternative donor substrate for the synthesis of {alpha}2,3-linked sialyllactoside in the presence of CMP (Lairson et al. 2007Go). In order to obtain large amount of catalytically active CstII{Delta}32I53S for chemoenzymatic synthesis of ganglioside oligosaccharides containing natural and nonnatural sialic acid residues, we cloned a truncated CstII mutant (CstII{Delta}32I53S) from a synthetic cstII gene (C. jejuni strain OH4384) whose codons are optimized for an E. coli expression system. To our surprise, we found that the obtained recombinant CstII{Delta}32I53S has additional activities other than the {alpha}2,3- and {alpha}2,8-sialyltransferase activities described before (Gilbert et al. 2000Go; Blixt et al. 2005Go). We report here the characterization of the multifunctionality of CstII{Delta}32I53S. The donor substrate specificity of the GD3 oligosaccharide synthase activity of the enzyme is also presented.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
Expression and purification
A truncated mutant of CstII having a C-terminal 32-amino-acid deletion and a single mutation I53S was cloned as an N- and a C-His6-tagged proteins in pET15b and pET22b(+) vectors, respectively, using a codon-optimized synthetic gene of cstII from C. jejuni strain OH4384 in a pUC 19 vector as the DNA template for polymerase chain reactions. Both N- and C-His6-tagged proteins were able to be expressed as soluble forms in E. coli cells by induction with 0.1 mM of isopropyl-1-thio-β-D-galactopyranoside (IPTG). Both could be easily purified by Ni2+-affinity chromatography. For both His-tagged forms, about 70 mg of purified proteins could be routinely obtained from the cell lysate of one liter E. coli cell culture. Unlike C-His6-tagged CstII{Delta}32I53S which remained soluble after dialysis, most of N-His6-tagged protein precipitated out during dialysis. Therefore, only the C-His6-tagged CstII{Delta}32I53S was studied in detail. Sodium dodecylsulfate–polyacrylamide gel electrophoresis (SDS–PAGE) indicated that one-step Ni2+- column purification was efficient to provide purified CstII{Delta}32I53S with over 95% purity (data not shown). As shown in Figure 1, the gene sequence of codon-optimized C-His6-tagged CstII{Delta}32I53S contains 32% adenine, 22% cytosine, 19% guanine, and 27% thymine as compared to the original sequence containing 41% adenine, 12% cytosine, 12% guanine, and 35% thymine (GenBank accession no. CS299360 [GenBank] ).


Figure 1
View larger version (54K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 The gene and protein sequences of the codon-optimized C-His6-tagged CstII{Delta}32I53S. The mutated amino acid I53S is in bold and underlined. The additional C-terminal amino acid residues including six histidines introduced in the cloning are in italics and underlined.

 
pH Profiles of the GD3 oligosaccharide synthase, sialidase, and trans-sialidase activities
CstII{Delta}32I53S efficiently catalyzes the transfer of Neu5Ac from CMP-Neu5Ac to Neu5Ac{alpha}2,3LacMU for the formation of Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU (a GD3 oligosaccharide analog with a fluorescent tag at the reducing end) in a broad pH range with an optimal activity at pH 8.0 (Figure 2). Over 90% of the optimal GD3 oligosaccharide synthase activity was observed in the pH range of 6.5–9.0. The enzyme has over 50% optimal activity under mild acid conditions (pH = 5–6) while the activity decreases quickly when the pH goes above 9.5 and no activity can be detected at pH 11.0 in a CAPS buffer. Other than the observed GD3 oligosaccharide synthase activity, CstII{Delta}32I53S also has GD3 oligosaccharide sialidase activity that specifically cleaves the {alpha}2,8-sialyl linkage but does not cleave the {alpha}2,3- or {alpha}2,6-sialyl linkage in 3'-sialyllactoside or 6'-sialyllactoside (data not shown). The GD3 oligosaccharide sialidase activity of CstII{Delta}32I53S is much weaker compared to the GD3 oligosaccharide synthase activity and a larger amount (10-fold) of the enzyme was used in a longer incubation time in GD3 oligosaccharide sialidase activity assays. The efficiency and the pH profiles of the GD3 oligosaccharide sialidase and trans-sialidase activities are very similar. Both activities are active in a pH range of 5.0–7.0 and reach the optimum at pH 6.0 but decrease rapidly when pH goes higher than 7.0 (Figure 2).


Figure 2
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 The pH profiles of the GD3 oligosaccharide synthase (unfilled diamonds), the GD3 oligosaccharide sialidase (filled diamonds), and the GD3 oligosaccharide trans-sialidase (filled circles) activities of CstII{Delta}32I53S obtained by quantitative HPLC analysis. CstII{Delta}32I53S was used in a larger (10-fold) amount (7.6 µg) in the GD3 oligosaccharide sialidase activity assays (30 min incubation) compared to the amount (0.76 µg) of CstII{Delta}32I53S used in the GD3 oligosaccharide synthase activity assays (20 min incubation). For the GD3 oligosaccharide trans-sialidase activity assays, 4.1 µg of CstII{Delta}32I53S was used and the reaction time was 20 min.

 
Effects of metal ions and EDTA on the GD3 oligosaccharide synthase, sialidase, and trans-sialidase activities
The effects of metal ions Mg2+ and Mn2+ as well as the chelating agent EDTA on the GD3 oligosaccharide synthase, GD3 oligosaccharide sialidase, and GD3 oligosaccharide trans-sialidase activities of CstII{Delta}32I53S were determined at pH 8.0, pH 6.0, and pH 6.0, respectively. As shown in Figure 3, a divalent metal ion is not required for the GD3 oligosaccharide synthase, GD3 oligosaccharide sialidase, and GD3 oligosaccharide trans-sialidase activities of the CstII{Delta}32I53S, as 5 mM of EDTA does not affect the enzyme activities significantly. Increasing the concentration of divalent metal ion from 5 mM to 20 mM in the reaction mixture decreases the GD3 oligosaccharide sialidase and GD3 oligosaccharide trans-sialidase activities of CstII{Delta}32I53S but does not affect its GD3 oligosaccharide synthase activity.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 The effects of metal ions (Mg2+ and Mn2+) and EDTA on the GD3 oligosaccharide synthase (0.76 µg of CstII{Delta}32I53S was used, white columns), the GD3 oligosaccharide sialidase (7.6 µg of CstII{Delta}32I53S was used, gray columns), and the GD3 oligosaccharide trans-sialidase (4.1 µg of CstII{Delta}32I53S was used, black columns) activities of CstII{Delta}32I53S. Conditions: (1) 5 mM MgCl2; (2) 10 mM MgCl2; (3) 20 mM MgCl2; (4) 5 mM MnCl2; (5) 10 mM MnCl2; (6) 20 mM MnCl2; (7) no metal; (8) 5 mM EDTA; and (9) control (no enzyme).

 
Kinetics
All kinetics studies were carried out using fluorescentyes-labeled 4-methylumbelliferyl glycosides as acceptor substrates, which allowed the detection of both acceptor and product by a fluorescent detector attached to a HPLC system. Data are shown in Table I.


View this table:
[in this window]
[in a new window]

 
Table I Apparent kinetic parameters for the GD3/GT3 oligosaccharide synthase, GD3 oligosaccharide sialidase, and GD3 oligosaccharide trans-sialidase activities of CstII{Delta}32I53S a

 
For the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S, the Km value of CMP-Neu5Ac (0.63 mM) for codon-optimized C-His6-tagged CstII{Delta}32I53S is similar to that reported for the CstII{Delta}32I53S without codon optimization. The Km value of Neu5Ac{alpha}2,3LacMU for codon-optimized C-His6-tagged CstII{Delta}32I53S is about half of that of Neu5Ac{alpha}2,3Lac for the CstII{Delta}32I53S without codon optimization (Chiu et al. 2004Go). The kcat values of CMP-Neu5Ac (19 min–1) and Neu5Ac{alpha}2,3LacMU (36 min–1) for codon-optimized C-His6-tagged CstII{Delta}32I53S are in the same magnitude as, but are smaller than, those of CMP-Neu5Ac (43 min–1) and Neu5Ac{alpha}2,3Lac (55 min–1) for the CstII{Delta}32I53S without codon optimization. These lead to a 3-fold difference in the kcat/Km values for the CMP-Neu5Ac and similar kcat/Km values for Neu5Ac{alpha}2,3LacMU and Neu5Ac{alpha}2,3Lac. The difference is reasonable as different assay methods and different acceptors were used.

For the GT3 oligosaccharide synthase activity, the Km and the kcat values of Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU are about 6-fold higher and 6-fold lower, respectively, than those of Neu5Ac{alpha}2,3LacMU, indicating a remarkably weaker binding of the CstII{Delta}32I53S to Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU than to Neu5Ac{alpha}2,3LacMU. GT3 oligosaccharide synthase activity is much less efficient (the kcat/Km value of Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU is 0.50 min–1 mM–1) compared to the GD3 oligosaccharide synthase activity (the kcat/Km value of Neu5Ac{alpha}2,3LacMU is 20 min–1 mM–1) of the CstII{Delta}32I53S.

The GD3 oligosaccharide sialidase activity of CstII{Delta}32I53S (the kcat/Km value of Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU is 1.5 min–1 mM–1) is less efficient compared to the GD3 oligosaccharide synthase activity (the kcat/Km value of Neu5Ac{alpha}2, 3LacMU is 20 min–1 mM–1), but is more efficient than the GT3 oligosaccharide synthase activity (the kcat/Km value of Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU is 0.50 min–1 mM–1).

The GD3 oligosaccharide trans-sialidase activity of CstII{Delta}32I53S (the kcat/Km values of Neu5Ac{alpha}2,3LacMU and Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacβProN3 are 4.4 min–1 mM–1 and 6.0 min–1 mM–1, respectively) is about 3- to 4-fold more efficient than the GD3 oligosaccharide sialidase activity (the kcat/Km value of Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU is 1.5 min–1 mM–1), mainly due to lower Km values (8.9 mM and 3.0 mM for Neu5Ac{alpha}2,3LacMU and Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacβProN3, respectively) for the trans-sialidase activity.

The GD3 oligosaccharide synthase activity of CstII{Delta}32I53S has flexible donor substrate specificity
In order to study the donor substrate specificity of the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S, CMP-sialic acids and their derivatives were synthesized in situ using a one-pot two-enzyme system (Yu et al. 2004Go) containing a fluorescent acceptor Neu5Ac{alpha}2,3LacMU for the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S. Excess amounts of a Pasteurella multocida sialic acid aldolase (Li et al. 2008Go) and a Neisseria meningitidis CMP-sialic acid synthetase (NmCSS) (Yu et al. 2004Go) were used to drive the reactions to the maximal yields. All reactions were performed in a Tris–HCl buffer of pH 7.5 to avoid the hydrolysis of the esters in the compounds containing an O-acetyl or an O-lactyl group (Yu et al. 2006Go). Before the addition of CstII{Delta}32I53S, half volume of each reaction mixture was withdrawn for analysis at 254 nm by a Beckman P/ACE MDQ capillary electrophoresis system to determine the yield of the CMP-sialic acid formed. After the addition of a suitable amount of CstII{Delta}32I53S, the GD3 oligosaccharide synthase reactions were carried out at 37°C for 20 min before being stopped by ice-cold acetonitrile solution and assayed using HPLC. In this second step, the amount of the CstII{Delta}32I53S and the reaction time were controlled to allow the comparison of the yields when different donor substrates were used. The presence of the predicted products was confirmed by mass spectrometry. Although not a quantitative assay, this method gave a good estimation of the donor substrate specificity of the enzyme.

As shown in Table II, the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S has flexible donor substrate specificity. It can use all of the CMP-sialic acid analogs generated in situ in the one-pot two-enzyme system from ManNAc/mannose derivatives as donor substrates for the synthesis of GD3 oligosaccharide analogs. CMP-Neu5Ac and CMP-Neu5Gc obtained from ManNAc and ManNGc (entries 1 and 2), respectively, are excellent substrates for CstII{Delta}32I53S. CMP-Neu5Ac analog with an azide group at C-5 of Neu5Ac obtained from ManNAz (entry 3) and CMP-Neu5Gc analog with a methoxyl group at C-5 of Neu5Gc obtained from ManNGcOMe (entry 4) are also very good acceptors of CstII{Delta}32I53S. Introducing a functional group, such as an azido group (entry 5), an O-acetyl group (entry 7), or an O-lactyl group (entry 8), at C-9 of Neu5Ac in CMP-Neu5Ac is well tolerated by CstII{Delta}32I53S, but CMP-Neu5Gc9Ac (entry 14) is a much poorer substrate for CstII{Delta}32I53S. Overall, CMP-2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN) (entry 6) and its analogs with a substitution at C-9 (entries 10 and 12) obtained in situ from mannose and its analogs with a substrate at C-6 are well perceived by CstII{Delta}32I53S, but they are much poorer substrates for the sialic acid aldolase and the CMP-sialic acid synthetase used for the in situ production of CMP-sialic acid derivatives. A similar phenomenon is seen for entry 13, in which a five-carbon monosaccharide D-lyxose is used to generate CMP-4,6-bis-epi-KDO as a donor substrate for CstII{Delta}32I53S. It is interesting to notice that the substitution of C-5 hydroxyl on the KDN of CMP-KDN with an azide group (entry 9) is well tolerated by CstII{Delta}32I53S. In comparison, the addition of an acetyl group at C-5 on the KDN of CMP-KDN (entry 11) is poorly tolerated.


View this table:
[in this window]
[in a new window]

 
Table II Donor substrate specificity for the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S a

 
Confirming multifunctionality of CstII{Delta}32I53S by preparative syntheses
In order to confirm the multiple activities of CstII{Delta}32I53S, preparative-scale syntheses were carried out to produce GM 3MU, GD3MU, GD3ProN3, and GT3MU (Figure 4). The structures of purified products obtained were confirmed by NMR spectroscopy and MALDI-TOF mass spectrometry.


Figure 4
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Confirming CstII{Delta}32I53S GD3/GT3 oligosaccharide synthetase, GD3 oligosaccharide sialidase and trans-sialidase activities by preparative syntheses of GD3MU, GD3ProN3, GT3MU, and GM3MU.

 
To confirm the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S, preparative synthesis of Neu5Ac{alpha}2,8Neu5Ac{alpha}2, 3LacMU (GD3MU) and Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacβProN3 (GD3ProN3) were achieved in excellent yields (91% and 89%, respectively) using a one-pot two-enzyme reaction containing Neu5Ac{alpha}2,3LacMU (GM3MU) or Neu5Ac{alpha}2,3LacβProN3 (GM3ProN3) with Neu5Ac, CTP, NmCSS (Yu et al. 2004Go), and CstII{Delta}32I53S at pH 8.0 in a Tris–HCl buffer (100 mM).

To confirm the GT3 oligosaccharide synthase activity of CstII{Delta}32I53S, preparative synthesis of Neu5Ac{alpha}2,8Neu5Ac{alpha}2, 8Neu5Ac{alpha}2,3LacMU (GT3MU) was achieved in 49% yield from GD3MU and CMP-Neu5Ac in a CstII{Delta}32I53S catalyzed reaction at pH 8.0 in a Tris–HCl buffer (100 mM).

To confirm the GD3 sialidase activity of CstII{Delta}32I53S, preparative synthesis of Neu5Ac{alpha}2,3LacMU (GM3MU) was achieved in 80% yield from Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU (GD3MU) in a CstII{Delta}32I53S catalyzed reaction at pH 6.0 in a MES buffer (100 mM).

To confirm the GD3 trans-sialidase activity of CstII{Delta}32I53S, preparative synthesis of Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU (GD3MU) was achieved in 22% yield from Neu5Ac{alpha}2,3LacMU (GM3MU) and Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU (GD3MU) in a CstII{Delta}32I53S catalyzed reaction at pH 6.0 in a MES buffer (100 mM).

As shown in Table III, the 13C NMR chemical shifts of the purified products are in a close agreement with previously reported data (Gilbert et al. 2000Go; Antoine et al. 2005Go; Tsvetkov and Nikolay 2005Go). More specifically, for GD3MU, sialylation at C-8 of Neu5Ac caused a downfield shift of –6.2 ppm from 71.96 ppm to 78.16 ppm in its C-8 chemical shift. The value of C-8 of the internal Neu5Ac in the compound GD3ProN3 (78.21 ppm) indicates 8-O-sialylation. Similarly, sialylation at C-8 of the second Neu5Ac in GT3MU (the terminal Neu5Ac in GD3MU) is shown by a 5.93 ppm downfield shift of this carbon atom (from 71.96 ppm to 77.89 ppm). Mass spectrometry data obtained in positive mode show the desired molecular ions [M]+ of m/z 1126 for GD3MU, m/z 1052 for GD3ProN3, and m/z 1440 for GT3MU.


View this table:
[in this window]
[in a new window]

 
Table III 13C NMR chemical shifts assignment of GM3, GD3, and GT3 oligosaccharides

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
In addition to the {alpha}2,3- and {alpha}2,8-sialyltransferase activities described before for the synthesis of GM3, GD3, and GT3 oligosaccharides (Gilbert et al. 2000Go; Blixt et al. 2005Go), the recombinant CstII{Delta}32I53S has additional functions including GD3 oligosaccharide sialidase and GD3 oligosaccharide trans-sialidase. The trans-sialidase activities were observed in the absence of CMP; therefore, it is different from the capability of using para-nitrophenyl Neu5Ac as an alternative donor for the {alpha}2,3-sialyltransferse activity reported before for CstII{Delta}32I53S, in which CMP-Neu5Ac intermediate is believed to be formed from CMP and para-nitrophenyl Neu5Ac (Lairson et al. 2006Go). Although the CstII{Delta}32I53S we report here was translated from codon-optimized gene sequence, it has the same primary protein sequence as the CstII{Delta}32I53S reported previously (Chiu et al. 2004Go). The multifunctionality described here should also be applicable to the CstII{Delta}32I53S without codon optimization. The multifunctionality of CstII{Delta}32I53S is similar but not identical to that of PmST1, a multifunctional sialyltransferase from P. multocida having {alpha}2,3-sialyltransferase, {alpha}2,6-sialyltransferase, {alpha}2,3-sialidase, and {alpha}2,3-trans-sialidase activities. (Yu et al. 2005Go). The sialidase activities of both of these enzymes (the GD3 oligosaccharide sialidase activity of CstII{Delta}32I53S and the {alpha}2,3-sialidase activity of {Delta}24PmST1) are weaker than their corresponding sialyltransferase activities (the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S and the {alpha}2,3-sialyltransferase activity of PmST1). The sialyltransferase activities of both enzymes are active in a broad pH range with high activities observed in pH 6.5–9.0 while the high sialidase activities are observed at a pH lower than 7.0. However, the effect of metals for CstII{Delta}32I53S is different from that for {Delta}24PmST1 although both enzymes do not require a divalent metal cation for their sialyltransferase or sialidase activities. High concentration of Mg2+ or Mn2+ does not affect the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S but decreases its GD3 oligosaccharide sialidase activity moderately. In contrast, high concentration of Mg2+ does not affect the {alpha}2,3-sialyltransferase or the sialidase activity of {Delta}24PmST1; the addition of Mn2+ decreases the {alpha}2,3-sialyltransferase activity dramatically but has no effect on the {alpha}2,3-sialidase activity of {Delta}24PmST1 (Yu et al. 2005Go).

The protein X-ray crystal structures of both CstII{Delta}32I53S and {Delta}24PmST1 have been reported. While the structure of CstII{Delta}32I53S has a GT-A-like glycosyltransferase fold having one Rossman domain but no DXD motif for a divalent metal binding, the structure of {Delta}24PmST1 has a GT-B glycosyltransferase fold having two Rossman domains. Since both enzymes have multifunctionality and flexible donor substrate specificity, it seems that these properties are not restricted to GT-A or GT-B glycosyltransferase fold.

CstII{Delta}32I53S belongs to CAZy glycosyltransferase family 42 (GT-42) and {Delta}24PmST1 belongs to CAZy glycosyltransferase family 80 (GT-80). In both CAZy glycosyltransferase families, there are other members of which a single function has been identified. For example, CstI is a monofunctional {alpha}2,3-sialyltransferase that belongs to GT-42 (Chiu et al. 2007Go), Pd2,6ST, a monofunctional {alpha}2,6-sialyltransferase from Photobacterium damsela (Sun et al. 2008Go), and Hd2,3ST, a monofunctional {alpha}2,3-sialyltransferase from Haemophillus ducreyi (Li et al. 2007Go), both belong to GT-80. Since CAZy families are classified based on the amino acid sequence similarity, this means that proteins share similar primary sequences may be diverse on multifunctionalities.

CstII{Delta}32I53S is an important enzyme that has been used in the enzymatic synthesis of complex ganglioside oligosaccharides which are difficult to be obtained by chemical synthesis (Blixt et al. 2005Go; Lairson et al. 2006Go, 2007Go). The multifunctionality of CstII{Delta}32I53S, especially the GD3 oligosaccharide sialidase activity, presented here indicates that precautions need to be taken for CstII{Delta}32I53S-catalyzed synthesis of GD3 and GT3 oligosaccharides. It is important to control the pH of the reaction solution and the reaction time in order to achieve optimal yields for CstII{Delta}32I53S-catalyzed oligosaccharide synthesis. The information presented here about the pH profile of different activities of CstII{Delta}32I53S, therefore, will greatly facilitate the efficient synthesis of ganglioside oligosaccharides using CstII{Delta}32I53S.

Sialic acids are a family of {alpha}-keto acids with a nine-carbon backbone. N-Acetylneuraminic acid (Neu5Ac) and N-glycolylneuraminic acid (Neu5Gc) are two of the most abundant forms of sialic acid. O-Acetylation and the less frequent O-methylation, O-lactylation, O-sulfation, and O-phosphorylation on Neu5Ac, Neu5Gc, and deaminoneuraminc acid (KDN) result in more than 50 structurally distinct forms of sialic acids that have been found in nature (Schauer 2000Go; Angata and Varki 2002Go). The reported applications of CstII{Delta}32I53S in the enzymatic synthesis of ganglioside oligosaccharides have been limited to those forms containing the most abundant Neu5Ac form (Blixt et al. 2005Go; Lairson et al. 2006Go, 2007Go). The flexible substrate specificity presented here indicates that CstII{Delta}32I53S can be more broadly used in synthesizing complex ganglioside oligosaccharides containing natural and nonnatural sialic acid forms. These compounds are important standards for analytical studies and are essential probes for understanding the important biological functions of gangliosides and their interaction with sialic acid-binding proteins. It also demonstrates that the previously reported one-pot three-enzyme chemoenzymatic system containing a sialic acid aldolase, a CMP-sialic acid synthetase, and a sialyltransferase will also be applicable for the highly efficient synthesis of ganglioside oligosaccharides containing modified sialic acids.

One example of important gangliosides containing naturally occurring sialic acid modifications is 9-O-acetyl GD3 (Neu5Ac9OAc{alpha}2,8Neu5Ac{alpha}2,3LacβOR), a naturally occurring GD3 ganglioside in which an acetyl group is attached to the hydroxyl on C-9 of the terminal Neu5Ac residue via an ester linage. The concentration of 9-O-acetyl GD3 is relatively high in the embryonic nervous system and is absent in most of other neural tissues (Schlosshauer et al. 1988Go). It has been suggested that the biological functions of 9-O-acetyl GD3 are distinct from GD3. The 9-O-acetyl GD3 has been found as a marker of neural differentiation and malignant transformation (Chen et al. 2006Go) and has been suggested to protect tumor cells from apoptosis (Kniep et al. 2006Go). Recently, a sialate O-acetyltransferase has been cloned from C. jejuni and confirmed to specifically catalyze the addition of an O-acetyl group from acetyl-CoA to the hydroxyl group on the C-9 of the terminal {alpha}2,8-linked sialoside in structures containing terminal GD3 oligosaccharides (Houliston et al. 2006Go). The data obtained from the donor substrate specificity studies here indicate that the 9-O-acetyl GD3 oligosaccharides can be efficiently synthesized using the one-pot three-enzyme system containing a sialic acid aldolase, CMP-sialic acid synthetase, and CstII{Delta}32I53S.

Campylobacter LOSs containing terminal ganglioside oligosaccharides are believed to be important virulence factors of the bacteria (Moran et al. 2000Go; Moran and Prendergast 2001Go) and are possible triggers for autoimmunity leading to Guillain–Barré and Miller–Fisher syndromes (Yuki et al. 1993Go; Jacobs et al. 1995Go). It will be important to study whether the multifunctionality of CstII is also observed in vivo and whether it is a mechanism for the bacteria to control the LOS structures when grow under different conditions.

In conclusion, we have demonstrated here that the recombinant CstII{Delta}32I53S has multifunctionality including a high GD3 oligosaccharide synthase activity over a broad pH range with flexible donor substrate specificity. Therefore, CstII{Delta}32I53S is an important tool for the synthesis of diverse ganglioside oligosaccharides containing natural or nonnatural sialic acids.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
Materials
E. coli electrocompetent DH5{alpha} and chemically competent BL21 (DE3) cells were from Invitrogen (Carlsbad, CA). Vector plasmids pET15b and pET22b(+) were purchased from Novagen (EMD Biosciences Inc., Madison, WI). Histrap FFTM, QIAprep spin miniprep kit, and QIAquick gel extraction kit were from Qiagen (Valencia, CA). Herculase-enhanced DNA polymerase was from Stratagene (La Jolla, CA). T4 DNA ligase, 1 kb DNA ladder, and BamHI restriction enzyme were from Promega (Madison, WI). NdeI and XhoI restriction enzymes were from New England Biolabs Inc. (Beverly, MA). Precision Plus Protein Standards and BioGel P-2 fine resin were from Bio-Rad (Hercules, CA). N-Acetyl-D-mannosamine (ManNAc), mannose, lyxose, CTP, and pyruvate were purchased from Sigma (St. Louis, MO). CMP-Neu5Ac was synthesized enzymatically from ManNAc, pyruvate, and CTP by a one-pot two-enzyme system using a recombinant E. coli K12 sialic acid aldolase and a recombinant N. meningitidis CMP-sialic acid synthetase as reported previously (Yu et al. 2004Go).

Cloning of cstII{Delta}32I53S
The full-length codon-optimized (optimized for the E. coli expression system) synthetic gene of cstIII53S was customer synthesized by Codon Devices (Cambridge, MA) and provided in a pUC19 vector. The truncated cstII{Delta}32I53S without the codons for the C-terminal 32 amino acids was cloned as an N- or a C-His6-tagged fusion protein. The primers used for the N-His6-tagged protein in the pET15b vector were forward primer 5'-GGATCCATATGAAAAAGGTGATTATC (NdeI restriction site is underlined) and reverse primer 5'-CGCGGATCCTTAGTTGATATTCTTACTAAATTTA (BamHI restriction site is underlined). To clone the C-His-tagged protein in the pET22b(+) vector, the same forward primer was used, and the reverse primer was 5'-CCGCTCGAG GTTGATATTCTTACTAAATTTA (XhoI restriction site is underlined). PCRs for amplifying the target gene were performed in a 50 µL reaction mixture containing plasmid DNA (100 ng), forward and reverse primers (1 µM each), 10 x Herculase buffer (5 µL), dNTP mixture (1 mM), and 5 U (1 µL) of Herculase-enhanced DNA polymerase. The reaction mixture was subjected to 30 cycles of amplification at an annealing temperature of 52°C. The resulted PCR product was purified and double digested with NdeI and BamHI or NdeI and XhoI restriction enzymes. The purified and digested PCR product was ligated with the predigested pET15b or pET22b(+) vector and transformed into electrocompetent E. coli DH5{alpha} cells. Selected clones were grown for minipreps and characterization by restriction mapping. DNA sequencing was performed by the Davis Sequencing Facility in the University of California-Davis.

Expression
Positive plasmid was selected and transformed into BL21 (DE3) chemically competent cells. The plasmid-bearing E. coli strain was cultured in a LB-rich medium (10 g L–1 tryptone, 5 g L–1 yeast extract, and 10 g L–1 NaCl) supplemented with ampicillin (100 µg mL–1). Overexpression of the target protein was achieved by inducing the E. coli culture with 0.1 mM of IPTG when the OD600 nm of the culture reached 0.8 followed by incubating at 20°C for 24 h with vigorous shaking at 250 rpm in a C25KC incubator shaker (New Brunswick Scientific, Edison, NJ).

Purification
His6-tagged target proteins were purified from cell lysate. To obtain the cell lysate, cell pellet harvested by centrifugation at 4000 rpm for 2 h was resuspended in a lysis buffer (pH 8.0, 100 mM Tris–HCl containing 0.1% Triton X-100) (20 mL L–1 cell culture). Lysozyme (50 µg mL–1) and DNaseI (3 µg mL–1) were then added and the mixture was incubated at 37°C for 60 min with vigorous shaking. Cell lysate was obtained by centrifugation at 12,000 rpm for 30 min as the supernatant. Purification of His-tagged proteins from the lysate was achieved using an ÄKTA FPLC system (GE Healthcare) equipped with a HisTrapTM FF 5 mL column. The column was pre-equilibrated with 10 column volumes of binding buffer (5 mM imidazole, 0.5 M NaCl, 50 mM Tris–HCl, pH 7.5) before the lysate was loaded. Followed by washing with 8 column volumes of binding buffer and 10 column volumes of washing buffer (40 mM imidazole, 0.5 M NaCl, 50 mM Tris–HCl, pH 7.5), the protein was eluted with an elute buffer containing 200 mM imidazole in a Tris–HCl buffer (50 mM, pH 7.5, 0.5 M NaCl). The fractions containing the purified enzymes were collected and stored at 4°C.

Sodium dodecylsulfate–polyacrylamide gel electrophoresis (SDS–PAGE)
SDS–PAGE was performed in a 12% Tris–glycine gel using a Bio-Rad Mini-protein III cell gel electrophoresis unit (Bio-Rad) at DC = 150 V. Bio-Rad Precision Plus Protein Standards (10–250 kDa) were used as molecular weight standards. Gels were stained with Coomassie Blue.

Quantification of purified protein
The concentration of purified enzymes was obtained using a Bicinchoninic acid (BCA) Protein Assay Kit (Pierce Biotechnology, Rockford, IL) with bovine serum albumin as a protein standard.

pH Profile by HPLC
Assays were performed in a total volume of 20 µL in a buffer (200 mM) with pH varying from 5.0 to 11.0 containing a suitable amount of CstII{Delta}32I53S (0.76, 7.6, and 4.1 µg were used for assay the GD3 oligosaccharide synthase, sialidase, and trans-sialidase activities, respectively) and 1 mM of corresponding substrates (CMP-Neu5Ac and Neu5Ac{alpha}2,3LacMU for GD3 oligosaccharide synthase activity assays; Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU for GD3 oligosaccharide sialidase activity assays; and Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacβProN3 and Neu5Ac{alpha}2,3LacMU for GD3 oligosaccharide trans-sialidase activity assays). The buffers used were MES, pH 5.0–6.5; MOPS, pH 7.0; Tris–HCl, pH 7.5–9.0; CAPSO, pH9.5; and CAPS, pH 10.0–11.0. Reactions were carried out at 37°C for 20 min (for the GD3 oligosaccharide synthase and trans-sialidase activity assays) or 30 min (for the GD3 oligosaccharide sialidase activity assay) before being quenched by adding ice-cold 8% acetonitrile (780 µL) to make 40-fold dilutions. The samples were then kept on ice until aliquots of 10 µL were injected and analyzed by a Shimadzu LC-2010A system equipped with a membrane on-line degasser, a temperature control unit, and a fluorescence detector. A reverse-phase Premier C18 column (250 x 4.6 mm i.d., 5 µm particle size, Shimadzu) protected with a C18 guard column cartridge was used. The mobile phase was 6% acetonitrile. The fluorescent compounds LacMU, Neu5Ac{alpha}2,3LacMU (GM3MU), and Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU (GD3MU) were detected by excitation at 325 nm and emission at 372 nm (Kajihara et al. 2004Go). All assays were carried out in duplicate.

Effects of metal ions and EDTA
EDTA (5 mM) and different concentrations (5, 10, and 20 mM) of MgCl2 or MnCl2 were used to study their effects on the GD3 oligosaccharide synthase (Tris–HCl buffer, pH 8.0, 100 mM was used), sialidase (MES buffer, pH 6.0, 100 mM was used), and trans-sialidase (MES buffer, pH 6.0, 100 mM was used) activities of CstII{Delta}32I53S. Reaction without EDTA or metal ions was used as a control. The amounts of the enzyme, the concentrations of the substrates, and other reaction conditions (37°C, 20 min) were the same as described above for the pH profile assays.

Kinetics for {alpha}2,8-sialyltransferase (GD3 and GT3 oligosaccharide synthetase) activities
The enzymatic assays were carried out in a total volume of 20 µL in a Tris–HCl buffer (100 mM, pH 8.0) containing CMP-Neu5Ac, sialyl LacMU acceptor substrate (GM3MU and GD3MU were used as acceptor substrates for GD3 and GT3 oligosaccharide synthase activities, respectively), and CstII{Delta}32I53S (0.77 µg and 9.3 µg for GD3 and GT3 oligosaccharide synthase activities, respectively). Reactions were allowed to proceed for 20 min at 37°C. Apparent kinetic parameters were obtained by varying the CMP-Neu5Ac concentration from 0.125 to 4.0 mM (0.125, 0.167, 0.2, 0.25, 0.33, 0.4, 0.5, 1, 2, and 4 mM) and a fixed concentration of GM3MU or GD3MU (1 mM); or a fixed concentration of CMP-Neu5Ac (1 mM) and varied concentrations of GM3MU or GD3MU (0.125, 0.167, 0.2, 0.25, 0.33, 0.4, 0.5, 1, 2, and 4 mM). For all kinetics assays, apparent kinetic parameters were obtained by fitting the data (the average values of duplicate assay results) into the Michaelis–Menten equation using Grafit 5.0.

Kinetics for GD3 oligosaccharide sialidase activity
These assays were performed in a total volume of 15 µL in MES buffer (100 mM, pH 6.0) containing GD3MU and the recombinant enzyme (7.7 µg, 10-fold more than the amount used in the sialyltransferase activity assays). Reactions were allowed to proceed for 20 min at 37°C. Kinetic data were obtained by varying the concentrations of GD3MU (0.5, 1, 2, 4, 8, 16, 24, and 32 mM).

Kinetics for GD3 oligosaccharide trans-sialidase activity
These assays were performed in a total volume of 20 µL in MES buffer (100 mM, pH 6.0) containing Neu5Ac{alpha}2, 8Neu5Ac{alpha}2,3LacβProN3 (GD3ProN3), GM3MU and the recombinant enzyme (4.1 µg). Reactions were carried out at 37°C for 20 min before being stopped by ice-cold acetonitrile solution and assayed using HPLC. Apparent kinetic parameters were obtained by varying the concentrations of GD3ProN3 (0.5, 1, 2, 4, 8, and 16 mM) and a fixed concentration of GM3MU (5 mM) or a fixed concentration of GM3MU (5 mM) and varied concentrations of GD3ProN3 (0.5, 1, 2, 4, 8, and 16 mM).

Donor substrate specificity assays for the GD3 oligosaccharide synthase activity
CMP-Sialic acid derivatives were generated in situ in a one-pot two-enzyme system in 40 µL of Tris–HCl buffer (200 mM, pH 7.0) containing GM3MU (1 mM), CTP (1.5 mM), pyruvate (5 mM), a sialic acid precursor (1 mM), MgCl2 (20 mM), P. multocida sialic acid aldolase (41 µg) (Li et al. 2008Go), and N. meningitidis CMP-sialic acid synthetase (10 µg). The reactions were carried out at 37°C for 1 h. An aliquot of 20 µL of the reaction mixture was taken to determine the yields of CMP-Sia derivatives at 254 nm using a Beckman P/ACE MDQ capillary electrophoresis system equipped with a fused-silica capillary (60 cm x 75 µm i.d.). The ratio of absorbance for CMP-Neu5Ac and CTP at 254 nm was determined at different concentrations (0.5, 1, and 2 mM). To compare the substrate specificity of the GD3 oligosaccharide synthase activity, CstII{Delta}32I53S (0.7 µg) was added and the reactions were allowed to continue for 20 min at 37°C before being quenched by adding 780 µL of ice-cold 6% acetonitrile. The samples were kept on ice until aliquots of 10 µL were injected and analyzed by the Shimadzu LC-2010A system as described above for the pH profile and kinetics assays. All assays were carried out in duplicate.

Synthesis of substrates
Precursors for sialic acid analogs including ManNAc and mannose derivatives, Neu5Ac{alpha}2,3LacMU (GM3MU), and other {alpha}2,3- and {alpha}2,6-linked sialosides were chemically or enzymatically synthesized as reported previously (Yu et al. 2004Go, 2005Go; Yu H et al. 2006Go).

Preparative synthesis of GD3MU, GD3ProN3, and GT3MU to confirm the GD3 and GT3 oligosaccharide synthetase activities
GD3MU and GD3ProN3 were synthesized at 37°C using a one-pot two-enzyme system in 15 mL of Tris–HCl buffer (100 mM, pH 8.0) containing Neu5Ac{alpha}2,3LacMU or Neu5Ac{alpha}2,3 LacβProN3 (50 mg) as an acceptor, Neu5Ac (1.2 equiv.) as the donor precursor, CTP (1.5 equiv.), MgCl2 (20 mM), N. meningitidis CMP-sialic acid synthetase (0.2 mg), and CstII{Delta}32I53S (2.4 mg) (Yu et al. 2004Go). Neu5Ac{alpha}2,8Neu5Ac{alpha}2,8Neu5Ac{alpha}2,3LacMU (GT3MU) was synthesized at 37°C in 5 mL of Tris–HCl buffer (100 mM, pH 8.0) containing GD3MU (30 mg, 0.027 mmol), CMP-Neu5Ac (35 mg, 0.053 mmol), and CstII{Delta}32I53S (2.4 mg). The reactions were incubated at 37°C for 2 h when TLC analysis (EtOAc:MeOH:H2O:HOAc = 5:3:2:0.2) indicated the completion of the reaction. Reactions were stopped by adding same volume of ice-cold ethanol and the reaction mixtures were centrifuged to remove insoluble precipitates. Supernatant was concentrated and purified by Bio-Gel P2 size exclusion chromatography and silica gel chromatography to give desired purified sialosides. 1H NMR, 1H–1H COSY, and 1H–13C HSQC experiments were carried out at 26°C in D2O on a Bruker DRX-600 spectrometer and 13C NMR experiment was carried out using a Bruker DRX-600 and a Varian mercury plus 300 spectrometers.

Preparative synthesis of GM3MU to confirm the GD3 oligosaccharide sialidase activity
The reaction was carried out at 37°C in 6.7 mL of MES buffer (100 mM, pH = 6.0) containing GD3MU (38 mg, 0.034 mmol) and CstII{Delta}32I53S (3.8 mg). The reaction was incubated at 37°C for 3 h when TLC analysis (EtOAc:MeOH:H2O:HOAc = 5:3:1.5:0.2) indicated the completion of the reaction. The yield (94%) of GM3MU was determined by a Shimadzu LC-2010A system equipped with a membrane on-line degasser, a temperature control unit, and a fluorescence detector. The reaction was quenched by adding an equal volume of ice-cold ethanol and the mixture was kept on ice for 30 min. The protein and insoluble precipitates were removed by centrifugation and the supernatant was concentrated and purified by BioGel P-2 size exclusion chromatography and lyophilized to give GM3MU as a white powder (22 mg, 80% yield). The 1H NMR spectrum of the product in D2O was identical to the GM3MU synthesized before (Yu et al. 2005Go) and mass spectrometry analysis showed the presence of [M+1]+·of m/z 814 for GM3MU.

Preparative synthesis of GD3MU to confirm the GD3 oligosaccharide trans-sialidase activity
The reaction was carried out at 37°C in 7.3 mL of MES buffer (100 mM, pH = 6.0) containing GM3MU (30 mg, 0.037 mmol), GD3ProN3 (43 mg, 0.041 mmol), and CstII{Delta}32I53S (4.1 mg). The reaction was incubated at 37°C for 2 h when HPLC (a Shimadzu LC-2010A system equipped with a membrane on-line degasser, a temperature control unit, and a fluorescence detector) analysis indicated that the yield (34%) of GD3MU did not increase over time. The reaction was quenched by adding an equal volume of ice-cold ethanol and the mixture was kept on ice for 30 min. The protein and insoluble precipitates were removed by centrifugation and the supernatant was concentrated and purified by BioGel P-2 size exclusion chromatography and silica gel chromatography to give desired purified GD3MU (9 mg, 22% yield). The 1H NMR spectrum of the product in D2O was identical to that of the GD3MU synthesized earlier by the GD3 oligosaccharide synthase activity of CstII{Delta}32I53S and mass spectrometry analysis showed the presence of molecular ion [M]+ of m/z 1126 for GD3MU.


    Funding
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
National Institutes of Health (R01GM076360); Arnold and Mabel Beckman Foundation (Beckman Young Investigator Award to X.C.).


    Conflict of interest statement
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
None declared.


    Abbreviations
 
CAPS, 3-(cyclohexylamino)-1-propanesulfonic acid; CAPSO, 3-(cyclohexylamino)-2-hydroxy-1-propanesulfonic acid; CMP, cytosine 5'-monophosphate; CTP, cytosine 5'-triphosphate; EDTA, ethylenediaminetetraacetic acid; HPLC, high performance liquid chromatography; IPTG, isopropyl-1-thio-β-D-galactopyranoside; KDN, 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid; KDO, 3-deoxy-D-manno-octulosonic acid; ManNAc, N-acetylmannosamine; ManNGc, N-glycolylmannosamine; MES, 2-(N-morpholino)ethanesulfonic acid; MOPS, 3-(N-morpholino)propanesulfonic acid; Neu5Ac, N-acetylneuraminic acid; Neu5Gc, N-glycolylneuraminic acid; Tris–HCl, tris(hydroxymethyl)aminomethane-hydrogen chloride


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Funding
 Conflict of interest statement
 References
 
Angata T, Varki A. Chemical diversity in the sialic acids and related alpha-keto acids: An evolutionary perspective. Chem Rev (2002) 102:439–469.[CrossRef][Web of Science][Medline]

Antoine T, Heyraud A, Bosso C, Samain E. Highly efficient biosynthesis of the oligosaccharide moiety of the GD3 ganglioside by using metabolically engineered Escherichia coli. Angew Chem Int Ed Engl (2005) 44:1350–1352.[CrossRef]

Aspinall GO, McDonald AG, Pang H, Kurjanczyk LA, Penner JL. Lipopolysaccharides of Campylobacter jejuni serotype O:19: Structures of core oligosaccharide regions from the serostrain and two bacterial isolates from patients with the Guillain–Barre syndrome. Biochemistry (1994) 33:241–249.[CrossRef][Web of Science][Medline]

Blixt O, Vasiliu D, Allin K, Jacobsen N, Warnock D, Razi N, Paulson JC, Bernatchez S, Gilbert M, Wakarchuk W. Chemoenzymatic synthesis of 2-azidoethyl-ganglio-oligosaccharides GD3, GT3, GM2, GD2, GT2, GM1, and GD1a. Carbohydr Res (2005) 340:1963–1972.[CrossRef][Web of Science][Medline]

Campbell JA, Davies GJ, Bulone V, Henrissat B. A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J (1997) 326((Pt 3)):929–939.[Web of Science][Medline]

Chen HY, Challa AK, Varki A. 9-O-Acetylation of exogenously added ganglioside GD3. The GD3 molecule induces its own O-acetylation machinery. J Biol Chem (2006) 281:7825–7833.[Abstract/Free Full Text]

Chiu CP, Lairson LL, Gilbert M, Wakarchuk WW, Withers SG, Strynadka NC. Structural analysis of the alpha-2,3-sialyltransferase Cst-I from Campylobacter jejuni in apo and substrate-analogue bound forms. Biochemistry (2007) 46:7196–7204.[CrossRef][Web of Science][Medline]

Chiu CP, Watts AG, Lairson LL, Gilbert M, Lim D, Wakarchuk WW, Withers SG, Strynadka NC. Structural analysis of the sialyltransferase CstII from Campylobacter jejuni in complex with a substrate analog. Nat Struct Mol Biol (2004) 11:163–170.[CrossRef][Web of Science][Medline]

Coutinho PM, Deleury E, Davies GJ, Henrissat B. An evolving hierarchical family classification for glycosyltransferases. J Mol Biol (2003) 328:307–317.[CrossRef][Web of Science][Medline]

Drickamer K. A conserved disulphide bond in sialyltransferases. Glycobiology (1993) 3:2–3.[Free Full Text]

Endtz HP, Ang CW, Van Den Braak N, Duim B, Rigter A, Price LJ, Woodward DL, Rodgers FG, Johnson WM, Wagenaar JA, et al. Molecular characterization of Campylobacter jejuni from patients with Guillain–Barre and Miller Fisher syndromes. J Clin Microbiol (2000) 38:2297–2301.[Abstract/Free Full Text]

Freiberger F, Claus H, Gunzel A, Oltmann-Norden I, Vionnet J, Muhlenhoff M, Vogel U, Vann WF, Gerardy-Schahn R, Stummeyer K. Biochemical characterization of a Neisseria meningitidis polysialyltransferase reveals novel functional motifs in bacterial sialyltransferases. Mol Microbiol (2007) 65:1258–1275.[CrossRef][Web of Science][Medline]

Geremia RA, Harduin-Lepers A, Delannoy P. Identification of two novel conserved amino acid residues in eukaryotic sialyltransferases: Implications for their mechanism of action. Glycobiology (1997) 7:v-vii.

Gilbert M, Brisson JR, Karwaski MF, Michniewicz J, Cunningham AM, Wu Y, Young NM, Wakarchuk WW. Biosynthesis of ganglioside mimics in Campylobacter jejuni OH4384. Identification of the glycosyltransferase genes, enzymatic synthesis of model compounds, and characterization of nanomole amounts by 600-mHz (1)H and (13)C NMR analysis. J Biol Chem (2000) 275:3896–3906.[Abstract/Free Full Text]

Gilbert M, Karwaski MF, Bernatchez S, Young NM, Taboada E, Michniewicz J, Cunningham AM, Wakarchuk WW. The genetic bases for the variation in the lipo-oligosaccharide of the mucosal pathogen, Campylobacter jejuni. Biosynthesis of sialylated ganglioside mimics in the core oligosaccharide. J Biol Chem (2002) 277:327–337.[Abstract/Free Full Text]

Harduin-Lepers A, Recchi MA, Delannoy P. 1994, the year of sialytransferases. Glycobiology (1995) 5:741–758.[Free Full Text]

Houliston RS, Endtz HP, Yuki N, Li J, Jarrell HC, Koga M, van Belkum A, Karwaski MF, Wakarchuk WW, Gilbert M. Identification of a sialate O-acetyltransferase from Campylobacter jejuni: Demonstration of direct transfer to the C-9 position of terminalalpha-2,8-linked sialic acid. J Biol Chem (2006) 281:11480–11486.[Abstract/Free Full Text]

Jacobs BC, Endtz H, Van Der Meche FG, Hazenberg MP, Achtereekte HA, van Doorn PA. Serum anti-GQ1b IgG antibodies recognize surface epitopes on Campylobacter jejuni from patients with Miller Fisher syndrome. Ann Neurol (1995) 37:260–264.[CrossRef][Web of Science][Medline]

Jeanneau C, Chazalet V, Auge C, Soumpasis DM, Harduin-Lepers A, Delannoy P, Imberty A, Breton C. Structure-function analysis of the human sialyltransferase ST3Gal I: Role of N-glycosylation and a novel conserved sialylmotif. J Biol Chem (2004) 279:13461–13468.[Abstract/Free Full Text]

Kajihara Y, Kamiyama D, Yamamoto N, Sakakibara T, Izumi M, Hashimoto H. Synthesis of 2-[(2-pyridyl)amino]ethyl beta-D-lactosaminide and evaluation of its acceptor ability for sialyltransferase: A comparison with 4-methylumbelliferyl and dansyl beta-D-lactosaminide. Carbohydr Res (2004) 339:1545–1550.[CrossRef][Web of Science][Medline]

Kniep B, Kniep E, Ozkucur N, Barz S, Bachmann M, Malisan F, Testi R, Rieber EP. 9-O-Acetyl GD3 protects tumor cells from apoptosis. Int J Cancer (2006) 119:67–73.[CrossRef][Web of Science][Medline]

Lairson LL, Wakarchuk WW, Withers SG. Alternative donor substrates for inverting and retaining glycosyltransferases. Chem Commun (2007) 4:365–367.

Lairson LL, Watts AG, Wakarchuk WW, Withers SG. Using substrate engineering to harness enzymatic promiscuity and expand biological catalysis. Nat Chem Biol (2006) 2:724–728.[CrossRef][Web of Science][Medline]

Li Y, Sun M, Huang S, Yu H, Chokhawala HA, Thon V, Chen X. The Hd0053 gene of Haemophilus ducreyi encodes an alpha2,3-sialyltransferase. Biochem Biophys Res Commun (2007) 361:555–560.[CrossRef][Web of Science][Medline]

Li Y, Yu H, Cao H, Lau K, Muthana S, Tiwari VK, Son B, Chen X. Pasteurella multocida sialic acid aldolase: A promising biocatalyst. Appl Microbiol Biotechnol. Forthcoming 2008 in press.

Livingston BD, Paulson JC. Polymerase chain reaction cloning of a developmentally regulated member of the sialyltransferase gene family. J Biol Chem (1993) 268:11504–11507.[Abstract/Free Full Text]

Moran AP, Prendergast MM. Molecular mimicry in Campylobacter jejuni and Helicobacter pylori lipopolysaccharides: Contribution of gastrointestinal infections to autoimmunity. J Autoimmun (2001) 16:241–256.[CrossRef][Web of Science][Medline]

Moran AP, Prendergast MM, Appelmelk BJ. Molecular mimicry of host structures by bacterial lipopolysaccharides and its contribution to disease. FEMS Immunol Med Microbiol (1996) 16:105–115.[CrossRef][Web of Science][Medline]

Moran AP, Penner JL, Aspinall GO. Campylobacter lipopolysaccharides. In: Campylobacter—Nachamkin I, Blaser MJ, eds. (2000) Washington, DC: American Society for Microbiology. 241–256, 241–257.

Nachamkin I, Liu J, Li M, Ung H, Moran AP, Prendergast MM, Sheikh K. Campylobacter jejuni from patients with Guillain–Barre syndrome preferentially expresses a GD(1a)-like epitope. Infect Immun (2002) 70:5299–5303.[Abstract/Free Full Text]

Schauer R. Achievements and challenges of sialic acid research. Glycoconj J (2000) 17:485–499.[CrossRef][Web of Science][Medline]

Schlosshauer B, Blum AS, Mendez-Otero R, Barnstable CJ, Constantine-Paton M. Developmental regulation of ganglioside antigens recognized by the JONES antibody. J Neurosci (1988) 8:580–592.[Abstract]

Sun M, Li Y, Chokhawala HA, Henning R, Chen X. N-Terminal 112 amino acid residues are not required for the sialyltransferase activity of Photobacterium damsela alpha2,6-sialyltransferase. Biotechnol Lett (2008) 30:1573–6776.

Tsvetkov YEN, Nikolay E. Enhanced sialylating activity of O-chloroacetylated 2-thioethyl sialosides. Synlett (2005) 1375–1380.

Vyas AA, Schnaar RL. Brain gangliosides: Functional ligands for myelin stability and the control of nerve regeneration. Biochimie (2001) 83:677–682.[CrossRef][Web of Science][Medline]

Yu H, Chokhawala H, Karpel R, Yu H, Wu B, Zhang J, Zhang Y, Jia Q, Chen X. A multifunctional Pasteurella multocida sialyltransferase: A powerful tool for the synthesis of sialoside libraries. J Am Chem Soc (2005) 127:17618–17619.[CrossRef][Web of Science][Medline]

Yu H, Huang S, Chokhawala H, Sun M, Zheng H, Chen X. Highly efficient chemoenzymatic synthesis of naturally occurring and non-natural alpha-2,6-linked sialosides: A P. damsela alpha-2,6-sialyltransferase with extremely flexible donor-substrate specificity. Angew Chem Int Ed Engl (2006) 45:3938–3944.[CrossRef]

Yu H, Yu H, Karpel R, Chen X. Chemoenzymatic synthesis of CMP-sialic acid derivatives by a one-pot two-enzyme system: Comparison of substrate flexibility of three microbial CMP-sialic acid synthetases. Bioorg Med Chem (2004) 12:6427–6435.[CrossRef][Medline]

Yu RK, Usuki S, Ariga T. Ganglioside molecular mimicry and its pathological roles in Guillain–Barre syndrome and related diseases. Infect Immun (2006) 74:6517–6527.[Free Full Text]

Yuki N, Taki T, Inagaki F, Kasama T, Takahashi M, Saito K, Handa S, Miyatake T. A bacterium lipopolysaccharide that elicits Guillain–Barre syndrome has a GM1 ganglioside-like structure. J Exp Med (1993) 178:1771–1775.[Abstract/Free Full Text]

Zhu J, Mix E, Link H. Cytokine production and the pathogenesis of experimental autoimmune neuritis and Guillain–Barre syndrome. J Neuroimmunol (1998) 84:40–52.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/9/686    most recent
cwn047v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cheng, J.
Right arrow Articles by Chen, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, J.
Right arrow Articles by Chen, X.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?