Glycobiology Advance Access originally published online on October 27, 2007
Glycobiology 2008 18(1):104-113; doi:10.1093/glycob/cwm120
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression of the Human Sda β-1,4-N-Acetylgalactosaminyltransferase II Gene is Dependent on the Promoter Methylation Status
2 Institute of Biological Chemistry, Academia Sinica, Taipei 115, Taiwan
3 Institute of Biochemical Sciences, National Taiwan University, Taipei 106, Taiwan
1 To whom correspondence should be addressed: Tel: +886-2-3366-4070; Fax: +886-2-2363-5038; e-mail: yulc{at}ntu.edu.tw
Received on August 22, 2007; revised on October 16, 2007; accepted on October 20, 2007
| Abstract |
|---|
|
|
|---|
It has been noted that the expression of Sda, including its antigenic structure, the β-1,4-N-acetylgalactosyltransferase II (β4GalNAcT-II) activity responsible for its formation, and the Sda β4GalNAcT-II mRNA transcript, is drastically reduced in oncogenetic processes in gastrointestinal tissues. Markedly reduced metastatic potential has been demonstrated in colon and gastric cancer cells transfected with the Sda β4GalNAcT-II gene. In this study, a putative CpG island encompassing the promoter and exon 1 regions in the human Sda β4GalNAcT-II gene was identified, and the investigation of DNA methylation of the Sda gene promoter region demonstrated a clear association between the methylation status of the CpG island promoter and expression of the Sda gene in gastrointestinal cancer cell lines. Hypomethylation of the promoter region of the Sda gene was shown in cells where this gene was expressed. By contrast, there was significant hypermethylation of the Sda gene promoter in cells that did not express the gene. A specific methylation profile in the Sda gene CpG island was demonstrated in KATO III gastric cancer cells. In colon cancer cells with the hypermethylated Sda gene promoter, treatment with the DNA methylation inhibitor, 5-aza-2'-deoxycytidine, resulted in demethylation of the promoter region and substantially induced the expression of the Sda gene and the Sda antigenic structure. These results strongly suggest that promoter DNA methylation plays a crucial role in the regulation of the Sda β4GalNAcT-II gene and Sda antigen expression.
Key words: DNA methylation / gastrointestinal cancers / gene expression / N-acetylgalactosaminyltransferase / Sda antigen
| Introduction |
|---|
|
|
|---|
The Sda antigen was first reported as a human blood group antigen by Macvie et al. and Renton et al. simultaneously in 1967 (Macvie et al. 1967
2-3)Galβ, carried on glycoproteins and glycolipids (Blanchard et al. 1983
2-3Galβ terminal structure in the β-1,4 linkage. This enzyme activity was first manifested in the guinea pig kidney (Serafini-Cessi and DallOlio 1983
Following the first isolation of the Sda β4GalNAcT-II cDNA from murine cytotoxic T lymphocytes (Smith and Lowe 1994
), a partial sequence of human Sda β4GalNAcT-II cDNA was cloned from the total RNA fraction of gastric mucosa (Dohi et al. 1996
). The full coding sequence of human Sda β4GalNAcT-II cDNA was demonstrated by Montiel et al. in 2003 (Montiel et al. 2003
). The human Sda gene is located on chromosome 17 and comprises at least 12 exon regions that span about 37 kb of genomic DNA. Notably, two transcript forms, which have different exon 1 (denoted as exon 1S and exon 1L), but identical exons 2–11, coding regions, are expressed from the human Sda gene locus through utilization of alternative promoters. The two transcripts, with respective open reading frames of 1521 and 1701 bp, encode the short- and long-form Sda β4GalNAcT-IIs with 506 and 566 amino acid residues, respectively. The two forms of Sda β4GalNAcT-II differ with respect to the lengths of their cytoplasmic tails, with the long-form unusually extended at 66 amino acid residues. An independent paper by Lo Presti et al. also reported the cDNA sequence for the long-form Sda β4GalNAcT-II (Lo Presti et al. 2003
).
It has been noted that the expressions of Sda are developmentally regulated and increase as a function of age (Macvie et al. 1967
; Renton et al. 1967
; DallOlio et al. 1987
, 1990
). Increased Sda antigen expression and Sda β4GalNAcT-II transferase activity has been observed during differentiation of human colon and gastric cancer cell lines (Malagolini et al. 1991
; Dohi et al. 1993
). Especially, altered expression patterns of Sda antigen during oncogenetic processes have been noted. It was demonstrated that the Sda antigen and Sda β4GalNAcT-II activity were markedly diminished (Malagolini et al. 1989
; Dohi et al. 1991
), and the expression of the Sda gene transcript significantly decreased in colon and gastric cancer tissues (Dohi et al. 1996
). Although association between the downregulation of Sda expression and malignant changes in the gastrointestinal tract mucosa has been noted, the biological implications of this phenomenon were not manifested until the study by Kawamura et al. (2005)
. It has been known that the expression of the E-selectin ligands, sialyl Lewisa (sLea) and sialyl Lewisx (sLex), in gastrointestinal cancer cells is associated with malignant metastasis. Kawamura et al. demonstrated that Sda β4GalNAcT-II competes for the acceptor substrates with the
-1,3- and
-1,4-fucosyltransferases responsible for the formation of sLea and sLex carbohydrate structures, and that overexpression of Sda β4GalNAcT-II eliminates the expression of sLea and sLex in colon and gastric cancer cells and, consequently, inhibits the metastasis of these cells. Their study suggests a potential for the development of antimetastatic gene therapy for gastrointestinal cancers. The relationship between the expression of Sda and sLex antigens in normal and cancerous colon tissues has been further elaborated in a recent study (Malagolini et al. 2007
).
Although tissue- and cell-type specificities with respect to the distribution of Sda antigen and its altered expression patterns during oncodevelopmental processes have long been noted, the control mechanism for the Sda gene expression has never been elucidated. It is well known that the methylation of cytosine residue in the CpG dinucleotide-rich sequence provides one of the regulatory mechanisms for gene expression. The present study has demonstrated that the expression of the human Sda β4GalNAcT-II gene is determined by the DNA methylation status of the CpG island in the promoter region.
| Results |
|---|
|
|
|---|
CpG island in the promoter and exon 1 regions of the Sda β4GalNAcT-II gene
The short- and long-form human Sda β4GalNAcT-II transcripts are composed of different exon 1, exon 1S, and exon 1L. Exon 1S and exon 1L contain 38 and 253 bp, respectively, and are separated by a 160-bp sequence (Figure 1) (Montiel et al. 2003
|
|
Correlation of the methylation status of the CpG promoter with the Sda β4GalNAcT-II gene expression
Expression of the Sda gene in different human gastrointestinal cancer cell lines was analyzed using reverse transcription-polymerase chain reaction (RT-PCR). The expression profiles were analyzed for the Sda transcript (with the common region of the short- and long-form Sda transcripts PCR amplified), together with the short- (denoted as Sda-S) and long-form Sda (Sda-L) transcripts in seven colon cancer cell lines, two gastric cancer cell lines, and one pancreatic cancer cell line (Figure 3). Expression of the Sda transcript was demonstrated in Caco-2, Colo 205, SW1417, SW480, SW948, and MKN45 cells. Similar expression profiles for the short- and long-form Sda transcripts were revealed in these cell lines, except that only the short-form Sda transcript was detected in MKN45 cells. In contrast, the RT-PCR analysis did not detect any Sda transcript in the RNA samples prepared from HCT 116, SW48, KATO III, and MIA Paca-2 cells. Nevertheless, a trace of expression of the short-form Sda, but not the long-form analog, was observed in the KATO III cells with more PCR cycles (data not shown).
|
The methylation status of the Sda gene CpG island in these cells was analyzed through bisulfite genomic sequencing as described in the Materials and methods section. The region of nucleotide –550 through –1, which contains 47 CpG dinucleotides (48 in KATO III and MKN45 cells; see Figure 1 legend), was analyzed; 5–8 clones were sequenced per cell line. In the analyzed clones, almost all the cytosine residues not within the CpG dinucleotide were converted to thymidines, with only few exceptions (0–3 per clone), demonstrating that the bisulfite conversions were virtually complete. The percentage of methylated CpG in the analyzed region obtained from each clone is schematically represented in Figure 4A. The methylation status of the Sda CpG island in each cell line reveals a sharp contrast between cells with and without Sda gene expression. The CpG sites are barely methylated in Caco-2, Colo 205, SW1417, SW480, SW948, and MKN45 cells, which express the Sda gene. Only few sites (0–3 per clone) in the 47 (or 48) CpG dinucleotides were found to be methylated in these cells. The lowest methylation status was observed in SW948 cells as only one methylated CpG was located in the five analyzed clones. In contrast, hypermethylation of the Sda gene CpG island was observed in HCT 116, SW48, and MIA PaCa-2 cells, which do not express the Sda gene. In these three cell lines, almost all the CpG sites were methylated, with only 0–3 sites per clone unmethylated. MIA PaCa-2 cells showed the highest methylation percentage, with 100% methylation demonstrated for six of the eight analyzed clones. A different feature was observed in KATO III cells. The methylation percentages for the six clones from the KATO III cells were around 60%.
|
Methylation-specific PCR was established to evaluate the methylation status of the Sda CpG promoter. In this analysis system, the primer pair designed to demonstrate the methylated status (lanes M, Figure 4B) yielded PCR products only from the bisulfite-treated genomic DNA samples prepared from HCT 116, SW48, KATO III, and MIA PaCa-2 cells, in which the Sda gene promoters were significantly methylated. When the primer pair designed to demonstrate the unmethylated status was used (lanes U, Figure 4B), only the samples prepared from the cells with the hypomethylated Sda promoter gave PCR products. However, bisulfite-treated genomic DNA from KATO III cells yielded, in addition to the obvious positive result from the methylated primer pair, a trace of PCR product from the unmethylated primer pair. This outcome may be caused by the semi-methylated status of the Sda promoter in KATO III cells. The results demonstrated from methylation-specific PCR were consistent with those obtained from bisulfite genomic sequencing, suggesting that this methylation-specific PCR is feasible for rapid analysis of the methylation status of the Sda gene CpG promoter.
The expression profiles for the Sda gene, revealed by RT-PCR, and the methylation status of the Sda gene CpG island, demonstrated by bisulfite genomic sequencing and methylation-specific PCR, display a definite inverse relationship between the methylation level in the Sda gene promoter region and gene expression level in these gastrointestinal cancer cell lines.
Methylation pattern of the Sda β4GalNAcT-II gene CpG island in KATO III cells
It has been shown in a number of genes that the methylation statuses of the individual CpG sites in the respective CpG islands are heterogeneous, and that the overall methylation profile in the CpG islands exhibits a specific pattern (Graff et al. 1997
; Kominato et al. 1999
; Pao et al. 2001
). In the bisulfite genomic sequencing analysis described above, the methylation statuses of the individual CpG sites in the Sda promoter region were found to be heterogeneous in KATO III cells. Therefore, the methylation pattern in the KATO III cells was analyzed in detail extending from nucleotides –550 to +380, which nearly encompasses the whole putative CpG island of the Sda gene. Eighty-five CpG dinucleotides are included in the analyzed region. Fifteen clones, which were prepared from five separate batches of PCR products, were sequenced, and the results compiled to calculate the methylation percentage for each of the 85 CpG sites. The methylation percentages of individual CpG sites in the Sda CpG island in KATO III cells (as schematically represented in Figure 5) are highly heterogeneous. Many CpG sites were intensively methylated, including 16 sites showing methylated in all of the 15 analyzed clones, whereas several sites exhibited very low methylation frequencies.
|
Further, a specific methylation pattern in the CpG island was observed in KATO III cells. As shown in Figure 5, the methylation density in the region around nucleotides –350 through –200 (the 5' region proximal to exon 1S) is evidently lower than those in the other regions. The 15 CpG dinucleotides in the 5' 150-bp region proximal to exon 1L have an average methylation of 87%, while the 14 CpG sites in the 5' 150-bp region proximal to exon 1S have an average methylation of 49%. This lower methylation density in the region 5' to exon 1S may explain the trace expression of the short-form Sda transcript in KATO III cells.
Effect of the DNA methylation inhibitor on the expression of Sda β4GalNAcT-II gene and Sda antigen
The results described above demonstrate a good correlation between methylation in the promoter region of the Sda β4GalNAcT-II gene and restraint of Sda β4GalNAcT-II gene expression in gastrointestinal cancer cell lines. To discover whether methylation of the promoter region is itself inhibiting the expression of the Sda gene, the effects of the DNA methylation inhibitor on the expression of the Sda gene and Sda antigen in the cells with the hypermethylated Sda promoter were examined. To achieve this, 5-aza-2'-deoxycytidine (5-aza-CdR), which is a well-known reagent that specifically inhibits DNA methylation (Momparler 2005
), was employed to treat HCT 116 and SW48 cells. The results obtained from RT-PCR analysis showed that the transcription of the Sda gene was significantly induced by treatment of 5-aza-CdR in these cells (Figure 6A). Demethylation of the Sda promoter regions in HCT 116 and SW48 cells, after treatment with 5-aza-CdR, was demonstrated through bisulfite genomic sequencing; however, this demethylation was only partial. Methylation-specific PCR yielded positive results using the primer pair adopted for the unmethylated status (lanes U, Figure 6B), showing that the reagent treatment at least partially demethylated the promoter regions of the Sda genes. However, the failure of the primer pair for the methylated status to yield a positive result from the 5-aza-CdR-treated HCT 116 sample was unexpected.
|
The effect of 5-aza-CdR treatment in terms of the expression of Sda antigen on SW48 cells was investigated. As shown from flow cytometry analysis and fluorescence microscopy examination (Figure 7), there appeared to be no Sda epitope on the surfaces of the untreated SW48 cells; however, there was substantial elicitation of Sda antigen expression on SW48 cells with the 5-aza-CdR treatment. Fluorescence microscopy revealed that about 20% of the cells became positively bound by monoclonal antibody for the Sda antigen (mAB KM694) after treatment with a DNA methylation inhibitor.
|
These results demonstrate marked induction of Sda β4GalNAcT-II gene, and Sda antigen expression can be achieved in cells with the hypermethylated Sda gene promoter through inhibition of DNA methylation, indicating a direct relationship between the methylation status in the Sda promoter and Sda gene expression.
| Discussion |
|---|
|
|
|---|
Tissue- and cell-type specificities have been demonstrated in the expression of the Sda β4GalNAcT-II gene, and the alteration of the Sda β4GalNAcT-II gene transcription during the oncogenetic processes of gastrointestinal cancers has been noted. It is of interest, therefore, to improve understanding of the regulatory mechanism for Sda gene expression, and of significance to elucidate the mechanism leading to the cancer-associated downregulation of the Sda gene transcription. In the present study, hypermethylation in the CpG island of the Sda gene promoter region was demonstrated in the gastrointestinal cancer cell lines without Sda gene expression, while the promoter region was hypomethylated in the Sda gene-expressing cells. The results were consistent for all 10 cell lines assessed in this study. Furthermore, the suppression of the Sda gene transcription could be effectively relieved by the treatment of the DNA methylation inhibitor. These results demonstrate that the DNA methylation status of the CpG island in the promoter region determines the expression of the human Sda β4GalNAcT-II gene.
The connection between DNA methylation of the CpG-rich promoter and the transcriptional inactivation of the respective genes has been established (Scarano et al. 2005
; Klose and Bird 2006
). A recent systematic survey of tissue-specific differentially methylated regions of genes has demonstrated a correlation between the gene expression and the methylation status of the respective differentially methylated regions (Song et al. 2005
), and the result is highly suggestive of a regulatory role for DNA methylation in gene expression. Mechanisms for methylation-induced gene suppression have been proposed, and binding of the methyl binding proteins to the methylated promoter regions appears to play a central role (Scarano et al. 2005
; Klose and Bird 2006
). Despite the proposed DNA methylation-triggered gene-silencing mechanisms, some studies have suggested that tissue- or cell-specific methylation may be the result of gene silencing rather than the controlling mechanism, and that the gene silencing occurs prior to DNA methylation, which takes place subsequently to stabilize the silencing (Song et al. 2002
; Turker 2002
). However, this proposed gene silencing prior to promoter methylation might not apply to the human Sda gene, as the suppression of this gene was effectively relieved, and re-expression of the Sda gene (Figure 6A), together with the Sda antigen (Figure 7), was efficiently elicited by singular treatment with a DNA methylation inhibitor in the cells with the hypermethylated Sda promoter. This demonstrates the crucial role of promoter-region DNA methylation in the downregulation of the Sda gene and Sda antigen expression.
Methylation of individual CpG sites in the Sda gene CpG island exhibits high heterogeneity in KATO III cells. Methylation heterogeneity has been described in the CpG islands of several genes (Kominato et al. 1999
; Pao et al. 2001
); however, the underlying mechanism leading to this phenomenon remains intangible. Except for the methylation heterogeneity, methylation in the Sda CpG island represents a specific pattern in KATO III cells. Relative to methylation frequencies in the other regions, methylation frequency in the 5' region proximal to exon 1S is lower. Differential methylation preference in specific regions of a CpG island has been demonstrated in a number of genes (Graff et al. 1997
; Kominato et al. 1999
; Pao et al. 2001
), and the mechanism for the establishment of a specific methylation pattern in a CpG island has been an attractive subject. It has been demonstrated that a cis-acting sequence in the mouse adenine phosphoribosyltransferase (aprt) gene is responsible for the initiation of the conserved methylation pattern. The region was designated the methylation center for the aprt CpG island (Mummaneni et al. 1995
). The methylation center sequence is derived from retrotransposons, which contribute to the human Alu repeats and homologous mouse B1 elements (Yates et al. 1999
). Furthermore, it has been shown that the Sp1 element at the 5' edge of the aprt CpG island is required for protecting the CpG island from de novo methylation (Brandeis et al. 1994
; Macleod et al. 1994
; Mummaneni et al. 1998
). This intriguing model, which depicts the initiation of methylation spread by the Alu repeat-containing methylation center and the functioning of Sp1 elements as boundaries to protect the CpG island from methylation, has been suggested to be applicable to the establishment of methylation patterns of the CpG islands of other genes (Graff et al. 1997
). The CpG island of the Sda β4GalNAcT-II gene is flanked by Alu elements (Figure 2), and multiple sites with the consensus sequence for the Sp1 binding are present in the Sda CpG island (not shown). Whether these elements play any role in the establishment of the methylation pattern in the Sda CpG island awaits further verification.
DNA methylation in CpG-rich promoters of genes is now recognized as a common feature of human neoplasia and cancers (Esteller 2005
; Toyota and Issa 2005
). Aberrant hypermethylation of gene promoters is known to be a major mechanism associated with inactivation of tumor-suppressor genes in cancers, and it is involved in almost all the critical steps of oncogenesis. In colorectal cancers, epigenetic changes in selected genes are tightly related to neoplastic transformation (Suzuki et al. 2002
; Kondo and Issa 2004
), and aberrant DNA methylation appears to arise very early in the colon (initially in mucosa of normal appearance), and may be part of the age-related defect in sporadic colorectal cancers (Ahuja et al. 1998
; Toyota et al. 1999
). It has been shown that the Sda antigen and Sda β4GalNAcT-II transferase activity are drastically diminished with the malignant changes in gastrointestinal tract mucosa (Malagolini et al. 1989
; Dohi et al. 1991
), and that the Sda β4GalNAcT-II mRNA disappears in most cancerous tissue specimens of colon and gastric cancers while it is detected in the majority of the paired tissue specimens from the normal portion (Dohi et al. 1996
). Kawamura et al. showed that the forced expression of Sda β4GalNAcT-II suppressed the formation of the E-selectin ligands, sLea and sLex, in colon and gastric cancer cells and, consequently, reduced the metastasis potential of these cells (Kawamura et al. 2005
). Thus, it can be conjectured that the downregulation of Sda gene expression in the oncogenetic processes facilitates the formation of the sLea and sLex antigens and, therefore, that it promotes metastasis in gastrointestinal cancers. In the present study, the results clearly indicate that DNA methylation in the promoter region plays a decisive role in the suppression of the Sda gene, and that the suppression can be substantially relieved by treatment with the DNA methylation inhibitor, 5-aza-CdR. 5-aza-CdR is one of the most extensively studied drugs of this type, and therapeutic efficacy has been demonstrated in several kinds of cancers (Momparler 2005
). In the present study, however, the results were obtained using gastrointestinal cancer cell lines. It is of importance, therefore, to ascertain whether the downregulation of Sda β4GalNAcT-II gene expression during oncogenetic processes in gastrointestinal tissues occurs via this mechanism of DNA methylation in the promoter region, as demonstrated in cell lines. In addition, the possible existence of other control mechanisms, including those relative to positive and negative regulation, for expression of the Sda gene in gastrointestinal tissues should not be neglected, and elucidation of these mechanisms is expected.
| Materials and methods |
|---|
|
|
|---|
Cell culture
Human colon cancer cell lines Caco-2, Colo 205, HCT 116, SW1417, SW48, SW480, and SW948, gastric cancer cell line KATO III, and pancreatic cancer cell line MIA PaCa-2 were purchased from the American Type Culture Collection (Manassas, VA). Human gastric cancer cell line MKN45 was purchased from the Japanese Collection of Research Bioresources (Health Science Research Resources Bank, Osaka, Japan). Colo 205 and KATO III cells were grown in 90% RPMI 1640 medium supplemented with 10% fetal bovine serum, 50 units/mL of penicillin, and 50 µg/mL of streptomycin. The other eight cell lines were grown in 90% Dulbecco's modified eagle media with identical supplementations.
RT-PCR
Expression of the Sda β4GalNAcT-II gene in various gastrointestinal cancer cell lines was evaluated by RT-PCR. Total RNAs of the assessed cancer cell lines were prepared using the QIAamp RNA Blood Mini Kit (Qiagen GmbH, Hilden, Germany). The first-strand cDNAs were primed by oligo-dT primer and synthesized by M-MLV reverse transcriptase (Promega Co., Madison, WI).
PCR amplifications specific for the short- and long-form Sda transcripts and the common region of the two transcript forms were performed to determine the Sda gene expression. The synthetic oligonucleotide primers, F41 (ACGGAGTGGAGGTGATGC, locating exon 4) and R64 (TGGTGTATGTCACGTGCTG, antisense sequence, locating exon 6), were used to amplify the common region of the short- and long-form Sda transcripts. The synthesized cDNA sample and 5 pmole of each primer were combined in 12.5 µL of PCR buffer containing 0.2 mM of dNTP and 0.625 U of Expand DNA polymerase (Roche Diagnostics GmbH, Mannheim, Germany). The PCR program included 2 min at 95°C, followed by 40 cycles of 30 s at 94°C, 30 s at 62°C, and 1 min at 72°C. The forward primers of F3 (GGGATTCGGGATGACTT, locating exon 1S) and F7 (CTCTGCTTGGAACTCAGA, locating exon 1L) were used for specific amplification for the short- and long-form Sda cDNAs, respectively, with the reverse primer, R10 (TGGCTTCACATTTGCACTG, antisense sequence, locating exon 3), common for the two cDNA forms. The PCR conditions were similar to those mentioned above, except for annealing at 60°C. PCR for the β-actin cDNA was performed using the forward and reverse primers with sequences of CCTCGCCTTTGCCGATCC and GGATCTTCATGAGGTAGTCAGTC (antisense sequence), respectively, and 25 cycles of PCR at an annealing temperature of 58°C were performed. The PCR products were analyzed using 1.5% agarose gel electrophoresis.
Bisulfite genomic sequencing
Genomic DNAs of gastrointestinal cancer cell lines were prepared using the QIAamp DNA Blood Mini Kit (Qiagen). The bisulfite modification method was employed to determine the methylation status of cytosine residue in genomic DNA (Frommer et al. 1992
). In this method, sodium bisulfite is used to convert cytosine residue to uracil in single-strand DNA under conditions whereby 5-methylcytosine remains nonreactive. In the following PCR amplification, the uracil and 5-methylcytosine residues in the sequence under investigation are amplified as thymine and cytosine, respectively. Bisulfite modification of the genomic DNA samples was achieved using the MethylEasy High Throughput DNA Bisulphite Modification Kit (Human Genetic Signatures Pty Ltd., Sydney, Australia).
The upper strand of the bisulfite-modified DNA segment encompassing the promoter and exon 1S regions of the Sda gene was amplified using nested PCR. The first round PCR was performed with primers for the modified sequences, mF1 (TAGGATAGTAGGTGTGGAGTG, nucleotides –601 through –581, transcription start nucleotide of exon 1L as +1) and mR2 (AACCAACRCTCCCCATTCCT, complementary of nucleotides +56 through +75) (Figure 1). Twenty nanograms of bisulfite-modified genomic DNA and 5 pmole of each primer were combined in 12.5 µL of PCR buffer containing 0.2 mM of dNTP and 0.25 U of Taq DNA polymerase (Promega). The PCR program consisted of 5 min at 94°C followed by 30 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C. The second round PCR was performed using the primers for the modified sequences, mF5 (TGAAGTGGAGGGTGGAGGTGGGATT, nucleotides –575 through –551) and mR4 (TCACCTCRCCTCTACAACCACCTAT, complementary of nucleotides +1 through +25). The conditions for the second round PCR were similar to those in the first PCR, except that annealing was at 65°C. The PCR products were cloned into the pGEM-T Easy vector (Promega). DNA sequences were determined using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA).
The methylation statuses of individual CpG sites in the Sda gene CpG island in KATO III cells were analyzed in detail. The upper strand of the bisulfite-modified DNA segment encompassing the majority of the putative CpG island of the Sda gene was PCR amplified. The first round PCR was performed using primers for the modified sequences, mF1 and mR6 (CTTTCAAATATACTTTACCCCRTTA, complementary of nucleotides +446 through +470). The PCR program consisted of 5 min at 94°C followed by 30 cycles of 30 s at 94°C, 30 s at 58°C, and 1 min at 72°C. The second round PCR was performed using the primers for the modified sequences, mF5 and mR8 (ACCACACAACCRCAACTCACTCTACC, complementary of nucleotides +381 through +406), at an annealing temperature of 68°C. Five separate PCR amplifications were performed, and the PCR products cloned. Fifteen clones from the five separate batches of PCR products were selected and the sequence determined.
Methylation-specific PCR
Methylation-specific PCR analysis was established to evaluate the DNA methylation status in the Sda gene promoter. The primer pair of USPF and USPR for the modified sequences, GAGTTGTGGGTGGGTTAAGGTTGTG (nucleotides –523 through –499) and ACCACCCACTCCCTAACTCCAACA (complementary of nucleotides –53 through –30) (Figure 1), respectively, was designed for the unmethylated status. The primer pair of MSPF and MSPR for the modified sequences, GTTGCGGGTGGGTTAAGGTCGCG (nucleotides –521 through –499) and CTACAAACGCCAAAAAAAACCCGCG (complementary of nucleotides –103 through –79), respectively, was designed for the methylated status. The primer pair of mF1 and mR2 was used for the first round PCR, with the bisulfite-modified genomic DNAs serving as templates. The primer pairs for the unmethylated and methylated status (USPF+USPR and MSPF+MSPR, respectively) were then used separately in the second round PCR. The PCR program in the second round PCR consisted of 5 min at 94°C followed by 30 cycles of 30 s at 94°C, 30 s at 65°C, and 1 min at 72°C. The products were analyzed using 1.5% agarose gel electrophoresis.
Treatment of cells with a DNA methylation inhibitor
HCT116 and SW48 colon cancer cells were split into six-well culture plates at a density of 1 x 105 cells/mL, and 5-aza-CdR (Sigma-Aldrich Co., St. Louis, MO), a potent and specific inhibitor of DNA methylation, was added to a final concentration of 5 µM. Cells were incubated for 6 days before harvesting total RNAs and genomic DNAs and examining cell surface Sda antigen expression.
Analysis of cell surface Sda antigen expression
The cell surface Sda antigen was detected using the monoclonal antibody (mAB) KM694, a generous gift from the Pharmaceutical Research Center, Kyowa Hakko Kogyo Co. Ltd. (Tokyo, Japan). The mAB KM694 was initially established as a mAB against GM2 ganglioside; however, greater binding affinity for the Sda structure was subsequently demonstrated (Kawamura et al. 2005
). To examine the expression of the Sda antigen on the surfaces of the SW48 cells, the cells were incubated with 0.25 µg/mL of mAB KM694 after blocking with 5% bovine serum albumin in phosphate-buffered saline. The bound mABs were detected by incubation with 0.5 µg/mL of fluorescein isothiocyanate (FITC)-conjugated goat antimouse IgM (Santa Cruz Biotechnology Inc., Santa Cruz, CA), and then the cells were subjected to flow cytometry. If the FITC signal bound on the cell surfaces was to be examined by fluorescence microscopy, the cells were incubated with 5 µg/mL of mAB KM694.
| Funding |
|---|
|
|
|---|
National Science Council, Taiwan (NSC 96-2320-B-002-074-MY3).
| Conflict of interest statement |
|---|
|
|
|---|
None declared.
| Abbreviations |
|---|
Aprt, adenine phosphoribosyltransferase; 5-aza-CdR, 5-aza-2'- deoxycytidine; β4GalNAcT, β-1,4-N-acetylgalactosaminyl- transferas; FITC, fluorescein isothiocyanate; RBCs, red blood cells; RT-PCR, reverse transcription-polymerase chain reaction; sLea, sialyl Lewisa; sLex, sialyl Lewisx
| References |
|---|
|
|
|---|
Ahuja N, Li Q, Mohan AL, Baylin SB, Issa J-PJ. Aging and DNA methylation in colorectal mucosa and cancer. Cancer Res (1998) 58:5489–5494.
Blanchard D, Cartron J-P, Fournet B, Montreuil J, van Halbeek H, Vliegenthart JFG. Primary structure of the oligosaccharide determinant of blood group Cad specificity. J Biol Chem (1983) 258:7691–7695.
Blanchard D, Piller F, Gillard B, Marcus D, Cartron J-P. Identification of a novel ganglioside on erythrocytes with blood group Cad specificity. J Biol Chem (1985) 260:7813–7816.
Brandeis M, Frank D, Keshet I, Seigfried Z, Mendelsohn M, Nemes A, Temper V, Razin A, Cedar H. Sp1 elements protect a CpG island from de novo methylation. Nature (1994) 371:435–438.[CrossRef][Medline]
Capon C, Maes E, Michalski J-C, Leffler H, Kim YS. Sda-antigen-like structures carried on core 3 are prominent features of glycans from the mucin of normal human descending colon. Biochem J (2001) 358:657–664.[CrossRef][Web of Science][Medline]
DallOlio F, Malagolini N, Di Stefano G, Ciambella M, Serafini-Cessi F. Postnatal development of rat colon epithelial cells is associated with changes in the expression of the β1,4-N-acetylgalactosaminyltransferase involved in the synthesis of Sda antigen and of
2,6-sialyltransferase activity towards N-acetyl-lactosamine. Biochem J (1990) 270:519–524.[Web of Science][Medline]
DallOlio F, Malagolini N, Serafini-Cessi F. Tissue distribution and age-dependent expression of β-4-N-acetylgalactosaminyltransferase in guinea-pig. Biosci Rep (1987) 7:925–932.[CrossRef][Web of Science][Medline]
Daniels G. Human Blood Groups (2002) Oxford: Blackwell.
Dell A, Chalabi S, Easton RL, Haslam SM, Sutton-Smith M, Patankar MS, Lattanzio F, Panico M, Morris HR, Clark GF. Murine and human zona pellucida 3 derived from mouse eggs express identical O-glycans. Proc Natl Acad Sci USA (2003) 100:15631–15636.
Dohi T, Hanai N, Yamaguchi K, Oshima M. Localization of UDP-GalNAc: NeuAc
2,3Gal-R β1,4(GalNAc to Gal)N-acetylgalacto- saminyltransferase in human stomach. J Biol Chem (1991) 266:24038–24043.
Dohi T, Nakasuji M, Oshima M. Induction of the fundic mucosa-specific glycolipid with dimethylformamide in gastric-cancer cell lines. Int J Cancer (1993) 53:137–140.[Web of Science][Medline]
Dohi T, Yuyama Y, Natori Y, Smith PL, Lowe JB, Oshima M. Detection of N-acetylgalactosaminyltransferase mRNA which determines expression of Sda blood group carbohydrate structure in human gastrointestinal mucosa and cancer. Int J Cancer (1996) 67:626–631.[CrossRef][Web of Science][Medline]
Donald ASR, Yates AD, Soh CPC, Morgan WTJ, Watkins WM. A blood group Sda-active pentasaccharide isolated from Tamm-Horsfall urinary glycoprotein. Biochem Biophys Res Commun (1983) 115:625–631.[CrossRef][Web of Science][Medline]
Esteller M. Aberrant DNA methylation as a cancer-inducing mechanism. Annu Rev Pharmacol Toxicol (2005) 45:629–656.[CrossRef][Web of Science][Medline]
Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molly PL, Paul CL. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci USA (1992) 89:1827–1831.
Gardiner-Garden M, Frommer M. CpG islands in vertebrate genomics. J Mol Biol (1987) 196:261–282.[CrossRef][Web of Science][Medline]
Graff JR, Herman JG, Myöhänen S, Baylin SB, Vertino PM. Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation. J Biol Chem (1997) 272:22322–22329.
Kawamura YI, Kawashima R, Fukunaga R, Hirai K, Toyama-Sorimachi N, Tokuhara M, Dohi T. Introduction of Sda carbohydrate antigen in gastrointestinal cancer cells eliminates selectin ligands and inhibits metastasis. Cancer Res (2005) 65:6220–6227.
Klose RJ, Bird AP. Genomic DNA methylation: The mark and its mediators. Trends Biochem Sci (2006) 31:89–97.[CrossRef][Web of Science][Medline]
Kominato Y, Hata Y, Takizawa H, Tsuchiya T, Tsukada J, Yamamoto F. Expression of human histo-blood group ABO gene is dependent upon DNA methylation of the promoter region. J Biol Chem (1999) 274:37240–37250.
Kondo Y, Issa J-PJ. Epigenetic changes in colorectal cancer. Cancer Metastasis Rev (2004) 23:29–34.[CrossRef][Web of Science][Medline]
Lo Presti L, Cabuy E, Chiricolo M, Dall'Olio F. Molecular cloning of the human β1,4 N-acetylgalactosaminyltransferase responsible for the biosynthesis of the Sda histo-blood group antigen: The sequence predicts a very long cytoplasmic domain. J Biochem (2003) 134:675–682.
Macleod D, Charlton J, Mullins J, Bird AP. Sp1 sites in the mouse aprt gene are required to prevent methylation of the CpG island. Genes Dev (1994) 8:2282–2292.
Macvie SI, Morton JA, Pickles MM. The reactions and inheritance of a new blood group antigen, Sda. Vox Sang (1967) 13:485–492.[Web of Science]
Malagolini N, DallOlio F, Di Stefano G, Minni F, Marrano D, Serafini-Cessi F. Expression of UDP-GalNAc: Neu
2,3Galβ-R β1,4(GalNAc to Gal) N-acetylgalactosaminyltransferase involved in the synthesis of Sda antigen in human large intestine and colorectal carcinomas. Cancer Res (1989) 49:6466–6470.
Malagolini N, DallOlio F, Serafini-Cessi F. UDP-GalNAc: NeuAc
2,3Galβ-R (GalNAc to Gal) β1,4-N-acetylgalactosaminyl-transferase responsible for the Sda specificity in human colon carcinoma CaCo-2 cell line. Biochem Biophys Res Commun (1991) 180:681–686.[CrossRef][Web of Science][Medline]
Malagolini N, Santini D, Chiricolo M, DallOlio F. Biosynthesis and expression of the Sda and sialyl Lewisx antigens in normal and cancer colon. Glycobiology (2007) 17:688–697.
Momparler RL. Epigenetic therapy of cancer with 5-aza-2'-deoxycytidine (decitabine). Semin Oncol (2005) 32:443–451.[CrossRef][Web of Science][Medline]
Montiel M-D, Krzewinski-Recchi M-A, Delannoy P, Harduin-Lepers A. Molecular cloning, gene organization and expression of the human UDP-GalNAc: Neu5Ac
2-3Galβ-R β1,4-N-acetylgalactosaminyltransfe- rase responsible for the biosynthesis of the blood group Sda/Cad antigen: Evidence for an unusual extended cytoplasmic domain. Biochem J (2003) 373:369–379.[CrossRef][Web of Science][Medline]
Morton JA, Pickles MM, Terry AM. The Sda blood group antigen in tissues and body fluids. Vox Sang (1970) 19:472–482.[Web of Science][Medline]
Mummaneni P, Walker KA, Bishop PL, Turker MS. Epigenetic gene inactivation induced by a cis-acting methylation center. J Biol Chem (1995) 270:788–792.
Mummaneni P, Yates P, Simpson J, Rose J, Turker MS. The primary function of a redundant Sp1 binding site in the mouse aprt gene promoter is to block epigenetic gene inactivation. Nucleic Acids Res (1998) 26:5163–5169.
Pao MM, Tsutsumi M, Liang G, Uzvolgyi E, Gonzales FA, Jones PA. The endothelin receptor B (EDNRB) promoter displays heterogenous, site specific methylation patterns in normal and tumor cells. Hum Mol Genet (2001) 10:903–910.
Renton PH, Howell P, Ikin EW, Giles CM, Goldsmith KLG. Anti-Sda, a new blood group antibody. Vox Sang (1967) 13:493–501.[Web of Science]
Robbe C, Capon C, Maes E, Rousset M, Zweibaum A, Zanetta J-P, Michalski J-C. Evidence of regio-specific glycosylation in human intestinal mucins. J Biol Chem (2003) 278:46337–46348.
Sanger R, Gavin J, Tippett P, Teesdale P. Plant agglutinin for another human blood-group. In: Lancet (1971) i:1130.
Scarano MI, Strazzullo M, Matarazzo MR, DEsposito M. DNA methylation 40 years later: Its role in human health and disease. J Cell Physiol (2005) 204:21–35.[CrossRef][Web of Science][Medline]
Schmid CW. Does SINE evolution preclude Alu function? Nucleic Acids Res (1998) 26:4541–4550.
Serafini-Cessi F, DallOlio F. Guinea-pig kidney β-N-acetylgalacto- saminyltransferase towards Tamm-Horsfall glycoprotein. Biochem J (1983) 215:483–489.[Web of Science][Medline]
Smith PL, Lowe JB. Molecular cloning of a murine N-acetylgalacto- samine transferase cDNA that determines expression of the T lymphocyte-specific CT oligosaccharide differentiation antigen. J Biol Chem (1994) 269:15162–15171.
Song F, Smith JF, Kimura MT, Morrow AD, Matsuyama T, Nagase H, Held WA. Association of tissue-specific differentially methylated region (TDMs) with differential gene expression. Proc Natl Acad Sci USA (2005) 102:3336–3341.
Song JZ, Stirzaker C, Harrison J, Melki JR, Clark SJ. Hypermethylation trigger of the glutathione-S-transferase gene (GSTP1) in prostate cancer cells. Oncogene (2002) 21:1048–1061.[CrossRef][Web of Science][Medline]
Suzuki H, Gabrielson E, Chen W, Anbazhagan R, van Engeland M, Weijenberg MP, Herman JG, Baylin SB. A genetic screen for genes upregulated by demethylation and histone deacetylase inhibition in human colorectal cancer. Nat Genet (2002) 31:141–149.[CrossRef][Web of Science][Medline]
Takai D, Jones PA. Comprehensive analysis of CpG islands in human chromosomes 21 and 22. Proc Natl Acad Sci USA (2002) 99:3740–3745.
Toyota M, Ahuja N, Ohe-Toyoto M, Herman JG, Baylin SB, Issa J-PJ. CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci USA (1999) 96:8681–8686.
Toyota M, Issa J-PJ. Epigenetic changes in solid and hematopoietic tumors. Semin Oncol (2005) 32:521–531.[CrossRef][Web of Science][Medline]
Turker MS. Gene silencing in mammalian cells and the spread of DNA methylation. Oncogene (2002) 21:5388–5393.[CrossRef][Web of Science][Medline]
Yates PA, Burman RW, Mummaneni P, Krussel S, Turker MS. Tandem B1 elements located in a mouse methylation center provide a target for de novo DNA methylation. J Biol Chem (1999) 274:36357–36361.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






