Glycobiology Advance Access originally published online on February 26, 2007
Glycobiology 2007 17(6):655-662; doi:10.1093/glycob/cwm022
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Introduction of bisecting GlcNAc in N-glycans of adenylyl cyclase III enhances its activity
2 Department of Biochemistry, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan
3 Division of Molecular Cell Biology, Department of Biomolecular Sciences, Saga University Faculty of Medicine, 5-1-1 Nabeshima, Saga 849-8501, Japan
4 Division of Regulatory Glycobiology, Institute of Molecular Biomembrane and Glycobiology, Tohoku Pharmaceutical University, Sendai, Miyagi 981-8558, Japan
5 Department of Biochemistry, Kochi Medical School, Nangoku, Kochi 783-8505, Japan
6 Department of Disease Glycomics, Research Institute for Microbial Diseases, 4th Floor, Center for Advanced Science & Innovation, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871, Japan
1 To whom correspondence should be addressed; Tel: +81-6-6879-4137; Fax: +81-6-6879-4137; e-mail address: tani52{at}wd5.so-net.ne.jp
Received on January 9, 2007; revised on February 16, 2007; accepted on February 19, 2007
| Abstract |
|---|
|
|
|---|
Adenylyl cyclases (ACs) catalyze the synthesis of cAMP in response to extracellular and intracellular signals and are responsible for a wide variety of biological activities including cell growth, differentiation, and metabolism. There are nine, currently known, isoforms of transmembrane ACs, and the primary structure of the catalytic unit and the potential N-glycosylation sites are highly conserved among them. The enzyme ß1,4-N-acetylglucosaminyltransferase III (GnT-III) catalyzes the addition of a bisecting N-acetylglucosamine (GlcNAc) to N-glycans. We have been studying the function of GnT-III on signaling molecules. In this study, we report on the effects of a bisecting GlcNAc on AC signaling. We established GnT-III stable expressing cell lines of Neuro-2a mouse neuroblastoma cells and B16 mouse melanoma cells. Forskolin-induced AC activation and downstream signaling, such as the synthesis of cAMP and the phosphorylation of transcriptional factor CRE-binding protein were upregulated in the GnT-III transfectants compared with mock transfectants or a dominant negative mutant of GnT-III-transfected cells. Since endogenous AC expression levels in Neuro-2a and B16 cells were too low to permit the glycosylation status to be examined, AC type III (ACIII) was overexpressed in a stable expression system using Flp-In-293 cells. The N-glycans of ACIII in the GnT-III transfectants were confirmed to be modified by the introduction of a bisecting GlcNAc, and AC activity was found to be significantly up-regulated in the GnT-III transfectants. Thus, the structure of N-glycans of ACIII regulates its enzymatic activity and downstream signaling.
Key words: adenylyl cyclase / bisecting GlcNAc / glycosylation / GnT-III / N-glycan
| Introduction |
|---|
|
|
|---|
Adenylyl cyclases (ACs) catalyze the synthesis of cAMP in response to extracellular and intracellular signals and are involved in wide variety of biological activities including cell growth, differentiation, and metabolism. Nine isoforms of transmembrane ACs and a soluble AC have been isolated and analyzed to date, revealing diverse regulation by G-proteins, Ca2 +, protein kinase A (PKA), and protein kinase C (PKC) (Sunahara et al. 1996
N-glycans on glycoproteins regulate their function in various manners; for example, N-glycans affect the intracellular transport of membrane proteins, the ligand binding rate of receptors, dimerization status or the endocytosis rate of receptors. The mechanisms of this regulation have been studied, and it was proposed that N-glycans alter the physico-chemical properties of core proteins, such as conformation, flexibility, and hydrophilicity, and thus regulate protein sorting, stability, and proteinprotein interactions (Dennis et al. 1999
; Rudd et al. 2001
; Helenius and Aebi 2004
; Freeze and Aebi 2005
; Taniguchi et al. 2006
). Lectin or lectin-like molecules, which recognize the peripheral structures of N-glycans, are also involved in the regulation of glycoproteins (Partridge et al. 2004
; Ohtsubo et al. 2005
). N-glycans have a common core structure, and their branching patterns are determined by glycosyltransferase enzymes. ß1,4-N-acetylglucosaminyltransferase III (GnT-III) is a glycosyltransferase that catalyzes the addition of a bisecting GlcNAc residue to the ß-mannoside of the trimannose core in N-glycans (Narasimhan 1982
; Nishikawa et al. 1992
; Taniguchi et al. 1999
; Stanley 2002
). GnT-III is known to suppress the elongation of N-glycans, since other glycosyltransferases such as GnT-IV and GnT-V, both of which are involved in the formation of multiantennary sugar chains, are not able to act on N-glycans that contain a bisecting GlcNAc (Schachter 1986
; Gu et al. 1993
).
To identify the role of N-glycans in the signaling pathway, we employed a promoterreporter assay and found that the forskolin-induced activation of the cAMP response element (CRE) was enhanced in the GnT-III transfectants. We observed that the forskolin-induced catalytic activity of AC was significantly increased in GnT-III-transfected Neuro-2a cells and B16 cells, compared with control cells. Exogenously expressed AC type III (ACIII) activity was also up-regulated by introduction of GnT-III, and it was confirmed that the N-glycan of AC was modified by a bisecting GlcNAc. Our findings demonstrate that ACIII activity is up-regulated by GnT-III transfection, and the mechanism by which AC activity is regulated by N-glycans is proposed.
| Results |
|---|
|
|
|---|
Increase in forskolin-induced downstream signaling in GnT-III-transfected Neuro-2a cells
Previous studies have demonstrated that glycosylation patterns regulate the function of many types of signaling molecules. We examined transcription from the elements of AP-1, CRE, heat shock element (HSE), Myc, NF-
B in several cell lines induced by various types of stimulation using a promoterreporter assay method. Among those elements, we found that transcription from CRE was elevated by 2-fold in GnT-III-transfected Neuro-2a cells when stimulated with 10 µM forskolin at 37 °C for 4 h (data is not shown). We confirmed that the phosphorylation of CRE- binding protein (CREB) at Ser-133 was enhanced in the GnT-III transfectants compared with mock transfectants or the D323A dominant negative mutant of GnT-III-transfected cells (Figure 1A). Since forskolin stimulates ACs that synthesize cAMP, leading to the activation of PKA and the phosphorylation of CREB, we then examined AC activity and cellular cAMP levels in Neuro-2a cells. As shown in Figure 1B, forskolin-induced AC activation was significantly up-regulated in the GnT-III transfectants. It was also observed that cAMP in the GnT-III transfectants was significantly increased compared with control cells (Figure 1C).
|
To determine whether similar phenomenon could be observed in other cell lines, we examined B16 cells and found that forskolin-induced AC activation and CREB phosphorylation were also elevated in GnT-III-transfected B16 cells (Figure 2A and B).
|
Identification of AC isoforms up-regulated by GnT-III transfection in Neuro-2a cells and B16 cells
Since there are nine, currently known, membrane-bound AC isoforms and one soluble isoform, we attempted to determine which isoform(s) is (are) affected by GnT-III overexpression. RTPCR was carried out using Neuro-2a cells and B16 cells, and, as shown in Figure 3, ACIII, -VI, -VII, and -IX are common in those cell lines. As reported previously, ACIII, -VI, and -VIII are glycoproteins, and ACIX is insensitive to forskolin (Premont et al. 1996
|
Establishment of Flp-In 293 cells stably expressing ACIII
Since endogenous AC expression levels in Neuro-2a and B16 cells were too low to examine the glycosylation status, we established ACIII stable expression cell lines using Flp-In 293 cells. The expression levels of ACIII were confirmed by both western blotting and an activity assay. The ACIII transfectants showed two bands by immunoprecipitation and western blotting using an ACIII antibody, and the molecular masses were about 180 and 120 kDa (Figure 4A), consistent with previously reported data (Wei et al. 1996
|
The profile of ACIII in GnT-III-transfected Flp-In 293 cells stably expressing ACIII
GnT-III, the D323A dominant negative mutant of GnT-III, and vector were then transfected into Flp-In 293 cells stably expressing ACIII, and the effect of GnT-III was investigated. The expression levels of GnT-III were confirmed by western blotting using a GnT-III-specific antibody and a GnT-III activity assay (data not shown). A western blot revealed that the protein levels of ACIII in each transfectant were similar (Figure 5A, left panel). When a lectin blot was performed, E4-PHA reacted with the upper band of ACIII in the GnT-III transfectants but not with ACIII in the mock transfectant and D323A dominant negative mutant of GnT-III transfectant (Figure 5A, right panel), indicating that N-glycans of ACIII in the GnT-III transfectant were modified by the insertion of a bisecting GlcNAc. When the cells were treated with N-glycosidase F (PNGase F), which cleaves N-glycans between the innermost N-acetylglucosamine and asparagines residue, only the lower bands could be detected (Figure 5B), indicating that the upper bands represented the glycosylated form and the lower bands represented the non-glycosylated form, as was suggested in a previous report (Wei et al. 1996
|
Forskolin-induced ACIII activity is increased in GnT-III-transfected Flp-In 293 cells stably expressing ACIII
AC activity in the GnT-III transfectants was examined. When cells were treated with 100 µM forskolin, the GnT-III transfectants showed an increased AC activity compared with mock transfectants and the D323A dominant negative mutant of GnT-III transfectants, as expected (Figure 6). Furthermore, when cells were treated with PMA, a calmodulin-dependent kinase II inhibitor, or a phosphodiesterase E inhibitor, AC activity in the GnT-III transfectants was slightly increased, but the difference compared with control cells was not significant (data not shown), indicating that GnT-III transfection specifically affects the forskolin-ACIII pathway.
|
| Discussion |
|---|
|
|
|---|
AC isoforms are tightly controlled by various signals and therefore contribute to the complexity of cellular signaling mechanisms. ACIII is expressed in several tissues including brain, spinal cord, adrenal medulla, adrenal cortex, heart atrium, aorta, lung, retina (Xia et al. 1992
In this study, we reported that glycosyltransferase GnT-III participates in the regulation of the AC signaling pathway. We found that the overexpression of GnT-III up-regulates AC activity in Neuro-2a mouse neuroblastoma cells and B16 mouse melanoma cells (Figures 1B and 2A). In those GnT-III transfectants, downstream signaling such as the formation of cellular cAMP and CREB phosphorylation, is also enhanced (Figures 1A, C and 2B). To elucidate the mechanism by which AC activity is enhanced in the GnT-III transfectants, we constructed a stable expression system of ACIII and GnT-III using Flp-In 293 cells. We confirmed that neither the total expression nor the cell surface expression levels of ACIII were changed in the GnT-III transfectants (Figure 5A and C). Experiments with PNGase F suggest that ACIII is glycosylated in Flp-In 293 cells, and that the upper band represents the glycosylated form and the lower band the unglycosylated form (Figure 5B). The results of lectin blotting indicated that N-glycan of the upper band of ACIII is modified by the insertion of a bisecting GlcNAc in the GnT-III transfectants (Figure 5A). It appears likely that the modification of N-glycan affects the function of ACIII itself, since activity was measured in the membrane fraction preparations, which might be free from AC-regulating molecules (Figure 6), although we cannot completely rule out the possibility that the addition of bisecting GlcNAc to other glycoproteins in addition to ACIII affects AC activity.
The function of the N-glycan of ACs has been studied by several groups; it was proposed that glycosylation is involved in the Ca2 +-induced phosphorylation of ACIII (Wei et al. 1996
). The glycosylation of ACVI significantly affects its catalytic activity in an activator-dependent manner and also alters the sensitivity of ACVI to the inhibition induced by a G
i-coupled receptor or by PKC (Wu et al. 2001
). The glycosylation state of ACVIII affects the catalytic activity without altering its Km values or its dependence on calmodulin (Cali et al. 1996
). These results strongly suggest that the N-glycan on ACs regulates AC activity. In the present study, we examined the effects of the modification of N-glycan structure of ACIII. We assume that other AC isoforms might also be involved in the up-regulation of forskolin-induced CREB phosphorylation in GnT-III. The detailed-mechanisms of how bisecting GlcNAc affects ACIII activity remain to be elucidated, but the possibility that ACIII with a bisecting GlcNAc becomes less responsive to inhibitory signals cannot be excluded since N-glycans regulate proteinprotein interactions. In the case of ACVI, sensitivity toward the G
i-coupled dopamine D2 receptor decreases by the deletion of glycans. Since GnT-III is a key enzyme that inhibits the extension and modification of N-glycans by introducing a bisecting GlcNAc, it is possible that GnT-III transfection reduces the interaction between certain residues of the N-glycan of ACIII and inhibitory molecules.
Previous studies have shown that GnT-III affects a number of intracellular signaling pathways (Yoshimura et al. 1996
; Ihara et al. 1997
; Kitada et al. 2001
; Sato et al. 2001
; Bhattacharyya et al. 2002
; Shibukawa et al. 2003
; Yang et al. 2003
; Zhao et al. 2006
). For example, when GnT-III is overexpressed in PC12 cells, Trk A, a nerve growth factor receptor, is modified with a bisecting GlcNAc, which suppresses its dimerization (Ihara et al. 1997
). GnT-III overexpression in HeLaS3 cells leads to the up-regulation of endocytosis of epidermal growth factor receptor (Sato et al. 2001
). Furthermore, GnT-III transfection in HeLaS3 cells suppressed H2O2-induced activation of the PKC
JNK1 pathway, resulting in the inhibition of apoptosis (Shibukawa et al. 2003
). Since cAMP is involved in a variety of physiological activities, the up-regulation of AC activity in GnT-III transfectants might be involved in the mechanisms of the above-observed phenomena.
Our results suggest that N-glycans on ACIII play an important role in regulating its activity. In a future study, we plan to analyze the structures of AC-linked N-glycans and to conduct detailed studies of the mechanisms by which N-glycans affect AC function.
| Materials and methods |
|---|
|
|
|---|
Promoterreporter assay
To determine the pathway that is up-regulated in the GnT-III transfectants, we utilized the Pathway Profiling Systems (Clontech, Palo Alto, CA). Briefly, Neuro-2a cells were plated in six-well plates and transfected with promoterreporter plasmids using Lipofectamine 2000 as described in the manufacturer's protocol. These plasmids contained the luciferase reporter gene downstream of several copies of specific transcription factor-binding sequences such as AP-1, CRE, HSE, Myc, and NF-
B. After incubation at 37 °C for 18 h, the cells were starved for 7 h and then treated with different chemicals. Cells were lysed and luciferase activities were measured using the Dual-Luciferase Reporter Assay (Promega, Madison, WI) following the manufacturer's protocol.
Construction of GnT-III and ACIII expression vectors
Rat GnT-III was subcloned in pCXN2 (Niwa et al. 1991
), which contains a neo gene, and is regulated by the ß-actin promoter. A D323A dominant negative mutant of GnT-III was constructed as reported previously. D323 in GnT-III is supposed to be involved in the coordination of a divalent cation such as Mn2 + along with a phosphoryl group of the donor nucleotide sugar and thus crucial for the enzymatic activity (Ihara et al. 2002
). Human ACIII cDNA was cloned from human brain RNA; the full-length of human ACIII was amplified by RTPCR with the following primers: CAGCAACATGTCATGGTTTAG (sense); CTTCAGCTGAATTTGTGGCTG (antisense). The coding region of ACIII was subcloned into a eukaryotic expression vector, pcDNA5/FRT (Invitrogen, Carlsbad, CA), driven by the cytomegalovirus promoter, for a stable high expression Flp-In system.
Cell culture and transfection
Neruo-2a mouse neuroblastoma cells and B16 mouse melanoma cells were maintained in Dulbecco's modified Eagle's medium (DMEM, low glucose), and Flp-In 293 cells (Invitrogen) were maintained in DMEM (high glucose) supplemented with 10% fetal bovine serum in an incubation chamber supplied with 5% CO2 at 37 °C. The cells were transfected with the desired construct using Lipofectamine 2000 (Invitrogen) following the manufacture's protocol. For GnT-III transfection, cells were selected by treatment with 1000 µg/mL of neomycin for 2 weeks, and for ACIII transfection, the cells were selected by treatment with 200 µg/mL of hygromycin B (Calbiochem, La Jolla, CA) for 2 weeks. Antibiotic-resistant colonies were isolated and recloned by serial dilution to ensure clonality. To confirm the expression of GnT-III or ACIII, western blotting and an enzyme activity assay were performed.
Immunoprecipitation and western blotting
Cell cultures were washed with ice-cold phosphate-buffered saline (PBS) and harvested in lysis buffer [20 mM TrisHCl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 1% (w/v) Nonidet P-40, 10% (w/v) glycerol, 5 mM sodium pyrophosphate, 10 mM NaF, 1 mM sodium orthovanadate, 10 mM ß-glycerophosphate, 1 mM phenylmethylsulfonyl fluoride (PMSF), 2 µg/mL aprotinin, 5 µg/mL leupeptin, and 1 mM dithiothreitol]. Cell lysates were centrifuged at 15 000 rpm for 15 min to obtain supernatants, and protein concentrations were determined using a protein assay CBB kit (Nacalai Tesque, Kyoto, Japan). For immunoprecipitation with ACIII, the lysate was incubated with a rabbit polyclonal antibody against ACIII (C-20) (Santa Cruz Biotechnology, Santa Cruz, CA) for 3 h at 4 °C and then with 15 µL of protein G-Sepharose for 2 h at 4 °C. For western blotting, whole cell lysates or immunoprecipitates were subjected to SDS polyacrylamide gel electrophoresis (PAGE), and transferred to a PVDF membrane (Amersham Pharmacia Biotech, Piscataway, NJ). The membrane was blocked with 5% (w/v) skimmed milk in Tris-buffered saline containing 0.1% (v/v) Tween-20 (TBST, pH 7.5) for 2 h at room temperature and incubated with antibodies against CREB (Cell signaling), phospho-CREB (Cell signaling), ACIII (C-20) (Santa Cruz) or GnT-III (Fuji rebio Inc., Tokyo, Japan) overnight at 4 °C. After washing with TBST, the membranes were treated with the second antibodies for 1 h at room temperature. The membranes were washed and immunoreactive bands were visualized using an ECL kit (Amersham Pharmacia), according to the manufacturer's instructions.
Measurement of total cellular cAMP
Cells were cultured overnight until 80% confluent in 96-well dishes (103 to 105 cells/well). After treatment with the indicated chemicals at 37 °C for 20 min, the cells were lysed and total cellular cAMP levels were determined using a Biotrak cAMP enzyme immunoassay kit (Amersham Pharmacia), following the manufacture's protocol.
Membrane fraction preparation for AC activity assay
Cells were harvested, resuspended in buffer A (25 mM TrisHCl, 0.4 mM EDTA, 1 mM EGTA, 250 mM sucrose, 0.1 mM leupeptin, and 40 µM PMSF, pH 7.4), and homogenized using a glass Dounce homogenizer. The homogenate was centrifuged at 1500 rpm for 5 min to remove nuclei and broken cell pieces, and the supernatant centrifuged again at 50 000g for 30 min to collect the membrane fractions. The pelleted membrane fraction was resuspended in buffer B (10 mM TrisHCl, pH 7.4, 10 mM EDTA, 5 mM MgCl2), and the protein concentrations determined using a protein assay CBB kit (Nacalai Tesuque, Japan).
AC activity assay
The catalytic activities of AC were measured as described previously, with minor modifications (Onda et al. 2001
). The reaction mixtures contained 20 mM HEPES (pH 8.0), 0.5 mM EDTA, 0.1 mM ATP containing [
-32P] ATP (1 x 106 cpm) (Amersham Pharmacia), 0.1 mM cAMP, 1 mM creatine phosphate, 8 U/mL creatine phosphokinase, 5 mM MgCl2, and 10 µg of membrane protein in a final volume of 100 µL. Reactions were performed at 30 °C for 20 min in the presence or absence of 100 µM forskolin and terminated by adding 10 µL of ice-cold 2.2 M HCl. The [32P] cAMP produced was separated on acidic alumina columns (Alvarez and Daniels 1992
). Briefly, the samples were applied to an acidic alumina column (ICN Pharmaceuticals, Inc., Costa Mesa, CA), which was washed with 5 mM HCl to remove any unbound contaminants, and the bound cAMP was eluted with 6 mL of 0.1 M ammonium acetate (pH 7.0). The radioactivity of the eluted samples was determined by scintillation counting.
RTPCR analysis
Total RNA was prepared from Neuro-2a and B16 cells using the TRIzol reagent (Invitrogen), and the cDNAs were synthesized by Superscriptase II (Gibco BRL, Gaithersburg, MD) with an oligo (dT) primer. To determine the expression of each AC isoform, PCR was performed with the specific primers listed in Table I. The reaction conditions were as follows; 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. Amplified cDNA fragments were confirmed by DNA electrophoresis on 1% agarose gel.
|
Lectin blotting
The immunoprecipitated ACIII was electrophoresed on 8% SDSPAGE and transferred to PVDF membranes, as described above. The membrane was blocked with 3% bovine serum albumin (BSA) (w/v) in TBST and then incubated with 1 µg/mL of biotinylated erythroagglutinating phytohemagglutinin (E4-PHA) (Seikagaku Corp., Tokyo, Japan) in TBST for 30 min at room temperature. After washing with TBST for three times, lectin-reactive proteins were detected by using a Vectastain ABC kit (Vector Laboratories, Burlingame, CA) and an ECL kit.
PNGase F digestion
Whole-cell lysates of human ACIII transfectants were boiled with 0.1 M 2-mercaptoethanol and 0.1% SDS for 10 min. After boiling, the cell lysates were incubated with 60 mM TrisHCl (pH 8.6), 0.8% Nonidet P-40, and 40 mU/mL of PNGase F (Roche Applied Science, Indianapolis, IN) at 37 °C, 16 h. The samples were then subjected to western blotting using an anti-ACIII antibody, as described above.
Cell surface biotinylation
Cells were cultured overnight until 80% confluence was reached. After washing three times with PBS supplemented with 0.1 mM CaCl2 and 1 mM MgCl2, the cells were incubated with 200 µg/mL of EZ-LinkTM Sulfo-NHS-Biotin (Pierce, Rockford, IL) at room temperature for 30 min. The reaction was quenched with 25 mM Tris (pH 8.0) containing 150 mM NaCl. After washing three times with PBS, the cells were solubilized with 1 mL of lysis buffer, and the cell lysates were centrifuged at 15 000 rpm for 15 min to obtain the supernatant. Immunoprecipitation was performed using an anti-ACIII antibody and the immunoprecipitates were separated by 8% SDSPAGE and then transferred to a PVDF membrane as described above. After blocking the membrane with 3% (w/v) BSA in TBST overnight, a Vectastain ABC kit and an ECL kit were used to detect the biotinylated protein.
| Conflict of interest statement |
|---|
|
|
|---|
None declared.
| Acknowledgments |
|---|
|
|
|---|
Grant support was provided by the 21st Century COE Program from the Japan Society for the promotion of Science; Core Research for Evolutional Science and Technology from Japan Science and Technology Agency; and Special Coordination Funds for Promoting Science and Technology, the Ministry of Education, Culture, Sports, Science and Technology, Japan.
| Abbreviations |
|---|
AC, adenylyl cyclase; ACIII, adenylyl cyclase type III; BSA, bovine serum albumin; CRE, cAMP response element; CREB, CRE-binding protein; DMEM, Dulbecco's modified Eagle's medium; GlcNAC, N-acetylglucosamine; GnT-III, ß1, 4-N-acetylglucosaminyltransferase III; HSE, heat shock element; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; PKA, cAMP-dependent protein kinase A; PKC, protein kinase C; PMSF, phenylmethylsulfonyl fluoride; PNGase, N-glycosidase F; TBST, Tris-buffered saline with Tween-20.
| References |
|---|
|
|
|---|
Abdel-Halim SM, Guenifi A, He B, Yang B, Mustafa M, Hojeberg B, Hillert J, Bakhiet M, Efendic S. Mutations in the promoter of adenylyl cyclase (AC)-III gene, overexpression of AC-III mRNA, and enhanced cAMP generation in islets from the spontaneously diabetic GK rat model of type 2 diabetes. Diabetes (1998) 47:498504.[Abstract]
Alvarez R, Daniels DV. A separation method for the assay of adenylylcyclase, intracellular cyclic AMP, and cyclic-AMP phosphodiesterase using tritium-labeled substrates. Anal Biochem (1992) 203:7682.[CrossRef][Web of Science][Medline]
Bakalyar HA, Reed RR. Identification of a specialized adenylyl cyclase that may mediate odorant detection. Science (1990) 250:14031406.
Bhattacharyya R, Bhaumik M, Raju TS, Stanley P. Truncated, inactive N-acetylglucosaminyltransferase III (GlcNAc-TIII) induces neurological and other traits absent in mice that lack GlcNAc-TIII. J Biol Chem (2002) 277:2630026309.
Cali JJ, Parekh RS, Krupinski J. Splice variants of type VIII adenylyl cyclase. Differences in glycosylation and regulation by Ca2 +/calmodulin. J Biol Chem (1996) 271:10891095.
Defer N, Marinx O, Poyard M, Lienard MO, Jegou B, Hanoune J. The olfactory adenylyl cyclase type 3 is expressed in male germ cells. FEBS Lett (1998) 424:216220.[CrossRef][Web of Science][Medline]
Dennis JW, Granovsky M, Warren CE. Glycoprotein glycosylation and cancer progression. Biochim Biophys Acta (1999) 1473:2134.[Medline]
Freeze HH, Aebi M. Altered glycan structures: the molecular basis of congenital disorders of glycosylation. Curr Opin Struct Biol (2005) 15:490498.[CrossRef][Web of Science][Medline]
Gautier-Courteille C, Salanova M, Conti M. The olfactory adenylyl cyclase III is expressed in rat germ cells during spermiogenesis. Endocrinology (1998) 139:25882599.
Gu J, Nishikawa A, Tsuruoka N, Ohno M, Yamaguchi N, Kangawa K, Taniguchi N. Purification and characterization of UDP-N-acetylglucosamine: alpha-6-D-mannoside beta 1-6N-acetylglucosaminyltransferase (N-acetylglucosaminyltransferase V) from a human lung cancer cell line. J Biochem (Tokyo) (1993) 113:614619.
Helenius A, Aebi M. Roles of N-linked glycans in the endoplasmic reticulum. Annu Rev Biochem (2004) 73:10191049.[CrossRef][Web of Science][Medline]
Ihara H, Ikeda Y, Koyota S, Endo T, Honke K, Taniguchi N. A catalytically inactive beta 1,4-N-acetylglucosaminyltransferase III (GnT-III) behaves as a dominant negative GnT-III inhibitor. Eur J Biochem (2002) 269:193201.[Web of Science][Medline]
Ihara Y, Sakamoto Y, Mihara M, Shimizu K, Taniguchi N. Overexpression of N-acetylglucosaminyltransferase III disrupts the tyrosine phosphorylation of Trk with resultant signaling dysfunction in PC12 cells treated with nerve growth factor. J Biol Chem (1997) 272:96299634.
Kitada T, Miyoshi E, Noda K, Higashiyama S, Ihara H, Matsuura N, Hayashi N, Kawata S, Matsuzawa Y, Taniguchi N. The addition of bisecting N-acetylglucosamine residues to E-cadherin down-regulates the tyrosine phosphorylation of beta-catenin. J Biol Chem (2001) 276:475480.
Livera G, Xie F, Garcia MA, Jaiswal B, Chen J, Law E, Storm DR, Conti M. Inactivation of the mouse adenylyl cyclase 3 gene disrupts male fertility and spermatozoan function. Mol Endocrinol (2005) 19:12771290.
Narasimhan S. Control of glycoprotein synthesis. UDP-GlcNAc:glycopeptide beta 4-N-acetylglucosaminyltransferase III, an enzyme in hen oviduct which adds GlcNAc in beta 1-4 linkage to the beta-linked mannose of the trimannosyl core of N-glycosyl oligosaccharides. J Biol Chem (1982) 257:1023510242.
Nishikawa A, Ihara Y, Hatakeyama M, Kangawa K, Taniguchi N. Purification, cDNA cloning, and expression of UDP-N-acetylglucosamine: beta-D-mannoside beta-1,4N-acetylglucosaminyltransferase III from rat kidney. J Biol Chem (1992) 267:1819918204.
Niwa H, Yamamura K, Miyazaki J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene (1991) 108:193199.[CrossRef][Web of Science][Medline]
Ohtsubo K, Takamatsu S, Minowa MT, Yoshida A, Takeuchi M, Marth JD. Dietary and genetic control of glucose transporter 2 glycosylation promotes insulin secretion in suppressing diabetes. Cell (2005) 123:13071321.[CrossRef][Web of Science][Medline]
Onda T, Hashimoto Y, Nagai M, Kuramochi H, Saito S, Yamazaki H, Toya Y, Sakai I, Homcy CJ, Nishikawa K, et al. Type-specific regulation of adenylyl cyclase. Selective pharmacological stimulation and inhibition of adenylyl cyclase isoforms. J Biol Chem (2001) 276:4778547793.
Partridge EA, Le Roy C, Di Guglielmo GM, Pawling J, Cheung P, Granovsky M, Nabi IR, Wrana JL, Dennis JW. Regulation of cytokine receptors by Golgi N-glycan processing and endocytosis. Science (2004) 306:120124.
Premont RT, Matsuoka I, Mattei MG, Pouille Y, Defer N, Hanoune J. Identification and characterization of a widely expressed form of adenylyl cyclase. J Biol Chem (1996) 271:1390013907.
Rudd PM, Elliott T, Cresswell P, Wilson IA, Dwek RA. Glycosylation and the immune system. Science (2001) 291:23702376.
Sato Y, Takahashi M, Shibukawa Y, Jain SK, Hamaoka R, Miyagawa J, Yaginuma Y, Honke K, Ishikawa M, Taniguchi N. Overexpression of N-acetylglucosaminyltransferase III enhances the epidermal growth factor-induced phosphorylation of ERK in HeLaS3 cells by up-regulation of the internalization rate of the receptors. J Biol Chem (2001) 276:1195611962.
Schachter H. Biosynthetic controls that determine the branching and microheterogeneity of protein-bound oligosaccharides. Biochem Cell Biol (1986) 64:163181.[Web of Science][Medline]
Shibukawa Y, Takahashi M, Laffont I, Honke K, Taniguchi N. Down-regulation of hydrogen peroxide-induced PKC delta activation in N-acetylglucosaminyltransferase III-transfected HeLaS3 cells. J Biol Chem (2003) 278:31973203.
Smit MJ, Iyengar R. Mammalian adenylyl cyclases. Adv Second Messenger Phosphoprotein Res (1998) 32:121.[Medline]
Stanley P. Biological consequences of overexpressing or eliminating N-acetylglucosaminyltransferase-TIII in the mouse. Biochim Biophys Acta (2002) 1573:363368.[Medline]
Sunahara RK, Dessauer CW, Gilman AG. Complexity and diversity of mammalian adenylyl cyclases. Annu Rev Pharmacol Toxicol (1996) 36:461480.[CrossRef][Web of Science][Medline]
Sunahara RK, Taussig R. Isoforms of mammalian adenylyl cyclase: multiplicities of signaling. Mol Interv (2002) 2:168184.
Tang WJ, Hurley JH. Catalytic mechanism and regulation of mammalian adenylyl cyclases. Mol Pharmacol (1998) 54:231240.
Taniguchi N, Miyoshi E, Jianguo G, Honke K, Matsumoto A. Decoding sugar functions by identifying target glycoproteins. Curr Opin Struct Biol (2006) 16:561566.[CrossRef][Web of Science][Medline]
Taniguchi N, Miyoshi E, Ko JH, Ikeda Y, Ihara Y. Implication of N-acetylglucosaminyltransferases III and V in cancer: gene regulation and signaling mechanism. Biochim Biophys Acta (1999) 1455:287300.[Medline]
Wei J, Wayman G, Storm DR. Phosphorylation and inhibition of type III adenylyl cyclase by calmodulin-dependent protein kinase II in vivo. J Biol Chem (1996) 271:2423124235.
Wong ST, Baker LP, Trinh K, Hetman M, Suzuki LA, Storm DR, Bornfeldt KE. Adenylyl cyclase 3 mediates prostaglandin E(2)-induced growth inhibition in arterial smooth muscle cells. J Biol Chem (2001) 276:3420634212.
Wong ST, Trinh K, Hacker B, Chan GC, Lowe G, Gaggar A, Xia Z, Gold GH, Storm DR. Disruption of the type III adenylyl cyclase gene leads to peripheral and behavioral anosmia in transgenic mice. Neuron (2000) 27:487497.[CrossRef][Web of Science][Medline]
Wu GC, Lai HL, Lin YW, Chu YT, Chern Y. N-glycosylation and residues Asn805 and Asn890 are involved in the functional properties of type VI adenylyl cyclase. J Biol Chem (2001) 276:3545035457.
Xia Z, Choi EJ, Wang F, Storm DR. The type III calcium/calmodulin-sensitive adenylyl cyclase is not specific to olfactory sensory neurons. Neurosci Lett (1992) 144:169173.[CrossRef][Web of Science][Medline]
Yang X, Tang J, Rogler CE, Stanley P. Reduced hepatocyte proliferation is the basis of retarded liver tumor progression and liver regeneration in mice lacking N-acetylglucosaminyltransferase III. Cancer Res (2003) 63:77537759.
Yoshimura M, Ihara Y, Matsuzawa Y, Taniguchi N. Aberrant glycosylation of E-cadherin enhances cell-cell binding to suppress metastasis. J Biol Chem (1996) 271:1381113815.
Zhao Y, Nakagawa T, Itoh S, Inamori K, Isaji T, Kariya Y, Kondo A, Miyoshi E, Miyazaki K, Kawasaki N, et al. N-acetylglucosaminyltransferase III antagonizes the effect of N-acetylglucosaminyltransferase V on alpha3beta1 integrin-mediated cell migration. J Biol Chem (2006) 281:3212232130.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





