Glycobiology Advance Access originally published online on September 24, 2007
Glycobiology 2007 17(12):1404-1412; doi:10.1093/glycob/cwm104
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Galectin-8 Induces Apoptosis in the CD4highCD8high Thymocyte Subpopulation
2 Instituto de Investigaciones Biotecnológicas - Instituto Tecnológico de Chascomús, CONICET-UNSAM, (B1650WAB) San Martín, Buenos Aires, Argentina
3 The Consortium for Functional Glycomics Microarray Core, The Scripps Research Institute, La Jolla, CA 92037 USA
1 To whom correspondence should be addressed: Tel: +54-11 4580-7255; Fax: +54-11 4752-9639; e-mail: oscar{at}iib.unsam.edu.ar
Received on July 20, 2007; revised on September 5, 2007; accepted on September 9, 2007
| Abstract |
|---|
|
|
|---|
In the present work, we followed a microarray approach to analyze the expression of glycosylation-related genes on different cell populations obtained from mouse thymus. Among other genes, transcription of the two-domain type galectin-8 was detected both in thymocytes and thymic epithelial cells (TECs), which was confirmed by reverse transcriptase (RT)-PCR assays independently carried out on both cell populations. Two splice variants, differing solely in the presence of a nine amino acid insertion in the linker peptide region connecting the two carbohydrate recognition domains (CRDs), were identified from purified thymocytes. Expression of galectin-8 was verified at the protein level in total organ extracts by western-blots of lactosyl-Sepharose purified binders. To explore the possible biological roles of locally produced galectin-8, both splice variants were recombinantly expressed in bacteria and assayed over cultured thymocytes. In spite of their binding to all cell populations, addition of either isoform of galectin-8 to thymocyte cultures induced apoptosis only of the CD4highCD8high cells through caspases pathway activation. All of these effects were prevented by the addition of thiodigalactoside (TDG) or lactose, thus indicating that the proapoptotic activity of galectin-8 was due to the specific interaction of its CRDs with defined cell surface glycans. Together, our results demonstrate intrathymic expression of galectin-8 in mouse, and suggest an active role for this lectin in shaping the mature T cell repertoire.
Key words: galectin expression / microarray analysis / thymocyte apoptosis
| Introduction |
|---|
|
|
|---|
Thymocytes suffer a complex maturation process that finally renders the repertoire of mature T cells. During their journey through the thymus, thymocytes have to interact with different cell populations including macrophages, dendritic cells, and thymic epithelial cells (TECs) that conjointly participate in the associated selection processes. One of the already well-known markers useful to visualize this process is the modification of the glycoconjugates at the cell surface as revealed earlier by their labeling with plant lectins. Presently, the developmentally regulated expression of the different enzymes that modify the glycosylation pattern is emerging together with the biologic relevance of these modifications (Gillespie et al. 1993
To obtain new insights into the expression of genes related to the glycosylation processes in the thymus, a microarray approach was followed by using the glycochips from the Consortium of Functional Glycomics (www.functionalglycomics.org). One of the identified genes transcribed both in TECs and thymocytes encodes galectin-8, a molecule whose relevance in the thymic environment is entirely unknown. Galectins constitute a family of ß-galactoside-binding lectins that exerts several distinct biological functions on the immune system (Bianco et al. 2006
; Toscano et al. 2007
) and in tumors (Liu and Rabinovich 2005
). Some components of this family of proteins, such as galectin-1, -3, and -9 are expressed in thymus among other tissues (Baum et al. 1995
; Wada et al. 1997
; Villa-Verde et al. 2002
). Galectin-8 belongs to the tandem repeat type galectins (that also includes galectins-4, -6, -9, and -12), which contain two carbohydrate recognition domains (CRDs) joined by a linker peptide whose variable length define different isoforms in rats and humans (Bidon, Brichory, Bourguet, et al. 2001
; Bidon, Brichory, Hanash, et al. 2001
). Although this galectin is a widely distributed protein that can be found in several healthy tissues and its expression in many tumors was also reported (Bidon, Brichory, Bourguet, et al. 2001
; Bidon, Brichory, Hanash, et al. 2001
; Zick et al. 2004
), only scarce information is still available concerning the effect of galectin-8 on the immune system. Galectin-8 transcripts were found in a mouse neonatal thymus-derived library (GeneBank AK083350) and the protein was detected in low amounts in the rat thymus (Hadari et al. 2000
), although no biologic function at all was advanced. Therefore, it is of interest to demonstrate the actual presence at the protein level of this lectin in the thymus together with its biological functions. In the present work, we identified for the first time two kinds of transcripts in mouse thymocyte mRNA that encode for different galectin-8 isoforms. The presence of the lectin was then confirmed by western blotting of thymus total organ extracts. Both recombinant isoforms were found to bind to all thymocytes, but to induce apoptosis only in the CD4highCD8high subpopulation.
| Results |
|---|
|
|
|---|
Expression of galectin-8 in the thymus
Microarray analyses were separately performed with RNA obtained of thymocytes and from TECs. Detailed data can be found at www.functionalglycomics.org/glycomics/publicdata/ microarray.jsp. Through the analysis of thymocyte and TEC gene expression profiles (summarized in the supplementary Table I), the transcripts corresponding to galectin-8 were detected. To confirm the expression of this lectin in the thymus, reverse transcriptase (RT)-PCR assays with cDNA separately obtained from thymocyte and TEC RNA as template were carried out. To measure the level of galectin-8 transcription in both cell types, SYBR Green real time RT-PCR was performed and the results obtained agreed with the signals observed in the microarray assays and by conventional RT-PCR (Figure 1). Transcripts were significantly more abundant in thymocytes than in TECs. Galectin-1 high expression in TECs was previously reported (Baum et al. 1995
|
Galectin-8 was then cloned by polymerase chain reaction (PCR) performed on cDNA from mouse thymocytes using primers designed on a mouse putative galectin-8 sequence obtained from a lung data base (GenBank AK004782). Two different kinds of amplicon that differ in the encoding of an inserted 9 amino acid residues stretch in the linker peptide were cloned at similar frequency. Out of this stretch, both sequences were identical among them and to the reported putative galectin-8 from mouse lung. These 9 extra residues correspond to an alternative splicing in the exon IV (Figure 2, upper panel) and are absent from any other reported transcript sequence, even those that putatively encode the lectin found in mouse cDNA libraries. Cloned transcripts predict the two tandem CRDs containing the respective HXNPR, WGXEEI, and WGXEER motifs and the peptide linker region (Figure 2, lower panel). The sequence was almost identical to that of the reported galectin-8 from rat liver (Hadari et al. 1995
|
|
To test for the actual presence of galectin-8 in the thymus, the whole homogenate of five organs was passed through a lactosyl-Sepharose affinity column to concentrate lactose binders. To further reduce the volume, the eluted fractions were kept at –20°C to induce the precipitation of galectin-8 (Hadari et al. 1995
Galectin-8 induces thymocyte apoptosis
Galectin-8 is secreted by an unknown mechanism into the extracellular space, where it exerts its function in a paracrine/ autocrine way (Zick et al. 2004
). The binding to thymocytes was then tested by reacting cells with both recombinant lectins (0.1 µM) followed by galectin-8 affinity-purified rabbit antibodies. Binding of both isoforms to the cell surface on more than 99% of thymocytes was observed, as shown in Figure 4A for the galectin-8L. Labeling was inhibited by the addition of 100 mM lactose after incubation with the lectins, supporting their specific interaction with the cell surface glycans. The slight displacement to the right in the control without galectin-8 addition was prevented by washing cells with 100 mM lactose (not shown) suggesting the labeling of the endogenous lectin.
|
The ability of galectin-1, -3, and -9 to induce thymocyte apoptosis when exogenously added is well known (Wada et al. 1997
To determine the thymocyte subpopulations affected, galectin-8 treated cultures were labeled for CD4 and CD8 markers. Although all cells bind the lectin (Figure 4A), only the CD4highCD8high population was depleted regardless of which lectin isoform was tested (Figure 4C). CD4highCD8high cells were reduced by about 50% after incubation for 16 h with 0.5 µM of galectin-8. As before, this effect was also prevented by the addition of TDG. The fact that only a defined subpopulation was affected, is in agreement with the low increase in the dying cells number observed by PI (Figure 4B) which does not support an extensive depletion. In search for the induced cell depletion mechanism, thymocytes cultured for 16 h in the presence of 1–2 µM galectin-8 were assayed for caspases activation with fluorescent substrates. Evident activity of caspase-3, together with caspases-8 and -9 were recorded supporting the apoptosis induction as the cell death process (Figure 4D).
From the results reported until here, galectin-8 induces both depletion of a defined subpopulation of thymocytes and the activation of the caspase pathway. To confirm the association of both processes, caspase-3 activation was evaluated by fluorescence together with CD4/CD8 markers labeling. For this purpose, thymocytes were cultured for 8 h in the presence of 2 µM galectin-8. From the histogram shown in Figure 5A, cells that display caspase-3 activation (area under the marker) were selected for further analysis by CD4/CD8 dot plot. This area represents about 25% of cells treated with galectin-8 versus 5% for untreated cells. Apoptotic cell number was reduced by TDG addition from 25% to 6%. As shown in Figure 5B, cells where the activation of caspase-3 was induced by galectin-8 treatment were all included in the CD4highCD8high subpopulation. The relative proportions of cells that enter into apoptosis in presence of TDG were conserved as they probably represent cells not accessed by the inhibitor. These findings agree with the depletion of these thymocytes reported in Figure 4C and are also supporting the absence of noticeable deleterious activity of galectin-8 on other subpopulations. Findings reported in Figures 4 and 5 were similar when cells from either the LPS-resistant C3H/HeJ or from C57BL/6J mice were assayed, then disregarding the effect of bacterial debris.
|
| Discussion |
|---|
|
|
|---|
In this work, the expression of galectin-8 in mouse thymus was described for the first time together with the existence of two isoforms, which are generated by alternative splicing of the exon IV. Several isoforms are also described for the human galectin-8 as transcripts from a carcinoma cell line that are due to alternative splicing involving exons VIII and IX that even involve the CRDs (Bidon, Brichory, Hanash, et al. 2001
The addition of galectin-8 to thymocyte cultures induced the activation of the caspase pathway. In fact, the caspase-3 activity was associated with the CD4highCD8high cells that constitute the subpopulation depleted by the treatment with galectin-8. This mechanism of action is consistent with that followed by other galectins, that are known to induce apoptosis by the activation of the caspases pathway except for one report concerning galectin-1 (Hahn et al. 2004
). However, other authors found this lectin to induce caspases activation as well (Matarrese et al. 2005
; Ion et al. 2006
). The ability of galectin-8 to deplete the CD4highCD8high cells supports a narrow role for this lectin and suggests its involvement in the thymocyte selection process. This constitutes an interesting difference with the activity of other galectins on thymocytes. Galectin-1 induces apoptosis not only in CD4+CD8+ cells, but also in the more immature CD4–CD8– thymocytes. Meanwhile, extracellular galectin-3 preferentially depletes this latter population (Hernandez et al. 2006
; Stillman et al. 2006
). In relation with galectin-1, galectin-8 was expressed at lesser levels in the thymus, but was able to induce thymocyte death when assayed at lower concentrations (20 µM versus 0.5 µM). This property is consistent with its structure where both CRDs are joined, then circumventing the requirement to dimerize the molecule to induce effects (Carlsson et al. 2007
) and stresses the possible biologic relevance of galectin-8 in the thymus. Galectin-8 was expressed not only by thymocytes, but also by TECs. TECs are in fact associated with the double positive thymocyte subpopulation conforming the so-called "nurse cell complex" where the selection process partially occurs. This may be suggesting a functional purpose for a localized production of this galectin in the selective depletion of the susceptible CD4highCD8high cells. The ability of this galectin to induce cell depletion in a defined subpopulation is consistent with the fact that the interaction of galectin-8 with integrins on Jurkat T cells is not enough to induce their apoptosis (Carcamo et al. 2006
) in strong contrast with parallel findings using galectin-9 (Lu et al. 2007
). These results support a selective activity of galectin-8 along the T cell maturation process that seems associated with the interaction with distinct molecules, or their glycoforms, that are exposed at the surface by the different cellular populations, a possibility that seems highly feasible due to the fine specificity in sugar reactivity of this galectin (Carlsson et al. 2007
).
| Materials and methods |
|---|
|
|
|---|
Mice and tissue samples
C57BL/6J and C3H/HeJ breeding pairs were obtained from The Jackson Labs (Bar Harbor, MA) and grew in our animal facilities. For RNA preparations, thymus from 4-week-old C57BL/6J animals were removed and passed through a stainless steel mesh in RPMI 1640 medium (GIBCO, Carlsbad, CA). Cell suspension was washed and incubated with red blood cells lysis buffer (Sigma, St. Louis, MO) and washed again with medium. The pellet was solubilized in Trizol reagent (Invitrogen, Carlsbad, CA) (1 mL per thymus) and total RNA was extracted following the manufacturer's instructions. TEC cultures were generated as described in (Hiramine et al. 1990
Analysis of TEC and thymocyte gene expression
Analysis of gene expression was carried out using two different custom gene microarrays produced by Affimetrix for the Consortium of Functional Glycomics (www.functionalglycomics. org). GLYCOv1 chip that contains a set of 752 mouse genes, and GLYCOv2 chip that contains a set of 942 mouse genes (included those of GLYCOv1). For thymocyte analysis, 3 male and 3 female replicates (each replicate originated from a pool of 3 animals, total: 9 animals per group) were processed using GLYCOv1 chips, resulting in triplicate RNA samples per gender. For TEC analysis, six independent experiments were performed using GLYCOv2 chips, thus resulting in sextuplicate RNA sample. Total RNA extracted with Trizol was treated with DNAse I, and further purified with RNAsy columns using the cleanup protocol (Qiagen, Valencia, CA) and was quality checked with an Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA). RNA was amplified, labeled, and hybridized to the GLYCO chips according to the Affymetrix recommended protocols. One chip per biological replicate was run.
The MAS 5.0 algorithm (Affymetrix, Santa Clara, CA) was used to determine present (P) and absent (A) absolute calls for each sample. All marginal calls were considered as absent. Expression signals were then generated using the Robust Multiarray Analysis algorithm (Irizarry et al. 2003
). Genes were finally considered present if they had been assigned a present call in at least two out of three replicate samples, and the average unlogged RMA expression signal was
100 (as empirically determined). Unsupervised hierarchical clustering by sample was performed with BRB ArrayTools using the default settings for correlation and linkages. Statistical comparisons were made for each gene to determine whether the signals were statistically significant.
Real-time quantitative RT-PCR
To validate microarray results, quantitative real-time RT-PCR reactions were performed as described (Alfonso et al. 2002
). Reactions were performed using the SYBR Green PCR Core Reagents (Applied Biosystems, Warrington, UK) in a final volume of 25 µL in a Gene Amp 5700 Sequence Detection System (Applied Biosystems, Warrington, UK). Primers sets that amplify about 100 bp sequences as close as possible to the 3' end of the target genes were designed using Primer Express software (Applied Biosystems). Galectin-8: Fwd 5'GGGTGG- TGGGTGGAACTG3', Rev 5'GCCTTTGAGCCCCCAATA- TC3'. Galectin-1: Fwd 5'TGCCAGACGGACATGAATTC3', Rev 5'CATCCGCCGCCATGTAGT3'.
Standard curves were generated for each primer set and each PCR was run using serial dilutions of one known cDNA sample (Rajeevan et al. 2001
). SYBR Green data were obtained using the sodium dodecyl sulfate (SDS) sequence detector 1.6.3 software (Applied Biosystems). Samples were tested against ß-Actin and glyceraldheyde 3-phosphate dehydrogenase (GAPDH) reference genes for normalization of data, a procedure for adjusting variations in RNA and/or cDNA quality and quantity. Prior to the correction calculations, all the expression data were logarithmically transformed.
Expression of mouse recombinant galectin-8
A set of primers (Fwd 5'AAAGCTAGCATGTTGTCCTTA- AATAACCTA3', Rev 5'AAAAGATCTCCGGATAAGCCATT- TTGTA3') containing the BglII and NheI cleavage sites (underlined) were designed to amplify the entire coding sequence of galectin-8 using C57BL/6J mouse thymus cDNA as template. The PCR product was gel purified, ligated into pGemT vector (Promega, Madison, WI) and transformed into Escherichia coli DH5-
. DNA from positive clones was sequenced to confirm the inserts. Two kinds of amplicons were cloned at similar frequency, one encoding a galectin-8 containing 9 amino acid residues longer hinge named galectin-8L (GenBank EF524570) and a shorter one, named galectin-8S, that coincided with the reported putative sequences from mouse lung library (GenBank AK004782). The BglII/NheI excised fragment was subcloned into pTrcHis B (Invitrogen) expression plasmid and transformed into E. coli BL-21. Overnight cultures were diluted 1/100 in 500 mL of Terrific Broth (USB Bio) and ampicillin, and incubated with agitation at 37°C. At OD600nm = 1, isopropyl ß-D-thio galactopyranoside 0.25 mM (Sigma) was added and the culture was incubated for 18 h at 18°C with shaking. The pellet was resuspended in 30 mL of buffer (PBS containing 4 mM 2-mercaptoethanol (2-ME), 2 mM EDTA, pepstatine A, leupeptin, and 1 mM phenylmethylsulfonyl fluoride (PMSF), pH 7.5), and lysed by sonication. Cell debris was removed by centrifugation twice at 15,000 x g at 4°C for 30 min. Thirty ml of the soluble extract were filtered through a 0.45 µm pore membrane and seeded on a 1 mL lactosyl-Sepharose column (Sigma). After washing with several volumes of PBS, the lectin was eluted with PBS containing 100 mM D-lactose (Sigma). Fractions of 1 mL were collected and analyzed by 10% SDS-PAGE. A single band of about 35–36 kDa corresponding to the MW predicted for the mouse galectin-8S and -8L DNA sequences were recorded. Fractions containing the protein were pooled and seeded into a 1 mL His-Trap Column (GE-Healthcare, Uppsala, Sweden). After washing the column with Tris–HCl 20 mM, NaCl 50 mM, 30 mM imidazole, pH 8.8, galectin-8 was eluted with Tris–HCl 20 mM, NaCl 50 mM, 100 mM imidazole, pH 6.8. About 3–5 mg of pure recombinant lectins were recovered by this protocol. Proteins were dialyzed overnight against 4 L of PBS with 4 mM 2-ME at 4°C. When needed, the protein was concentrated with polyethylene glycol 8000.
Hemagglutination assay
In this assay, 50 µL of a 4% v/v suspension of PBS-washed fresh mouse red blood cells were mixed with 50 µL of twofold serial dilutions of the recombinant galectins in PBS plus 2% bovine serum albumin (BSA). When required, lactose, maltose or TDG (Sigma) were added at different concentrations from 0 to 20 mM to test agglutination inhibition. The reaction was performed in a 96-round bottom well plate and incubated for 1 h at room temperature.
Antibodies
Antibodies against recombinant mouse galectin-8 were raised in rabbits. Animals were subcutaneously injected with 100 µg of galectin-8L emulsified in complete Freund's adjuvant (Sigma) followed by three boosters (every 14 days) of 20 µg protein in incomplete Freund's adjuvant (Sigma) each. IgG was purified through a Protein A affinity column (GE Healthcare) and then subjected to galectin-8L affinity chromatography on an Hi-Trap NHS-activated HP column (GE Healthcare) previously charged with recombinant mouse galectin-8L. Antibodies were eluted with glycine 0.1 M, NaCl 0.15 M, pH 2.5 and neutralized with 1 M Tris Base. Anti-rat galectin-8 monoclonal antibody (mAb) (Arbel-Goren et al. 2005
) was kindly provided by Dr. Y. Zick (Weizmann Institute of Science, Israel). Fluorescent mAbs against mouse CD4 and CD8 were from BD (San Diego, CA).
Purification of galectin-8 from mouse thymus
Thymuses from C57BL/6J male mice were cut into pieces and homogenized with 15 mL of ice-cold buffer (PBS containing 4 mM 2-ME, 2 mM EDTA and a cocktail of protease inhibitors (pepstatine A, leupeptin, and PMSF), 1% NP40, pH 7.5) and centrifuged at 11,000 rpm for 45 min at 4°C. The supernatant was seeded onto a 1 mL lactosyl-Sepharose column, following the above-described protocol. Eluted fractions were kept at –20 °C to induce precipitation of galectin-8 (Hadari et al. 1995
). The pellet was resuspended in SDS-PAGE cracking buffer. Fractions without notorious precipitate were added with 10% TCA and the pellets resuspended in SDS-PAGE cracking buffer were pooled in a small volume. Both samples were run in a 10% SDS-PAGE and transferred onto polyvinyl difluoride membranes. Blots were probed with anti-mouse galectin-8 rabbit serum 1/100, followed by horseradish peroxidase (HRP)-labeled goat IgG anti-rabbit IgG 1/5000 and developed by chemoluminescence (both from Pierce, Rockford, IL). In a similar set of assays, blots were probed with a mouse mAb anti-rat galectin-8 followed by HRP-labeled anti-mouse IgG secondary antibodies (Dako, Carpinteria, CA).
Galectin-8 binding
Mouse C57BL/6J and C3H/HeJ thymocytes were treated with 0.1 µM of galectin-8S or -8L, washed with PBS or PBS plus 100 mM lactose, blocked with anti-Fc receptors (BD), and incubated with 1/500 affinity-purified anti-galectin-8 antibodies on ice with sodium azide followed by incubation with 1/1000 FITC-conjugated anti-rabbit IgG antibodies (Molecular Probes). Cells were washed, fixed, and analyzed by flow cytometry. Two controls were included, one where cells were first incubated with a nonrelated rabbit IgG and another where cells were processed without incubation with galectin-8. A FACSCalibur Cytometer (BD) and WinMdi software were employed throughout this work.
Apoptosis induction
Thymocytes from C57BL/6J and C3H/HeJ (LPS resistant) male mice were obtained as described above and seeded in a 24-well plate at 1 x 106 cells/0.5 mL RPMI medium plus 10% FCS and gentamycin. Galectin-8S or -8L (0.5–2 µM) were added and 1–2.5 µg/mL anti-Fas ligand (BD) or 1 µM dexamethasone (Sigma) were used as controls. As galectin-8 inhibitor, 30 mM TDG was included 20 min before lectin addition. After 16–18 h of culture at 37°C and 5% CO2, thymocytes were washed with 100 mM lactose in PBS to detach cells from the plate bottom. For hypoploidy assays, cells were fixed with ethanol 70% in PBS, washed, and dispersed in 5 µg/mL of PI, 0.3% NP40, and 0.1% sodium citrate until flow cytometry analysis. For population assays, thymocytes were incubated with conjugated anti-mouse CD4 and anti-mouse CD8 mAbs (BD), washed, fixed, and analyzed by flow cytometry.
Caspase activity assay
After apoptosis induction, thymocytes from either mouse strain were assayed for caspase activation. Caspase-3, -8, and -9 activities were measured using specific substrates (for caspases -8 and -9: Flica kit, Immunochemistry Technologies, LLC, Bloomington, MN and for caspase-3: NucView 488 Caspase-3 Assay Kit for Live Cells, Biotium, Inc., Hayward, CA), following manufacturer's instructions. For triple labeling procedures, thymocytes were cultured for 8 h in the presence of galectin-8S (2 µM), incubated with caspase-3 fluorescent substrate and finally labeled for CD4/CD8 markers. Cells were analyzed by flow cytometry.
| Supplementary Data |
|---|
|
|
|---|
Supplementary data for this article is available online at http://glycob.oxfordjournals.org.
| Funding |
|---|
|
|
|---|
Agencia Nacional de Promoción de la Ciencia y Tecnología, (ANPCyT), Universidad Nacional de San Martín and Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) (Argentina). The gene microarray analysis was conducted by the Gene Microarray (E) Core of the Consortium for Functional Glycomics funded by National Institute of General Medical Sciences Grant GM62116.
| Conflict of interest statement |
|---|
|
|
|---|
None declared.
| Acknowledgments |
|---|
|
|
|---|
Authors are in debt to Dr. Y. Zick from the Weizmann Institute of Science, Rehovot, for the anti-rat galectin-8 mAb, Drs. A. Cassola and J. Alfonso for their help with sequence analysis and real time RT-PCR, Dr. M. Barboza for his help with the cytometry assays and Drs. G. Rabinovich and C. Buscaglia for critical reading of the manuscript. The technical assistance of Mr. Fabio Fraga in animal care is appreciated.V.C. is a fellow from ANPCyT. M.V.T and J.M. are fellows and F.A. and O.C. are Researchers from CONICET.
| Abbreviations |
|---|
BSA, bovine serum albumin; CRDs, carbohydrate recognition domain/s; EDTA, ethylenediamine tetra-acetic acid; FBS, fetal bovine serum; GAPDH, glyceraldheyde 3-phosphate dehydrogenase; HRP, horseradish peroxidase; IgG, immunoglobulin G; 2-ME, 2-mercaptoethanol; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PI, propidium iodide; PMSF, phenylmethylsulfonyl fluoride; RT-PCR, reverse transcriptase-PCR; SDS, sodium dodecyl sulfate; SDS-PAGE, SDS-polyacrylamide gel electrophoresis; TEC, thymic epithelial cell/s; TCA, trichloroacetic acid; TDG, thiodigalactoside
| References |
|---|
|
|
|---|
Alfonso J, Pollevick GD, Castensson A, Jazin E, Frasch AC. Analysis of gene expression in the rat hippocampus using Real Time PCR reveals high inter-individual variation in mRNA expression levels. J Neurosci Res (2002) 67:225–234.[CrossRef][Web of Science][Medline]
Arbel-Goren R, Levy Y, Ronen D, Zick Y. Cyclin-dependent kinase inhibitors and JNK act as molecular switches, regulating the choice between growth arrest and apoptosis induced by galectin-8. J Biol Chem (2005) 280:19105–19114.
Baum LG, Derbin K, Perillo NL, Wu T, Pang M, Uittenbogaart C. Characterization of terminal sialic acid linkages on human thymocytes. Correlation between lectin-binding phenotype and sialyltransferase expression. J Biol Chem (1996) 271:10793–10799.
Baum LG, Pang M, Perillo NL, Wu T, Delegeane A, Uittenbogaart CH, Fukuda M, Seilhamer JJ. Human thymic epithelial cells express an endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes and T lymphoblastoid cells. J Exp Med (1995) 181:877–887.
Bianco GA, Toscano MA, Ilarregui JM, Rabinovich GA. Impact of protein-glycan interactions in the regulation of autoimmunity and chronic inflammation. Autoimmun Rev (2006) 5:349–356.[CrossRef][Web of Science][Medline]
Bidon N, Brichory F, Bourguet P, Le Pennec JP, Dazord L. Galectin-8: a complex sub-family of galectins (Review). Int. J Mol Med (2001) 8:245–250.
Bidon N, Brichory F, Hanash S, Bourguet P, Dazord L, Le Pennec JP. Two messenger RNAs and five isoforms for Po66-CBP, a galectin-8 homolog in a human lung carcinoma cell line. Gene (2001) 274:253–262.[CrossRef][Web of Science][Medline]
Carcamo C, Pardo E, Oyanadel C, Bravo-Zehnder M, Bull P, Caceres M, Martinez J, Massardo L, Jacobelli S, Gonzalez A, et al. Galectin-8 binds specific beta1 integrins and induces polarized spreading highlighted by asymmetric lamellipodia in Jurkat T cells. Exp Cell Res (2006) 312:374–386.[Web of Science][Medline]
Carlsson S, Oberg CT, Carlsson MC, Sundin A, Nilsson UJ, Smith D, Cummings RD, Almkvist J, Karlsson A, Leffler H. Affinity of galectin-8 and its carbohydrate recognition domains for ligands in solution and at the cell surface. Glycobiology (2007) 17:663–676.
Galvan M, Tsuboi S, Fukuda M, Baum LG. Expression of a specific glycosyltransferase enzyme regulates T cell death mediated by galectin-1. J Biol Chem (2000) 275:16730–16737.
Gillespie W, Paulson JC, Kelm S, Pang M, Baum LG. Regulation of a2,3-sialyltransferase expression correlates with conversion of peanut agglutinin (PNA)+ to PNA– phenotype in developing thymocytes. J Biol Chem (1993) 268:3801–3804.
Hadari YR, Arbel-Goren R, Levy Y, Amsterdam A, Alon R, Zakut R, Zick Y. Galectin-8 binding to integrins inhibits cell adhesion and induces apoptosis. J Cell Sci (2000) 113:2385–2397.[Abstract]
Hadari YR, Paz K, Dekel R, Mestrovic T, Accili D, Zick Y. Galectin-8. A new rat lectin, related to galectin-4. J Biol Chem (1995) 270:3447–3453.
Hahn HP, Pang M, He J, Hernandez JD, Yang RY, Li LY, Wang X, Liu FT, Baum LG. Galectin-1 induces nuclear translocation of endonuclease G in caspase- and cytochrome c-independent T cell death. Cell Death Differ (2004) 11:1277–1286.[CrossRef][Web of Science][Medline]
Hernandez JD, Nguyen JT, He J, Wang W, Ardman B, Green JM, Fukuda M, Baum LG. Galectin-1 binds different CD43 glycoforms to cluster CD43 and regulate T cell death. J Immunol (2006) 177:5328–5336.
Hiramine C, Hojo K, Koseto M, Nakagawa T, Mukasa A. Establishment of a murine thymic epithelial cell line capable of inducing both thymic nurse cell formation and thymocyte apoptosis. Lab Invest (1990) 62:41–54.[Web of Science]
Ion G, Fajka-Boja R, Kovacs F, Szebeni G, Gombos I, Czibula A, Matko J, Monostori E. Acid sphingomyelinase mediated release of ceramide is essential to trigger the mitochondrial pathway of apoptosis by galectin-1. Cell Signal (2006) 18:1887–1896.[CrossRef][Web of Science][Medline]
Irizarry RA, Bolstad BM, Collin F, Cope LM, Hobbs B, Speed TP. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res (2003) 31:e15.
Levy Y, Auslender S, Eisenstein M, Vidavski RR, Ronen D, Bershadsky AD, Zick Y. It depends on the hinge: a structure-functional analysis of galectin-8, a tandem-repeat type lectin. Glycobiology (2006) 16:463–476.
Liu FT, Rabinovich GA. Galectins as modulators of tumour progression. Nat Rev Cancer (2005) 5:29–41.[CrossRef][Web of Science][Medline]
Lu LH, Nakagawa R, Kashio Y, Ito A, Shoji H, Nishi N, Hirashima M, Yamauchi A, Nakamura T. Characterization of galectin-9-induced death of Jurkat T cells. J Biochem (Tokyo) (2007) 141:157–172.
Matarrese P, Tinari A, Mormone E, Bianco GA, Toscano MA, Ascione B, Rabinovich GA, Malorni W. Galectin-1 sensitizes resting human T lymphocytes to Fas (CD95)-mediated cell death via mitochondrial hyperpolarization, budding, and fission. J Biol Chem (2005) 280:6969–6985.
Moody AM, Chui D, Reche PA, Priatel JJ, Marth JD, Reinherz EL. Developmentally regulated glycosylation of the CD8
ß coreceptor stalk modulates ligand binding. Cell (2001) 107:501–512.[CrossRef][Web of Science][Medline]
Moody AM, North SJ, Reinhold B, Van Dyken SJ, Rogers ME, Panico M, Dell A, Morris HR, Marth JD, Reinherz EL. Sialic acid capping of CD8ß core 1-O-glycans controls thymocyte-major histocompatibility complex Class I interaction. J Biol Chem (2003) 278:7240–7246.
Ohtsubo K, Marth JD. Glycosylation in cellular mechanisms of health and disease. Cell (2006) 126:855–867.[CrossRef][Web of Science][Medline]
Rajeevan MS, Ranamukhaarachchi DG, Vernon SD, Unger ER. Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods (2001) 25:443–451.[CrossRef][Web of Science][Medline]
Stillman BN, Hsu DK, Pang M, Brewer CF, Johnson P, Liu FT, Baum LG. Galectin-3 and galectin-1 bind distinct cell surface glycoprotein receptors to induce T cell death. J Immunol (2006) 176:778–789.
Toscano MA, Ilarregui JM, Bianco GA, Campagna L, Croci DO, Salatino M, Rabinovich GA. Dissecting the pathophysiologic role of endogenous lectins: Glycan-binding proteins with cytokine-like activity? Cytokine Growth Factor Rev (2007) 18:57–71.[CrossRef][Web of Science][Medline]
Vespa GN, Lewis LA, Kozak KR, Moran M, Nguyen JT, Baum LG, Miceli MC. Galectin-1 specifically modulates TCR signals to enhance TCR apoptosis but inhibit IL-2 production and proliferation. J Immunol (1999) 162:799–806.
Villa-Verde DM, Silva-Monteiro E, Jasiulionis MG, Farias-De-Oliveira DA, Brentani RR, Savino W, Chammas R. Galectin-3 modulates carbohydrate-dependent thymocyte interactions with the thymic microenvironment. Eur. J Immunol (2002) 32:1434–1444.[CrossRef]
Wada J, Ota K, Kumar A, Wallner EI, Kanwar YS. Developmental regulation, expression, and apoptotic potential of galectin-9, a ß-galactoside binding lectin. J Clin Invest (1997) 99:2452–2461.[Web of Science][Medline]
Zick Y, Eisenstein M, Goren RA, Hadari YR, Levy Y, Ronen D. Role of galectin-8 as a modulator of cell adhesion and cell growth. Glycoconj J (2004) 19:517–526.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. V. Tribulatti, V. Cattaneo, U. Hellman, J. Mucci, and O. Campetella Galectin-8 provides costimulatory and proliferative signals to T lymphocytes J. Leukoc. Biol., August 1, 2009; 86(2): 371 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Norambuena, C. Metz, L. Vicuna, A. Silva, E. Pardo, C. Oyanadel, L. Massardo, A. Gonzalez, and A. Soza Galectin-8 Induces Apoptosis in Jurkat T Cells by Phosphatidic Acid-mediated ERK1/2 Activation Supported by Protein Kinase A Down-regulation J. Biol. Chem., May 8, 2009; 284(19): 12670 - 12679. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Massardo, C Metz, E Pardo, V Mezzano, M Babul, E Jarpa, A. Guzman, S Andre, H Kaltner, H. Gabius, et al. Autoantibodies against galectin-8: their specificity, association with lymphopenia in systemic lupus erythematosus and detection in rheumatoid arthritis and acute inflammation Lupus, May 1, 2009; 18(6): 539 - 546. [Abstract] [PDF] |
||||
![]() |
S. R. Stowell, C. M. Arthur, K. A. Slanina, J. R. Horton, D. F. Smith, and R. D. Cummings Dimeric Galectin-8 Induces Phosphatidylserine Exposure in Leukocytes through Polylactosamine Recognition by the C-terminal Domain J. Biol. Chem., July 18, 2008; 283(29): 20547 - 20559. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bi, L. A. Earl, L. Jacobs, and L. G. Baum Structural Features of Galectin-9 and Galectin-1 That Determine Distinct T Cell Death Pathways J. Biol. Chem., May 2, 2008; 283(18): 12248 - 12258. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







