Glycobiology Advance Access originally published online on August 6, 2007
Glycobiology 2007 17(10):1084-1093; doi:10.1093/glycob/cwm083
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Characterization and subcellular localization of human neutral class II
-mannosidase cytosolic enzymes/free oligosaccharides/glycosidehydrolase family 38/M2C1/N-glycosylation
3 Institute of Biotechnology, University of Helsinki, FIN-00014, Finland
4 Department of Biochemistry and Food Chemistry, University of Turku, FIN-20014, Finland
5 Unité de Glycobiologie Structurale et Fonctionnelle, UMR CNRS 8576, IFR 147, GDR CNRS 2590, Université des Sciences et Technologies de Lille, Villeneuve dAscq, France
6 Department of Medical Biochemistry, University of Tromsø, N-9037 Tromsø, Norway
1 To whom correspondence should be addressed: Tel: +358-9-191-58957; Fax: +358-9-191-59940; e-mail: pirkko.heikinheimo{at}helsinki.fi
Received on April 10, 2007; revised on July 27, 2007; accepted on July 31, 2007
| Abstract |
|---|
|
|
|---|
A glycosyl hydrolase family 38 enzyme, neutral
-mannosidase, has been proposed to be involved in hydrolysis of cytosolic free oligosaccharides originating either from ER-misfolded glycoproteins or the N-glycosylation process. Although this enzyme has been isolated from the cytosol, it has also been linked to the ER by subcellular fractionations. We have studied the subcellular localization of neutral
-mannosidase by immunofluorescence microscopy and characterized the human recombinant enzyme with natural substrates to elucidate the biological function of this enzyme. Immunofluorescence microscopy showed neutral
-mannosidase to be absent from the ER, lysosomes, and autophagosomes, and being granularly distributed in the cytosol. In experiments with fluorescent recovery after photo bleaching, neutral
-mannosidase had slower than expected two-phased diffusion in the cytosol. This result together with the granular appearance in immunostaining suggests that portion of the neutral
-mannosidase pool is somehow complexed. The purified recombinant enzyme is a tetramer and has a neutral pH optimum for activity. It hydrolyzed Man9GlcNAc to Man5GlcNAc in the presence of Fe2+, Co2+, and Mn2+, and uniquely to neutral
-mannosidases from other organisms, the human enzyme was more activated by Fe2+ than Co2+. Without activating cations the main reaction product was Man8GlcNAc, and Cu2+ completely inhibited neutral
-mannosidase. Our findings from enzyme-substrate characterizations and subcellular localization studies support the suggested role for neutral
-mannosidase in hydrolysis of soluble cytosolic oligomannosides. Key words: cytosolic enzymes / free oligosaccharides / glycoside hydrolase family 38 / M2C1 / N-glycosylation
| Introduction |
|---|
|
|
|---|
Eukaryotic
-mannosidases are involved in metabolism of N-glycans. These enzymes participate in processing of N-glycans in the endoplasmic reticulum (ER) and Golgi, and catabolism in the lysosomes (Daniel et al. 1994
-mannosidases into two nonrelated families, glycoside hydrolase family (GH) 47 and 38 (Henrissat and Davies 1997
-mannosidases hydrolyze
-1,2 linkages and invert the conformation of the anomeric carbon, whereas GH 38 enzymes operate on
-1,2, -1,3, and -1,6 linkages retaining the conformation (McCarter and Withers 1994
-mannosidases. All of them are activated by metallic cations, inhibited by swainsonine, and they can hydrolyze an artificial substrate, p-nitrophenyl
-D-mannoside (PNP
-man). Mammalian GH 38 enzymes comprise membrane-bound Golgi II and IIx
-mannosidases (Misago et al. 1995
1,6 mannosidases (Daniel et al. 1994
-mannosidase MAN2C1, which is also known as neutral
-mannosidase (NAM) according to its neutral pH optimum (Daniel et al. 1994
-mannosidase, since the sequence information for the cloning came from the ER fraction isolated NAM (Bischoff et al. 1990
In vitro NAM purified from hen hydrolyzes soluble oligomannosides containing nine mannose residues and one N-acetylglucosamine residue (Man9GlcNAc) to free mannose and a specific Man5GlcNAc isomer M5B. (Figure 1) (Yamagishi et al. 2002
). Since Man5-9GlcNAc oligomannosides occur in the cytosol as part of the free oligosaccharide (OS) pool (Moore and Spiro 1994
; Kmiecik et al. 1995
; Iwai et al. 1999
; Ohashi et al. 1999
; Yanagida et al. 2006
), NAM is proposed to play a role in their metabolism (Haeuw et al. 1991
; Suzuki et al. 2006
). Free OS are suggested to originate through glycoprotein biosynthesis both from lipid-linked oligosaccharides and glycoproteins undergoing ER-associated protein degradation (ERAD) (Cacan and Verbert 2000
; Spiro 2004
). At an early stage of ERAD, deglycosylation by a peptide N-glycanase (PNGase) (Suzuki et al. 2002
) releases oligomannosides with two GlcNAc residues at their reducing end. The terminal GlcNAc is sequentially removed by cytosolic endo-N-acetyl glucosaminidase yielding Man9-6GlcNAc (Cacan et al. 1996
). A cytosolic
-mannosidase activity produces the Man5GlcNAc isomer M5B (Kmiecik et al. 1995
) that is transported and degraded in lysosomes (Saint-Pol et al. 1997
).
|
The physiological role of NAM has been investigated in human cancer cells. In these nasopharyngeal carcinoma cells, siRNA inhibition of NAM changed their properties to be less tumorigenic (Yue et al. 2004
-man and Man5GlcNAc (Suzuki et al. 2006
The hydrolysis pattern of the purified hNAM with its suggested natural substrate Man9GlcNAc is not known. In order to answer this question and others related to physiological role of this
-mannosidase, we have expressed an N-terminally Hisx6 tagged rhNAM in Pichia pastoris. This enables us to study hNAM on the protein level without contamination from the other cellular GH 38
-mannosidases. Since understanding of the physiology of NAM and its role in oligomannoside metabolism is hampered by ambiguous data concerning the subcellular localization of this enzyme, we have performed immunofluorescence localization studies on native NAM and heterologously expressed nontagged hNAM in Chinese Hamster Ovary (CHO-K1) cells with an antibody against rhNAM.
| Results |
|---|
|
|
|---|
Cloning, over-expression, and purification
We amplified the hNAM coding sequence from human fibroblast cDNA by PCR. The PCR product was a single band on 1% agarose gel, matching the expected length of the hNAM cDNA (3204 bp). For protein production, we prepared an expression construct containing 6xHis and tobacco etch virus protease (TEV) recognition sites in the N-terminus of hNAM and integrated this into the P. pastoris chromosome under inducible alcohol oxygenase (AOX) promoter. In a typical fermentation, the
-mannosidase activity in the cell lysate of this recombinant strain reached the maximum level after a methanol induction of 89 h and 830 mL.
Our purification protocol for rhNAM from P. pastoris cell lysates involved an ammonium sulfate fractionation followed by two cobalt chelating chromatography steps. We charged the affinity column with Co2+ because the atomic absorption spectrum of purified hen NAM suggests that the native enzyme contains cobalt (Yamashiro et al. 1997
). In the first Co2+chelating step, the His-tagged rhNAM bound to the column, but in the second step, following a successful TEV cleavage to remove the 6xHis-tag, rhNAM remained in the flow through fraction. Digestion with TEV removed 23 amino acids from histev-rhNAM, which could be observed on 6% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). If necessary, rhNAM could be further purified with gel filtration to remove aggregates, but in general we found the enzyme preparation pure and homogenous directly from the metal chelating chromatography (Figure 2B). The yield from purification was typically 3–8 mg/L of fermentation culture.
|
The apparent molecular weight for rhNAM monomer on 12% SDS-PAGE was 112 kDa (Figure 2B), but the hen enzyme has been suggested to be a tetramer in solution (Yamashiro et al. 1997
-mannosidase activity was 151.9 min giving a calculated molecular weight of 468 kDa and confirming that hNAM is indeed a tetramer in its native state.
Enzyme characterization with natural substrates
Substrate Specificity
Tissue isolated neutral
-mannosidase fractions from rat or hen catalyse the reaction from Man9–6GlcNAc to Man5GlcNAc and free mannose (Grard et al. 1994; Yamagishi et al. 2002
). The reducing end structure of the substrate is also significant: Japanese quail, hen, rat, mouse, and bovine NAMs recognize the number of GlcNAc residues and favor the structures with only one GlcNAc residue (Oku and Hase 1991
; Grard et al. 1996; Kumano et al. 1996
; Yamashiro et al. 1997
; Costanzi et al. 2006
).
In order to examine hydrolysis with the human enzyme, we incubated rhNAM with Man9GlcNAc in the presence of 1 mM Co2+ for 15 min, 30 min, 60 min, and 90 min. The hydrolysis patterns at these time points show that the relative amounts of Man8GlcNAc, Man7GlcNAc, and Man6GlcNAc were similar, but the amount of Man5GlcNAc increased and Man9GlcNAc decreased (Figure 3). A different oligomannoside profile was seen after 18 h incubation, when rhNAM fully hydrolyzed Man9GlcNAc to Man5GlcNAc and free mannose (Figure 4A). In addition to the large peak of Man5GlcNAc, peaks for Man4GlcNAc and Man6GlcNAc were present (Figure 4A).
|
|
The reaction with Man9GlcNAc2 had a different hydrolysis pattern compared to the reaction with a single GlcNAc substrate. After 18 h incubation, Man9GlcNAc2 still remained and the most abundant reaction product was Man8GlcNAc2 while Man5GlcNAc2 was missing (Figure 4A).
Metal Ions and Ethylenediaminetetraacetic Acid (EDTA)
The effect of other cationic metals than Co2+ for the activity of NAM has previously been only investigated with the artificial substrate PNP
-man (Weng and Spiro 1996
) or Man5GlcNAc (Kumano et al. 1996
; Yamashiro et al. 1997
). Since Man9GlcNAc has been suggested to be a major substrate of NAM, we analyzed the effect of the cationic metals for the reaction of rhNAM with Man9GlcNAc by incubating the purified enzyme with metal ions or EDTA before adding the substrate. Depending on the resulting oligomannoside composition, we divided the cations and EDTA into three different categories showing an activating, inhibiting or null effect to the hydrolytic activity of rhNAM.
This experiment showed that in addition to Co2+, also Fe2+ and Mn2+ activate rhNAM. When they were present, the composition of reaction products was similar to the 30 min reaction in Figure 3: Hydrolysis proceeded through the Man8GlcNAc isomers M8C and M8B (Figure 1) to Man5GlcNAc. When pretreated with Zn2+, Ca2+ or Mg2+, rhNAM removed one mannose residue from Man9GlcNAc leaving M8C as the major reaction product. Since the hydrolysis profile was similar after preincubation without metals or with EDTA, we classify Zn2+, Ca2+, and Mg2+ as the null effect metal ions. The inhibiting metal category contains only Cu2+, which completely blocked the hydrolysis of Man9GlcNAc.
Table I presents relative proportions of Man5GlcNAc and the Man8GlcNAc isomer M8C peak areas from the total peak area for each metal reaction and EDTA. In the activating group, the proportion of Man5GlcNAc is greater than M8C whereas in the null effect group, M8C dominates over Man5GlcNAc. The inhibitory metal ion Cu2+ also prevents hydrolysis of the first mannose residue.
|
Enzyme Characterization with the PNP-
-manpH Profile
We measured the rhNAM activity with Co2+ at different pH values of acetate, 2-morpholinoethanesulfonic acid (MES), and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffers covering a pH range 4.25–8.0. In order to exclude the possible effect of different ionic contents in the buffers due to the pH adjustment, we adjusted the ionic strength in all buffers to 20 mM with NaCl. Optimal pH for hNAM is between 6.25 and 6.75 (Figure 5), which is consistent with the previously reported values of 6.5 and 6.75 for hen and bovine NAM, respectively (Kumano et al. 1996
|
Effect of Metals
We tested the effect of cationic metals for rhNAM with PNP-
-man with the similar preincubation procedure as with Man9GlcNAc. This study confirmed that Fe2+ is an even stronger activator than Co2+ for the human enzyme: The relative hydrolysis rate of PNP-
-D-mannoside in the Fe2+ reaction was 23% higher than in the Co2+ reaction (Table II). Likewise, the division to the null effect and activating metals for Man9GlcNAc hydrolysis was applicable to PNP-
-man hydrolysis, since the activating class metals provided a faster reaction with the PNP-
-D-mannoside than the null effect metals (Table II). An exception was Zn2+, which had an equally activating effect in the PNP-
-D-mannoside reaction compared with the activating class metals. Cu2+ was an effective inhibitor blocking the hydrolysis of PNP
-man as well as Man9GlcNAc (Table II).
|
Intracellular localization
Since the reports concerning intracellular localization of NAM have been contradictory, we wanted to confirm localization by immunofluorescence confocal microscopy. An antibody against rhNAM (AbNAM) recognizes rhNAM in immunofluorescence conditions, which we demonstrated by transfecting CHO-K1 cells with pNAM-EGFP, a construct encoding hNAM with C-terminal enhanced green fluorescent protein tag, and staining the cells with AbNAM. Colocalization of these stains indicates that rhNAM reacts with the antibody (Figure 6A). Due to the high sequence homology between mammalian NAMs, the antibody also labels endogenous CHO-NAM, which is shown by the similar staining of rhNAM transfected and untransfected CHO-cells (Figure 6B and C). AbNAM does not cross-react with the other GH 38
-mannosidases as shown by the Rab7 cell line where the AbNAM staining is absent from the lysosomes (Figure 6E). Specificity of AbNAM was evident also in immunoprecipitation after a pulse-chase experiment when analyzed by the
-mannosidase activity measurement and on SDS-PAGE (data not shown).
|
To investigate the possible ER-localization of NAM, we expressed rhNAM transiently in the CHO-K1 cell line constitutively expressing an enhanced green fluorescent protein (EGFP)-kdel fusion protein as a marker for the ER. Superimposition of the AbNAM stain and the ER marker shows that the localization of these two proteins is clearly distinct (Figure 6B) with a Pearson coefficient of 0.21 and corresponding P value of 0%. Unexpectedly, NAM is not diffusely distributed in the cytosol as with EGFP, which fills the cytosolic space surrounding cellular organelles such as the ER in CHO-K1 (Figure 6D and supplementary data, Figure 1). Instead, the NAM staining pattern resembles granular bodies that are small, numerous, and evenly spread throughout the cytosol. Staining for endogenous CHO-K1 NAM has a similar cellular distribution (Figure 6C), confirming that the grainy pattern is not an artefact from the heterologous expression of rhNAM. This is evident also with AbNAM stained CHO cells expressing plain EGFP, which show granular staining for endogenous NAM and smooth for EGFP (Supplementary data, Figure 2).
In order to study the grainy appearance of NAM immunofluorescense, we investigated if NAM could be involved with membrane structures other than the ER. Since the NAM reaction product, cytosolic Man5GlcNAc is transported to the lysosomes (Saint-Pol et al. 1997
), NAM could be related to both the lysosomes and autophagosomes, which deliver their contents to lysosomes. In the experiments with CHO-K1, cells we found a lysosomal and late endosomal marker EGFP-Rab7 (Bucci et al. 2000
) and an autophagosomal marker cyan fluorescent protein (CFP)-LC3 (Kabeya et al. 2000
) localizing in their target organelles, but not colocalizing with AbNAM (Figure 6E and F), thus showing that NAM is absent from these membrane bodies.
Since we could not confirm the exact identity of the NAM granular bodies, we wanted to evaluate the dynamics of NAM protein in the CHO-K1 cytosol to indicate if it is indeed freely distributed. We performed a fluorescence recovery after photo-bleaching (FRAP) experiment using transiently transfected pNAM-EGFP and compared its recovery to similarly expressed EGFP. It is clear that the freely soluble EGFP marker recovers much faster than NAM-EGFP (Figure 7). The t1/2 for NAM-EGFP of 0.63 s compared to 0.19 s for freely diffusing EGFP demonstrates a 3.32-fold slower recovery. In contrast, the expected rate is only 2.74-fold according to the relationship of free cellular diffusion. This states that recovery rate is proportional to the cube root of molecular weight and is calculated given the theoretical M of EGFP to be 27 kDa and NAM-EGFP tetramer of 556 kDa. The discrepancy between expected and observed recovery rates suggest that the recovery of NAM is not entirely dictated by free diffusion, but in fact another mechanism is also involved in its dynamics. NAM's total percent mobility is also below that observed for EGFP 92% versus 97%. The remaining 8% can then be assumed to be constitutively associated to some relatively immobile structure. It can also be concluded that the recovery of NAM is happening by two separate mechanisms, one fast and one slow. Pure diffusion is almost certainly responsible for the fast component and it is likely that binding association rates are responsible for the second slower component of recovery. Full recovery of NAM can only occur as it is gradually released from this unknown structure at which point it is once again free to diffuse. This is apparent by the gradual logarithmic shape of NAM's recovery curve after roughly 1 s when all the freely distributed NAM in the cytosol has already randomly redistributed itself (Figure 7).
|
| Discussion |
|---|
|
|
|---|
One of the aims of this study was to produce an active rhNAM in larger scale for antibody production and enzyme-substrate analysis. The Hisx6 tag in rhNAM allowed us to minimize the purification steps and thus, avoid the previously reported problems with unstability (Bischoff and Kornfeld 1986
-mannosidase activity than hNAM with Hisx6 in the C-terminus or hNAM without tags.
Common disadvantages with heterologous expression are host-specific posttranslational modifications, especially N-glycosylation in yeasts. However, for N-glycosylation the protein needs to enter the ER, which is implausible in the context of heterologously expressed hNAM in P. pastoris. According to our SignalP (Bendtsen et al. 2004
) and WoLF PSORT (Horton et al. 2006
) analysis, hNAM does not possess an ER signal sequence. Thus it is highly probable that rhNAM expressed from pPIC3.5 construct was cytosolic in P. pastoris and avoided occupation in its four potential N-glycosylation sites. When we tested extracellular rhNAM expression with a Saccharomyces cerevisiae
-factor secretion signal, we did not detect
-mannosidase activity in the culture medium. Possibly, rhNAM did not survive targeting or the potent N-glycosylation sites in the NAM sequence got glycosylated disrupting native rhNAM structure.
Characterization of rhNAM with oligomannosides and PNP-
-D-mannoside served two purposes: Firstly, the hNAM as a purified protein lacked characterization with nine mannoside substrates. Secondly, we wanted to study the properties of the recombinant enzyme and compare it with previously reported tissue-purified NAMs from other organisms. The results presented here from Co2+ containing reactions with Man9GlcNAc and Man9GlcNAc2 are consistent with the published data on homologous enzymes, rhNAM is selective for the reducing end of the substrate like are bovine and Japanese quail NAMs. They hydrolyze substrates with one reducing end GlcNAc 15 times (bovine) and 40 times (Japanese quail) faster than substrates with two reducing end GlcNAc residues (Oku and Hase 1991
; Kumano et al. 1996
). With Man9GlcNAc, we noticed that the amount the product Man5GlcNAc increased as a function of time whereas the relative amount of the intermediates was stable, which has been showed also in the rat cytosolic fraction (Haeuw et al. 1991
) and purified rat NAM (Bischoff and Kornfeld 1986
).
With the activating cations, Co2+, Fe2+, and Mn2+, the reaction with rhNAM and Man9GlcNAc proceeded to Man5GlcNAc via both the isomeric forms M8C and M8B. On the contrary, EDTA treated rhNAM or reactions with Zn2+, Ca2+ or Mg2+ or without metal/EDTA yielded M8C as a main product and the peak profile did not change when the reactions were continued for longer time. Similar formation of specific M8 isomers has been reported with Co2+ and EDTA treated hen NAM (Yamagishi et al. 2002). The effect of Co2+ for hNAM has previously been studied using Man5GlcNAc as a substrate (Suzuki et al. 2006). With Co2+, both oxidizing end mannosides from the branched chain are released (Suzuki et al. 2006). Experiments with metals other than Co2+ have so far been reported only with PNP-
-D-mannoside and from our results, it is evident that the reaction with this artificial substrate does not reveal the difference between the weak activators and metals with the zero effect for Man9GlcNAc hydrolysis. Interestingly, we found that Fe2+ was a better activator for rhNAM than Co2+. One of the uniting features for GH 38 enzymes is the presence of metals in the enzyme structure: lysosomal
-mannosidase (Heikinheimo et al. 2003
) and Golgi II
-mannosidase (van den Elsen et al. 2001
) have Zn2+ in the three-dimensional structure, but tissue purified NAM contains Co2+ (Yamashiro et al. 1997
). As to which metal is present in vivo in hNAM needs further studies with the enzyme from human tissue. However, due to difficulties in obtaining the necessary tissues required for this analysis, we decided to abandon this approach.
Understanding of the subcellular localization of NAM is crucial for deciphering its physiological role. However, the data concerning localization of NAM inside the cell has been contradictory and therefore, one of the main interests in our study was to visualize the enzyme inside the cell by fluorescence microscopy. The data from these experiments shows that both endogenous NAM and rhNAM are missing from the ER in CHO-K1 that is constitutively expressing EGFP-kdel fusion protein as a marker for the ER.
Since appearance of NAM in immunofluorescense was grainy, we investigated if NAM might be in contact with cellular structures other than the ER. Connection to the lysosomes and autophagosomes we studied because the NAM reaction product Man5GlcNAc is transported from the cytosol to the lysosomes (Saint-Pol et al. 1997
). Another link between NAM, the lysosomes, and the autophagosomes is provided by yeast vacuolar
-mannosidase, which is the closest relative to NAM among the GH 38 family. This yeast enzyme is translated and multimerized in the cytosol, and transported via an autophagosomal route to the vacuoles (Yoshihisa and Anraku 1990
; Hutchins and Klionsky 2001
), the organelles corresponding the lysosomes. Nevertheless, neither of the markers for these organelles, rab7 for the lysosomes or LC3 for the autophagosomes, colocalizes with NAM. Thus, the detailed attachment of NAM still remains an open question. However, the FRAP experiments revealed a slower than expected two-phased NAM diffusion in the cytosol, showing that in living cells also, part of the NAM pool is not freely floating. In fact, NAM is most likely associated to some relatively immobile structures in the cytosol, which may well explain the granular pattern observed by immunofluorescence. Further speculation as to what this structure or complex could be is a matter for future investigation.
The results from hydrolysis experiments with NAM and oligomannosides support the localization of NAM in cytosol. As we have stated, rhNAM prefers substrates with one instead of two GlcNAc residues in the reducing end. This has been also reported with NAMs from other organisms (Oku Hase 1991; Grard et al. 1996
; Kumano et al. 1996
; Yamashiro et al. 1997
; Costanzi et al. 2006
) like it has been reported that the modifications which add the size of the reducing end decrease the hydrolysis rate (Kumano et al. 1996
; Oku and Hase 1991
; Yamashiro et al. 1997
). Thus, in order to prepare suitable substrates for NAM, N-glycans must be detached from a protein and the terminal GlcNAc removed. Consistent with cytosolic localization of NAM, both PNGase, which releases glycan from the protein, and endo-N-acetyl glucosaminidase, which removes GlcNAc are cytosolic (Cacan et al. 1996
; Suzuki et al. 2002
). Cytosolic localization provides strong evidence for the theory of NAM's role in free OS metabolism.
| Materials and methods |
|---|
|
|
|---|
Materials
Escherichia coli XL1 Blue (Stratagene, Santa Clara, CA) and TOP10F (Invitrogen, Carlsbad, CA) were used for plasmid propagation. rhNAM was produced in the P. pastoris strain GS115 (Invitrogen) in media recommended by the supplier (Invitrogen, Pichia Expression Kit, version1 and Pichia Fermentation Process Guidelines, version B). A construct for recombinant TEV (rTEV) was a gift from Gunther Stier. Plasmids for EGFP-Rab7 and CFP-LC3 originally from Cecilia Bucci and Tamotsu Yoshimori were donated by Eeva-Liisa Eskelinen.
Cloning of hNAM cDNA
cDNA for hNAM (GenBank Accession No. NM_006715) was cloned by PCR from a human fibroblast first-strand cDNA. Its preparation is reported elsewhere (Nilssen et al. 1997
). The hNAM cDNA was amplified with primers 5'ATGGCGGCTGCGCCGGCATTGAA3' and 5'ACTGATCCCTGCTTTAGGCTGGGGAAGCAGA3', and polymerase Dynazyme II (Finnzymes, Espoo, Finland) in a 20 µL reaction containing 0.4 mM deoxynucleotide (dNTP), 5% dimethylsulphoxide, 10 mM Tris-Cl, pH 8.8, 1.5 mM MgCl2, 50 mM KCl, and 0.1% Triton® X-100. Conditions for a 34-cycle PCR after initial denaturation at 95°C for 4 min were 95°C for 30 s, 66°C for 30 s, and 72°C for 3 min. The DNA from the two parallel reactions was subcloned into TOPO–pCR2.1 vector using a TOPO TA cloning kit (Invitrogen) and these pCR2.1–NAM constructs from two separate PCR reactions were sequenced and checked against the GenBank sequence. PCR-induced mutations were removed using a QuickChangeTM Site-Directed Mutagenesis kit (Stratagene) or by combining correctly amplified sequences using the native restriction sites in the hNAM cDNA.
Construction of vectors for P. pastoris expression
The hNAM sequence from pCR2.1-NAM was inserted in the EcoRI site of P. pastoris vector pPIC3.5 (pPIC3.5-hNAM). In addition, we attached six histidines and a TEV protease recognition site in the N-terminus of hNAM by cloning the hNAM sequence from pCR2.1-NAM in the EcoRI site of pPROExHTa (Invitrogen). The resulting plasmid was a template in a PCR amplification with primers 5'TAACCTCGAGTA- CGTAGCCACCATGGCATACTACCATCACCATCA 3', and 5'CATATCTAGAGGGACTTAGTGTGGCGGAGGCT-3', the former introducing SnaBI and Kozak sites. The PCR product was ligated as a SnaBI-BstEII fragment to pPIC3.5-hNAM, replacing the untagged 5' end of the construct. The resulting expression plasmid was sequence verified and it encoded histev-rhNAM with an eight amino acid spacer between the TEV recognition site and hNAM.
Expression in P. pastoris
Homologic recombination, recombinant clone screening, and testing of recombinant protein expression were performed as in the instructions for pPIC3.5 (Invitrogen), Pichia expression kit, version 1). The above described pPIC3.5 derived plasmids were isolated with a QIAprep® Spin Miniprep Kit (Qiagen, Hilden, Germany), linearized with SalI and electroporated into GS115 with a GenePulserTM (BioRad, Hercules, CA) using 1–2 µg of DNA. The resulting GS115/pPIC3.5-histev-rhNAM and GS115/pPIC3.5 transformants were recovered by adding 1 M sorbitol and selected on minimal medium plates without histidine. Chromosomal recombination was PCR verified from P. pastoris isolated genomic DNA, using primers for hNAM and the alcohol oxygenase promoter.
The verified GS115/pPIC3.5-histev-rhNAM and reference strain GS115/pPIC3.5 constructs were tested in bottle cultivations at 30°C. The cell mass was first grown with glycerol containing buffered yeast complex medium. After 18 h, the recombinant protein expression was induced by diluting the cultures to OD600 value of 1 in methanol containing buffered yeast complex medium. The induction was maintained for 72 h by adding methanol in every 24 h.
-Mannosidase activity was measured from cell lysates and the most active GS115/pPIC3.5-histev-rhNAM clone was selected for rhNAM production in a Sartorius Biostat B (Sartorius BBI Systems GmbH, Melsungen, Germany). A preculture for the fermentation was started from a colony of GS115/pPIC3.5-histev-rhNAM that was inoculated into 150 mL of glycerol containing buffered yeast complex medium and grown to an OD600 value of 3. Fermentation was initiated by adding this preculture into 2 L of basal salts medium with trace element solution and 4% glycerol. The fermentation temperature was adjusted to 29°C and pH to 5.5 with NH4OH, and the amount of dissolved oxygen (DO) was kept above 20%. In the glycerol and methanol feeding phases, the carbon source flow-rate was maintained as growth limiting and the metabolic state of the culture was monitored by the dissolved oxygen level. At the typical fermentation, the cell mass was grown to 110 g/L at the 23 h glycerol batch phase and at the following 8 h glycerol feed phase to 225 g/L with 195 mL of glycerol. Induction was carried on for 89 h with 830 mL of methanol, until the
-mannosidase activity reached a stable level and the cell mass was 300 g/L. The cells were harvested by centrifugation at 1600 x g for 30 min.
Purification of rhNAM
In a typical purification, 100 g of GS115/pPIC3.5-histev-rhNAM cells were mixed in 250 mL of 20 mM sodium phosphate buffer, pH 7.5 and lysed in two batches with BeadBeaterTM cell disruptor (BioSpec Products, Bartlesville, OK) containing 180 mL of 0.5 mm glass beads (Sartorius) BeadBeaterTM was operated by repeating four times the 1 min lysis and 2.5 min cooling. The lysate was centrifuged at 15300 x g for 60 min and 39200 x g for 25 min and brought to 42% ammonium sulfate saturation, and the precipitate was collected at 14300 x g for 30 min. The precipitate was dissolved in 100 mL of 20 mM sodium phosphate buffer, pH 7.5, clarified by centrifugation and loaded on a HiPrep 26/10 Desalting column, where proteins were eluted in buffer A, containing 20 mM sodium phosphate buffer, pH 7.5, 150 mM NaCl, and 5 mM imidazole. An Äkta-fast protein liquid chromatography (FPLC) system (GE Healthcare, Chalfont St. Giles, UK) was applied in all chromatography steps. The desalted protein fractions were loaded on a 5 mL HiTrap Chelating HP column charged with Co2+ ions and equilibrated with buffer A, and the his-tagged rhNAM was eluted with 250 mM imidazole. The fractions containing the
-mannosidase activity were combined and treated with 5 mg of rTEV for 20 h at 8°C in a solution containing 20% glycerol. After the digestion, the desalting with HiPrep 26/10 column and the Co2+chelating chromatography were performed with the same buffers as described earlier. The digested rhNAM was now collected from the flow-through fractions and the protein was concentrated and stored at –70°C with 50% glycerol. The purity of the protein was checked on the SDS-PAGE and by measuring the
-mannosidase activity with PNP
-man. For antibody preparation, rhNAM was further purified by gel filtration on a HiLoad 26/60 Superdex 200 column (GE Healthcare) with 20 mM MES, pH 6.5, 100 mM NaCl, and 2 mM DTT. Molecular weight of the purified rhNAM was determined by gel filtration on a HiLoad 26/60 Superdex 200 column using internal molecular weight markers albumin, aldolase, catalase, ferritin, and thyroglobulin (GE Healthcare).
-Mannosidase activity assay with PNP
-man
The protein sample was incubated at 37°C for 30 min in a reaction containing 100 mM MES (pH 6.5), 1 mM CoCl2, and 2 mM PNP
-man (Calbiochem, Darmstadt, Germany). The reaction was stopped with an equal volume of 13 mM glycine buffer at pH 10.7, containing 67 mM NaCl and 83 mM Na2CO3, and the amount of released PNP was measured at 410 nm.
The effect of cationic metals was tested in 500 µL final volume. The purified rhNAM was first incubated in 300 µL of 167 mM MES (pH 6.5) and 0.167 mM metal (CoCl2, FeSO4, ZnCl2, CaCl2, CuSO4, MnCl2, MgCl2) at 37°C for 15 min, PNP
-man was added to 2 mM concentration and the reaction was incubated 15 min before it was stopped as described above. The protocol for pH-dependency of NAM was similar, except that preincubation was done with 0.167 mM CoCl2 and reactions were performed in 20 mM acetate, MES or HEPES buffers, with ionic strength adjusted to 20 mM with NaCl.
-Mannosidase activity assay with oligomannoside substrates
Radiolabeled Man9GlcNAc2 was prepared from glycoproteins synthesized in wild type CHO cells after 1 h incubation with [2-3H]Man. The labeled oligomannosides released after PNGase digestion were separated by preparative HPLC separating the Man9GlcNAc2 from Man8GlcNAc2 (isomer B) and Glc1Man9GlcNAc2. Man9GlcNAc was prepared under the same conditions except that the labeled oligomannosides were released by endoglycosidase H.
The reaction products were analyzed by HPLC on an amino-derivatized Asahipak NH2P-50 column 250 mm x 4.6 mm; (Asahi, Kawasaki-ku, Japan) with a solvent gradient of acetonitrile/water from 70:30 (v/v) to 50:50 (v/v) at a flow rate of 1 mL/min for 90 min. Elution of the radiolabeled oligosaccharides was monitored by continuous-flow detection of the radioactivity with a Flo-one ß-detector (PerkinElmer, Waltham, MA). Oligomannosides were identified on the basis of their retention times compared with well-defined standards (Foulquier et al. 2004
).
Activity of rhNAM against natural substrates was assayed with radiolabeled Man9GlcNAc and Man9GlcNAc2. The reaction mixture containing 1 µg of rhNAM, 7 nM (20000 dpm) of radiolabeled oligomannosides, 20 mM Hepes, pH 7.2, 110 mM potassium acetate, 2 mM magnesium acetate, and 1.8 mM CoCl2 in 100 µL final volume was incubated at 37°C for 18 h and heated at 100°C for 5 min before oligomannoside analysis. The same reaction conditions were applied to analysis of hydrolysis profile of Man9GlcNAc in a function of time.
When the effect of cationic metals was studied, 0.2 µg NAM was preincubated at 37°C for 15 min in a 10 µL reaction mixture containing 100 mM MES (pH 6.5), and 0.2 mM metal (CoCl2, FeSO4, ZnCl2, CaCl2, CuSO4, MnCl2, MgCl2.) Next, this was combined to 10 µL of substrate mixture containing 20000 dpm of Man9GlcNAc in 100 mM MES, pH 6.5 and reaction was incubated at 37°C for 25 min before stopping it at 100°C for 5 min.
Intracellular localization and confocal microscopy
Plasmid constructs for expression in mammalian cells were designed as follows: The hNAM cDNA was digested from pCR2.1-NAM with EcoRI and ligated into mammalian expression vector pcDNA3.1(–) (Invitrogen). For subcloning into pEGFP-N1 (Clontech Laboratories, Palo Alto, CA) the hNAM cDNA was amplified by PCR with the primers 5'GGAATTCATGGCGGCTGCGCCGGCATTGAA3' and 5'TCCCCCCGGGCGTGTGGCGGAGGCTGAAGCACGA3' introducing EcoRI and XmaI sites to the 3' and 5' ends respectively. The EcoRI-NAM-XmaI PCR-fragment was inserted in pEGFP-N1 (pNAM-EGFP).
pEGFP-KDEL was constructed by first replacing the HRP gene from pHRP-KDEL with HindIII-EGFP-HindIII PCR-fragment and then amplifying and cloning SacII-ssEGFP-KDEL-NotI PCR-fragment into pEGFP-N1 backbone (Clontech).
Antiserum against native hNAM was generated by immunization of male Chinchilla rabbits with rhNAM expressed in P. pastoris and purified as described above. The immunization protocols were carried out according to standard methods (Tollersrud et al. 1997
).
Stable cell lines were prepared by transfection of CHO-K1 with Fugene 6 (Roche, IN) or CELLFECTIN® (Invitrogen) for 24 h, and then cultured in selection medium containing 500 µg/mL of G418. Positive clones were isolated after 2–4 weeks of selection culturing.
CHO-K1 cells stably expressing EGFP-kdel or EGFP-Rab7 were transfected with the plasmid constructs of interest using Invitrogen's CELLFECTIN®according to the standard protocol. Cells were cultured in media containing Dulbecco's Modified Eagle's Medium, 10% fetal bovine serum, 1% Non-essential amino acids, 1% L-glutamine, 1% HEPES, 50 µg/mL penicillin-streptomycin, and 100 µg/mL G418.
Protein synthesis was stopped 48 h posttransfection using 50 µg/mL cyclohexamide. Cells were fixed at room temperature in 4% PFA, 0.1 mM MgCl2, 0.1 mM CaCl2 for 15 min and quenched with 50 mM NH4Cl for 10 min before permeabilizing with 0.1% Triton-X 100 for 4 min. Antibody staining was achieved by 30 min incubations with primary rabbit antibody against native NAM in 1:500 dilution and secondary goat anti-rabbit Rhodamine RedTM-X 1:500 antibody and then mounted in polyvinyl alcohol (Fluka, Buchs SG, Switzerland). All solutions were prepared in PBS and blocking solution contained 0.5% BSA.
Confocal microscope Leica TCS SP2 AOBS was used to capture images of the cells according to the following parameters: lens 63x/1.4 Oil; excitation 458, 488, 561 nm; absorbance 496–550 nm, 570–640 nm; frame-averaging 4.
Deconvolution of the data relied on a manually collected point spread function (PSF) image showing the smallest resolvable distance for each wavelength of a 175 nm subresolution fluorescent beads using identical conditions. The voxel dimensions of the PSF were then altered to match that of the target image to be deconvolved. Iterative Deconvolve3D plugin (Dougherty 2005
) for ImageJ (Abramoff et al. 2004
) was used for calculation. Colocalization was performed according to the method of (Costes et al. 2004
).
FRAP experiments of live CHO-K1 cells transiently transfected with pNAM-EGFP plasmid were duplicated 10 times. Data was acquired using the same confocal microscope, setup as follows: 63x/1.2 water lens, excitation 488 nm at 2% power, line averaging 2, scanning speed 1400 Hz, dual bleaching step using 458, 476, 488, and 496 nm lasers at maximum power. Fluorescence intensity data was collected from 5 µ circles in the bleaching region (ib), control region (ic) and background region (br) at uniform timepoints (t). Intensity readings for pre and postbleach levels were determined by a mean of three timepoints. The data sets were then separately normalized to give relative intensity (ri) and percentage recovery as per the following formulae:
|
|
All ten data sets for each sample were then plotted on a scatter graph to give a best-fit curve with 95% confidence levels for half time recovery in seconds (t1/2) and percentage mobility.
Supplementary data for this article is available online at www.glycob.oxfordjournals.org.
| Funding |
|---|
|
|
|---|
National Graduate School in Informational and Structural Biology; Academy of Finland, NordForsk; Sigrid Jusélius Foundation; the Turku Systems Biology Research Program.
| Conflict of interest statement |
|---|
|
|
|---|
None declared.
| Acknowledgements |
|---|
We thank Gunther Stier from the EMBL for the rTEV clone and Eeva-Liisa Eskelinen for useful discussions and plasmids EGFP-Rab7 and CFP-LC3, which originally are from Cecilia Bucci and Tamotsu Yoshimori.
| Footnotes |
|---|
2 Present address: Department of Pathology, University Hospital of Northern Norway, 9038, Tromsø, Norway
| Abbreviations |
|---|
AbNAM, antibody against rhNAM; AOX, alcohol oxygenase; CFP, cyan fluorescent protein; CHO-K1, Chinese Hamster Ovary cell line; dNTP, deoxynucleotide; DO, dissolved oxygen; EDTA, ethylenediaminetetraacetic acid; EGFP, enhanced green fluorescent protein; ER, endoplasmic reticulum; ERAD, ER-associated protein degradation; FPLC, fast protein liquid chromatography; FRAP, fluorescence recovery after photo-bleaching; free OS, free oligosaccharides; GH, glycoside hydrolase family; GlcNAc, N-acetylglucosamine; hNAM, human NAM; HPLC, high performance liquid chromatography; Man, mannose; NAM, neutral
-mannosidase; PNGase, peptide N-glycanase; PNP
–man, p–nitrophenyl
–D–mannoside; PSF, point spread function; rhNAM, recombinant human NAM; rTEV, recombinant tobacco etch virus protease; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis. Abbreviations for oligomannosides are listed in Figure 1| References |
|---|
|
|
|---|
Abramoff MD, Magelhaes PJ, Ram SJ. Image Processing with ImageJ. Biophotonics Int (2004) 11:36–42.
Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol (2004) 340:783–795.[CrossRef][Web of Science][Medline]
Bischoff J, Kornfeld R. Evidence for an
-mannosidase in endoplasmic reticulum of rat liver. J Biol Chem (1983) 258:7907–7910.
Bischoff J, Kornfeld R. The soluble form of rat liver
-mannosidase is immunologically related to the endoplasmic reticulum membrane
-mannosidase. J Biol Chem (1986) 261:4758–4765.
Bischoff J, Moremen K, Lodish HF. Isolation, characterization, and expression of cDNA encoding a rat liver endoplasmic reticulum
-mannosidase. J Biol Chem (1990) 265:17110–17117.
Bucci C, Thomsen P, Nicoziani P, McCarthy J, van Deurs B. Rab7: A key to lysosome biogenesis. Mol Biol Cell (2000) 11:467–480.
Cacan R, Dengremont C, Labiau O, Kmiecik D, Mir AM, Verbert A. Occurrence of a cytosolic neutral chitobiase activity involved in oligomannoside degradation: a study with Madin-Darby bovine kidney (MDBK) cells. Biochem J (1996) 313(Pt 2):597–602.[Web of Science][Medline]
Cacan R, Verbert A. Transport of free and N-linked oligomannoside species across the rough endoplasmic reticulum membranes. Glycobiology (2000) 10:645–648.
Costanzi E, Balducci C, Cacan R, Duvet S, Orlacchio A, Beccari T. Cloning and expression of mouse cytosolic alpha-mannosidase (Man2c1). Biochim Biophys Acta (2006) 1760:1580–1586.[Medline]
Costes SV, Daelemans D, Cho EH, Dobbin Z, Pavlakis G, Lockett S. Automatic and quantitative measurement of protein-protein colocalization in live cells. Biophys J (2004) 86:3993–4003.[CrossRef][Web of Science][Medline]
Daniel PF, Winchester B, Warren CD. Mammalian
-mannosidases–multiple forms but a common purpose? Glycobiology (1994) 4:551–566.
Dougherty RP. Extensions of DAMAS and benefits and limitations of deconvolution in beamforming. AIAA Paper (2005) 2005–2961.
Foulquier F, Duvet S, Klein A, Mir AM, Chirat F, Cacan R. Endoplasmic reticulum-associated degradation of glycoproteins bearing Man5GlcNAc2 and Man9GlcNAc2 species in the MI8–5 CHO cell line. Eur J Biochem (2004) 271:398–404.[Web of Science][Medline]
Grard T, Herman V, Saint-Pol A, Kmiecik D, Labiau O, Mir AM, Alonso C, Verbert A, Cacan R, Michalski JC. Oligomannosides or oligosaccharide-lipids as potential substrates for rat liver cytosolic
-D-mannosidase. Biochem J (1996) 316(Pt 3):787–792.[Web of Science][Medline]
Grard T, Saint-Pol A, Haeuw JF, Alonso C, Wieruszeski JM, Strecker G, Michalski JC. Soluble forms of
-D-mannosidases from rat liver. Separation and characterization of two enzymic forms with different substrate specificities. Eur J Biochem (1994) 223:99–106.[Web of Science][Medline]
Haeuw JF, Strecker G, Wieruszeski JM, Montreuil J, Michalski JC. Substrate specificity of rat liver cytosolic
-D-mannosidase. Novel degradative pathway for oligomannosidic type glycans. Eur J Biochem (1991) 202:1257–1268.[Web of Science][Medline]
Heikinheimo P, Helland R, Leiros HK, Leiros I, Karlsen S, Evjen G, Ravelli R, Schoehn G, Ruigrok R, Tollersrud OK, McSweeney S, Hough E. The structure of bovine lysosomal
-mannosidase suggests a novel mechanism for low-pH activation. J Mol Biol (2003) 327:631–644.[CrossRef][Web of Science][Medline]
Henrissat B, Davies G. Structural and sequence-based classification of glycoside hydrolases. Curr Opin Struct Biol (1997) 7:637–644.[CrossRef][Web of Science][Medline]
Herscovics A. Importance of glycosidases in mammalian glycoprotein biosynthesis. Biochim Biophys Acta (1999) 1473:96–107.[Medline]
Horton P, Keun-Joon Park KJ, Obayashi T, Nakai K. Protein subcellular localization prediction with WoLF PSORT. In: Proceedings of the 4th Annual Asia Pacific Bioinformatics Conference APBC06 (2006) 39–48.
Hutchins MU, Klionsky DJ. Vacuolar localization of oligomeric
-mannosidase requires the cytoplasm to vacuole targeting and autophagy pathway components in Saccharomyces cerevisiae. J Biol Chem (2001) 276:20491–20498.
Iwai K, Mega T, Hase S. Detection of Man5GlcNAc and related free oligomannosides in the cytosol fraction of hen oviduct. J Biochem (1999) 125:70–74.
Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Kominami E, Ohsumi Y, Yoshimori T. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J (2000) 19:5720–5728.[CrossRef][Web of Science][Medline]
Kmiecik D, Herman V, Stroop CJ, Michalski JC, Mir AM, Labiau O, Verbert A, Cacan R. Catabolism of glycan moieties of lipid intermediates leads to a single Man5GlcNAc oligosaccharide isomer: a study with permeabilized CHO cells. Glycobiology (1995) 5:483–494.
Kollmann K, Mutenda KE, Balleininger M, Eckermann E, von Figura K, Schmidt B, Lubke T. Identification of novel lysosomal matrix proteins by proteome analysis. Proteomics (2005) 5:3966–3978.[CrossRef][Web of Science][Medline]
Kumano M, Omichi K, Hase S. Substrate specificity of bovine liver cytosolic neutral
-mannosidase activated by Co2+. J Biochem (1996) 119:991–997.
Li B, Wang ZZ, Ma FR, Shi GX, Zhang LX, Zeng X, Liu Y, Zhao FT, Zhu LP. Cloning, expression and characterization of a cDNA (6A8) encoding a novel human
-mannosidase. Eur J Biochem (2000) 267:7176–7183.[Web of Science][Medline]
McCarter JD, Withers SG. Mechanisms of enzymatic glycoside hydrolysis. Curr Opin Struct Biol (1994) 4:885–892.[CrossRef][Web of Science][Medline]
Misago M, Liao YF, Kudo S, Eto S, Mattei MG, Moremen KW, Fukuda MN. Molecular cloning and expression of cDNAs encoding human
-mannosidase II and a previously unrecognized
-mannosidase IIx isozyme. Proc Natl Acad Sci USA (1995) 92:11766–11770.
Moore SE, Spiro RG. Intracellular compartmentalization and degradation of free polymannose oligosaccharides released during glycoprotein biosynthesis. J Biol Chem (1994) 269:12715–12721.
Nilssen O, Berg T, Riise HM, Ramachandran U, Evjen G, Hansen GM, Malm D, Tranebjaerg L, Tollersrud OK.
-Mannosidosis: functional cloning of the lysosomal
-mannosidase cDNA and identification of a mutation in two affected siblings. Hum Mol Genet (1997) 6:717–726.
Ohashi S, Iwai K, Mega T, Hase S. Quantitation and isomeric structure analysis of free oligosaccharides present in the cytosol fraction of mouse liver: detection of a free disialobiantennary oligosaccharide and glucosylated oligomannosides. J Biochem (1999) 126:852–858.
Oku H, Hase S. Studies on the substrate specificity of neutral
-mannosidase purified from Japanese quail oviduct by using sugar chains from glycoproteins. J Biochem (1991) 110:982–989.
Saint-Pol A, Bauvy C, Codogno P, Moore SE. Transfer of free polymannose-type oligosaccharides from the cytosol to lysosomes in cultured human hepatocellular carcinoma HepG2 cells. J Cell Biol (1997) 136:45–59.
Shoup VA, Touster O. Purification and characterization of the
-D-mannosidase of rat liver cytosol. J Biol Chem (1976) 251:3845–3852.
Spiro RG. Role of N-linked polymannose oligosaccharides in targeting glycoproteins for endoplasmic reticulum-associated degradation. Cell Mol Life Sci (2004) 61:1025–1041.[CrossRef][Web of Science][Medline]
Suzuki T, Hara I, Nakano M, Shigeta M, Nakagawa T, Kondo A, Funakoshi Y, Taniguchi N. Man2C1, an
-mannosidase, is involved in the trimming of free oligosaccharides in the cytosol. Biochem J (2006) 400:33–41.[CrossRef][Web of Science][Medline]
Suzuki T, Park H, Lennarz WJ. Cytoplasmic peptide:N-glycanase (PNGase) in eukaryotic cells: occurrence, primary structure, and potential functions. FASEB J (2002) 16:635–641.
Tollersrud OK, Berg T, Healy P, Evjen G, Ramachandran U, Nilssen O. Purification of bovine lysosomal
-mannosidase, characterization of its gene and determination of two mutations that cause
-mannosidosis. Eur J Biochem (1997) 246:410–419.[Web of Science][Medline]
Van Den Elsen JM, Kuntz DA, Rose DR. Structure of Golgi
-mannosidase II: a target for inhibition of growth and metastasis of cancer cells. EMBO J (2001) 20:3008–3017.[CrossRef][Web of Science][Medline]
Weng S, Spiro RG. Endoplasmic reticulum kifunensine-resistant
-mannosidase is enzymatically and immunologically related to the cytosolic
-mannosidase. Arch Biochem Biophys (1996) 325:113–123.[CrossRef][Web of Science][Medline]
Yamagishi M, Ishimizu T, Natsuka S, Hase S. CoII-regulated substrate specificity of cytosolic
-mannosidase. J Biochem (2002) 132:253–256.
Yamashiro K, Itoh H, Yamagishi M, Natsuka S, Mega T, Hase S. Purification and characterization of neutral
-mannosidase from hen oviduct: studies on the activation mechanism of Co2+. J Biochem (1997) 122:1174–1181.
Yanagida K, Natsuka S, Hase S. Structural diversity of cytosolic free oligosaccharides in the human hepatoma cell line, HepG2. Glycobiology (2006) 16:294–304.
Yoshihisa T, Anraku Y. A novel pathway of import of
-mannosidase, a marker enzyme of vacuolar membrane, in Saccharomyces cerevisiae. J Biol Chem (1990) 265:22418–22425.
Yue W, Jin YL, Shi GX, Liu Y, Gao Y, Zhao FT, Zhu LP. Suppression of 6A8
-mannosidase gene expression reduced the potentiality of growth and metastasis of human nasopharyngeal carcinoma. Int J Cancer (2004) 108:189–195.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
Related articles in Glycobiology:
- Characterization and subcellular localization of human neutral class II
-mannosidase cytosolic enzymes/free oligosaccharides/glycosidehydrolase family 38/M2C1/N-glycosylation
Glycobiology 2008 18: 136.[Extract] [FREE Full Text]
This article has been cited by other articles:
![]() |
I. Chantret and S. E H Moore Free oligosaccharide regulation during mammalian protein N-glycosylation Glycobiology, March 1, 2008; 18(3): 210 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Puhka, H. Vihinen, M. Joensuu, and E. Jokitalo Endoplasmic reticulum remains continuous and undergoes sheet-to-tubule transformation during cell division in mammalian cells J. Cell Biol., December 3, 2007; 179(5): 895 - 909. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








