Glycobiology Advance Access originally published online on January 31, 2006
Glycobiology 2006 16(5):402-414; doi:10.1093/glycob/cwj086
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The Geodia cydonium galectin exhibits prototype and chimera-type characteristics and a unique sequence polymorphism within its carbohydrate recognition domain
2 Institute of Biochemistry II, Medical Faculty, University of Cologne, Joseph-Stelzmann-Str. 52, 50931 Köln, Germany; 3 Central Bioanalytics, Center for Molecular Medicine Cologne (CMMC), University of Cologne, Köln, Germany; 4 Institute of Medical Physics and Biophysics, University of Münster, Münster, Germany; 5 Applied Biosystems, Langen, Germany; 6 Bruker-Daltonic, Bremen, Germany; and 7 Intradisciplinary Center for Biopolymers, University of Potsdam, Potsdam, Germany
1 To whom correspondence should be addressed; e-mail: franz.hanisch{at}uni-koeln.de
Received on October 25, 2005; revised on January 24, 2006; accepted on January 28, 2006
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
The ancestral galectin from the sponge Geodia cydonium (GCG) is classified on a structural basis to the prototype subfamily, whereas its carbohydrate-binding specificity is related to that of the mammalian chimera-type galectin-3. This dual coordination reveals GCG as a potential precursor of the later evolved galectin subfamilies, which is reflected in the primary structure of the protein. This study provides evidence that GCG is the LECT1 gene product, while neither a previously described LECT2 gene nor a functional LECT2 gene product was found in the specimen under investigation. The electrophoretically separated protein isomers with apparent molecular masses of 13, 15, and 16 kDa correspond to variants of the LECT1 protein-exhibiting peptide sequence polymorphisms that concern critical positions of the carbohydrate recognition domain (13 kDa: Leu51, Asn55, His130, Gly137; 15 kDa: Ser51, Asn55, Asn130, Gly137; 16 kDa: Ser51, Tyr55, Asn130, Glu137). Four residues, highly conserved in the galectin family, are substituted. None of the residues claimed to be involved in interactions with GalNAc
1-3 moieties at an extended binding subsite of galectin-3 was identified in the corresponding positions of GCG. Apparently, the substitutions do not confer distinct binding characteristics to the GCG variants as evidenced by binding studies with a recombinantly expressed 15-kDa isoform. The natural isoforms as well as the recombinant 15-kDa isoform oligomerize by the formation of non-covalent heteromeric or homomeric complexes. A phosphorylation of the galectin was confirmed neither by mass spectrometry nor by alkaline phosphatase treatment combined with isoelectric focusing. Key words: galectins / mass spectrometry / polymorphism / sponge lectin
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
Within the family of ß-galactoside-binding lectins, the galectin from a Mediterranean sponge, Geodia cydonium, represents one of the earliest members described so far (Pfeifer et al., 1993
; Wagner-Hülsmann et al., 1996). The Geodia cydonium galectin (GCG) was proposed to fulfill an extracellular function by bridging cellular interactions of the aggregation factor (Wagner-Hülsmann et al., 1996). This ancestral galectin can be regarded as a precursor of later evolved galectins (Cooper and Barondes, 1999; Houzelstein et al., 2004), which are found in higher animals and were described to fulfill a series of intra- and extracellular functions (Cooper and Barondes, 1999; Ochieng et al., 2004; Patterson et al., 2004). While from a functional point of view the sponge galectin should exhibit a multifarious potential, its structural aspects indicate a close relationship to the prototype galectins as represented by galectin-1. However, unlike other members of this subfamily, the galectin from G. cydonium resembles chimera-type galectins (like mammalian galectin-3) with respect to its preferred binding to terminal blood group A-related saccharides on polylactosamine-type glycans (Sato and Hughes, 1992; Feizi et al., 1994; Hanisch et al., 1996). The relationship between the hamster and the sponge galectins is further founded by immunological cross-reactivities (Stalz, H. and Hanisch, F.-G., unpublished results) and by specific protein–protein interactions of the galectins with nuclear proteins, which are inhibited by the specific carbohydrate ligands (Seve et al., 1993; Hanisch et al., 1996). Proposed extracellular functions of galectin-3, like the modulation of cell–matrix interaction via binding to G domains of laminin (Feizi et al., 1994; Henrick et al., 1998; Ochieng et al., 1998), can be mimicked by the sponge galectin (Stalz, H., Vollmar, S., and Hanisch, F.-G., unpublished results). Similar observations were made with respect to intracellular ligands represented by GalNAc containing glycans on cytokeratins (Goletz et al., 1997).
Structural information on GCG is primarily based on two previous studies (Pfeifer et al., 1993; Wagner-Hülsmann et al., 1996). According to the published cDNA sequences, two galectin species, the LECT1 and LECT2 gene products, were postulated to exist in G. cydonium. The major expressed galectin species were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and were identified as proteins with apparent molecular masses of 15 kDa (LECT1), and 13 and 16 kDa (LECT2) (Pfeifer et al., 1993). The galectin isolated from the extracellular fluid of the sponge lacks a 50 amino acid–long peptide at the amino terminal (Wagner-Hülsmann et al., 1996).
Several open questions remain with regard to the galectin protein that were addressed in this study: (1) It has not been conclusively shown that two distinct galectin species are expressed in the sponge; (2) the relationship of the three GCG isoforms to each other and to the LECT1 and LECT2 genes is still unclear; (3) the primary structure deduced from cDNA sequence data has not yet been confirmed on the protein level; (4) in a functional context, it has not been elucidated whether the isoforms oligomerize in homomeric or heteromeric complexes and whether individual isoforms exhibit distinct binding specificities to glycan ligands; and (5) finally, potential modifications of the galectin protein, in particular O-phosphorylation, need to be identified, since binding activity of galectin-3 is modulated by phosphorylation (Mazurek et al., 2000).
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
Secretory GCG forms non-covalent heterooligomeric complexes
In accordance with previous reports, SDS–gel electrophoresis of GCG revealed a three-band pattern at apparent molecular masses of 13, 15, and 16 kDa under denaturating, reducing conditions (Hanisch et al., 1984
; Pfeifer et al., 1993). In the absence of a reducing agent and under non-denaturating conditions, a band pattern corresponding to mono-, di-, and tetramers of the lectin was obtained at 13–16, 30, and 60 kDa, respectively (Figure 1A, lane 1). Reanalysis of the 30-kDa dimer under denaturating, nonreducing conditions demonstrated that the three isoforms were associated non-covalently and dissociated into the subunits (Figure 1A, lane 2). The dimeric complex yielded the 13-, 15-, and 16-kDa isoforms indicating its heteromeric nature. The identity of the proteins in the 13- to 16-, 30-, and 60-kDa bands was confirmed by western blot analysis using polyclonal rabbit anti-GCG antiserum.
|
On matrix-assisted laser desorption ionization–mass spectrometry (MALDI-MS), each of the electrophoretically separated isoforms yielded a broadened signal in the mass range from 15,391 to 15,424 (data not shown). A similarly broadened molecular ion was obtained on analysis of the natural isoform mixture in the presence of 2-mercaptoethanol. Accordingly, no exact molecular masses could be assigned to the lectin isoforms. The oligomerization of isoforms was investigated by MALDI-MS under conditions optimized for the analysis of non-covalent interactions (Gruic-Sovulj et al., 1997; Strupat et al., 2000; Peter-Katalinic, 2005). In 2,6-dihydroxyacetophenone matrix, GCG complex formation was indicated by the molecular ions at m/z 30,780 ± 40 (dimer), 46,165 ± 50 (trimer), and 61,960 ± 105 (tetramer). Higher masses at approximately m/z 93 and 124 kDa indicated the formation of hexameric and octameric complexes (Figure 2A). Complexes with an even number of monomeric components were more prominent compared with trimeric and pentameric complexes. Complex formation was independent of calcium ions. Using 2,5-dihydroxybenzoic acid (DHB) as a matrix with increased denaturing capacities, the complexes decomposed preferentially to the subunit registered at m/z 15,380 Da (Figure 2B).
|
Intracellular isoforms of GCG proteins
Protein was extracted from sponge cells, and ß-galactoside-binding lectins were isolated by affinity chromatography. A western blot analysis of binding-active proteins using anti-GCG for detection revealed major bands at 
15, 30, 45, and 60 kDa. Hence, the major galactoside-binding proteins extractable from the sponge cells were apparently identical to the secretory GCG protein. However, a minor band was also detectable at 20 kDa (Figure 1B), which is in agreement with the calculated mass of a 190 amino acid precursor (MH 20,864 Da) postulated on the basis of a cDNA sequence (Wagner-Hülsmann et al., 1996). Attempts to identify proteolytic fragments corresponding to the N-terminal 50 amino acid sequence of the putative GCG precursor were unsuccessful due to the scarcity of the protein and comigrating proteins. However, the putative 5' terminal 150 bp extension was located upstream of the GCG gene in genomic DNA of the sponge separated by a 450 bp intron sequence (Figure 1C).
Sequence analysis of secretory galectin protein
The primary structure of secretory GCG protein was analyzed by mass spectrometric identification and sequencing of proteolytic fragments. The peptide fingerprints obtained by tryptic digestion are summarized in Table I. The following were found from the assignments of pseudomolecular ions MH+ and calculated peptide masses: (1) They revealed a complete cleavage of the 140 amino acid protein into a consistent series of fragments that could be linearly aligned (Table I), except for dipeptides Thr84-Arg85 and Val120-Arg121 with masses below 500 mass units. (2) For several of the proteolytic fragments amino acid replacements within the peptides are indicated by incremental mass shifts (peptides 49–83, 96–119, and 127–140). (3) No indication for the occurrence of posttranslational modifications by phosphorylation, sulfation, or glycosylation was found in the MALDI-MS spectra (refer to GCG isoforms are not modified by phosphorylation). (4) No fragment ions were registered, which would match the proposed amino acid sequence of the LECT2 gene product.
|
Referring to the published LECT1 sequence (Pfeifer et al., 1993), five amino acid replacements were identified (Table II): (1) Ser51 to Leu in peptide 49–83 (MH 3812.9 Da), (2) Tyr55 to Asn in peptide 49–83 (MH 3786.9 Da), (3) His112 to Arg in peptide 96–119 (MH 2762.4 Da), (4) His130 to Asn in peptide 127–140 (MH 1448.8 Da), and (5) Gly137 to Glu in peptide 127–140 (MNa 1543.8 Da). Peptides and their molecular masses, which support the above-specified sequence variations, were sequenced by postsource decay (PSD)-MALDI-MS or electrospray ionization (ESI)-MS/MS and underlined in Table III. Fragmentation at Leu30 (MH at m/z 1997.0 Da) results from nonspecific cleavage by trypsin, which is known to possess chymotryptic activity and to hydrolyze at Phe, Tyr, Trp, and Leu. However, the tryptic fragment 7–30 was not detectable.
|
|
To assign the above-specified sequence variations to the three protein isoforms of GCG, the 13-, 15-, and 16-kDa species were separated by preparative SDS–PAGE and analyzed by MALDI-MS. On the basis of the mass spectra obtained for the tryptic digests (Figure 3), the following assignments could be made (Table II): (1) All three isoforms exhibit the replacement His112 to Arg (deviating from the LECT1-derived amino acid sequence reported in Pfeifer et al. (1993)). (2) The Ser51 to Leu replacement can be unequivocally assigned to the 13-kDa species (Table II). (3) The Tyr55 to Asn replacement (refer to the PSD mass spectrum in Figure 4) is found in both, the 13- and 15-kDa species. (4) The substitution His130 to Asn was assigned to the 15- and 16-kDa species, while (5) the Gly137 to Glu replacement is restricted to the 16-kDa species.
|
|
y29 and
Sequence information deduced from PSD-MALDI-MS (Table III) was corroborated by Edman degradation of selected, high-pressure liquid chromatography (HPLC)-purified peptides. Three internal tryptic peptides could be assigned to the peptides 49–61, 86–94, and 127–139. Two replacements were identified at Tyr55 (to Asn) and Gly137 (to Glu) (data not shown).
Comparison of the protein sequence of GCG to the primary structures of hamster galectin-1 and -3
The amino acid sequences of the three GCG isoforms were aligned to those of the galectin-1 and galectin-3 from hamster (Figure 5). The sponge galectin showed striking homology to both hamster galectins, in particular, the sequence motifs between positions 44–48 and 75–77, and the single positions 5, 23, 25, 33, 57, 59, 66, 69, 112, and 127 were identical. (The N-terminal position 1 of secretory GCG corresponds to position 110 of hamster galectin-3.) The numbers of positions showing identity with one of the hamster galectins suggest that the degree of similarity between the sponge galectin and the mammalian galectin-1 or galectin-3 is equally high. Strikingly, four of 15 positions, which are conserved in galectin carbohydrate recognition domains (CRDs) from species throughout the animal kingdom, are mutated in all three isoforms of GCG (refer to positions 22, 67, 71, and 80 in Figure 5). A high degree of sequence variation relative to both mammalian galectins is found in the region between positions 49–56 and 78–85, and in the C-terminal part of the protein between positions 105 and 132. Two of the sequence variations identified in this study (Leu51, Asn55) are located within the highly variable turn, which links the ß-strands S4 and S5.
|
Sequence analysis of the GCG gene from genomic DNA
To confirm evidence obtained on the protein level by sequencing of the gene, genomic DNA from G. cydonium was isolated for the purpose of gene cloning. Two quiet mutations were found on sequencing (Table II), which deviate from the published sequence for LECT1 (Pfeifer et al., 1993): position nt 99 (T to C) coding for Asn33 and position nt 351 (C to T) coding for Tyr117. Additionally, we identified a replacement of G for A at position nt 335 (CGT coding for Arg112 replaces CAT coding for His112). These data confirmed the findings from Edman and MALDI-MS sequencing, which both revealed independent evidence for Arg (100%) in that position.
Within the CRD, two signals were registered at nt 163, either encoding Asn (AAC) or Tyr (TAC) at amino acid position 55. Both amino acids were indicated by MH ions in the tryptic peptide maps (Table I and Table II). A further partial replacement was identified at position nt 388 (C to A), altering the amino acid sequence from His130 to Asn130. The corresponding MH ions were both found in MALDI-MS (Table II).
Using specifically designed primers for the amplification of the LECT2 gene (sense primer nt-24 to -3 and antisense primer nt 418–442), no PCR product was detectable. Since the primer sequences were designed according to stretches of cDNA flanking the putative LECT2 gene, it can be concluded that the gDNA from the sponge under investigation does not contain the alternative galectin gene.
GCG isoforms are not modified by phosphorylation
GCG peptide fractions enriched for phosphorylated species by metal chelate affinity chromatography were analyzed by nanoLC coupled online with electrospray mass spectrometry. By negative ion registration in the parent-ion-scanning mode at m/z 97 (corresponding to precursors, which undergo a loss of phosphate groups), no phosphorylated peptide species were reproducibly detected. If present, phosphorylation of GCG may occur at levels that are below the detection limits of the mass spectrometric approach. Since a modification of GCG by negatively charged groups was indicated in 2D gel electrophoresis (Figure 6A) by intensely stained protein spots below and at pH 5.0 (nominal pI of unmodified protein: 5.5–5.7), we analyzed the protein isoforms by isoelectric focusing prior to and after alkaline phosphatase treatment. As shown in Figure 6B, no evidence for the presence of phosphorylated GCG isoforms was revealed. In particular, the protein spots with pI below and at pH 5.0 were not shifted to higher pI values. The 13-kDa protein spot at pH 6.0 (Figure 6A), which was slightly above the nominal pI of this isoform, was identified via peptide mass fingerprinting as a GCG isoform. A likely explanation for the multiple isoelectric forms can be seen in artificial spot formation caused by differential ampholine binding of partially unfolded protein, an observation made by researchers in 2D-based proteomics (H. Meyer, University of Bochum, Germany, personal communication).
|
Binding characteristics of a recombinantly expressed 15-kDa isoform
Sequencing of the PCR-amplified LECT1 gene from gDNA (423 bp) revealed the expected sequence variations in positions nt 99, 163, 335, 364, and 388, characterizing the 15-kDa isoform. The gene was ligated into the expression vector pGEX-4T-1 and cloned in competent BL-21 E. coli. The expressed fusion protein was cleaved with thrombin to release the 15-kDa GCG isoform. As revealed for the natural galectin, the recombinant GCG isoform oligomerized spontaneously to dimeric and tetrameric complexes (data not shown). The binding affinities to carbohydrates of the recombinant galectin were analyzed in enzyme immunoassays on neoglycoproteins. The measured profiles were indistinguishable from those previously obtained in binding studies with the natural galectin (Hanisch et al., 1996) by showing preferential binding of GCG to glycans with the terminal structure GalNAc1-3Gal(NAc)ß as found on Forssman disaccharide and blood group A antigen (Figure 7).
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
A previous study had identified two subclasses of CRDs in galectins, which were characterized by their binding specificities and distinct amino acid residues in critical positions (Ahmed and Vasta, 1994
). In "type II CRDs" as in galectin-3, substitutions or deletions at positions 161 and 162 were claimed to be responsible for the ability of these CRDs to accommodate more bulky nonreducing sugar moieties. Additional sugar-binding amino acid residues, Arg139 and Ile141 in galectin-3, were identified in a later study to interact with terminal GalNAc1-3 moieties (Henrick et al., 1998). In particular, Arg139 was demonstrated to be involved in a putative extended carbohydrate-binding subsite conferring a galectin-3-like specificity. It is assumed that the size of the extended groove can accommodate a tetrasaccharide. Correspondingly, four subsites A–D were defined, where C is the ß-Gal binding site and subsite B is the -GalNAc binding site (Leffler et al., 2004). Arg139 and Ile141 in galectin-3 correspond to Ala29 and Ser31 in GCG, respectively, indicating that the galectin-3-like binding specificity of GCG may have an alternative structural basis (Figure 8). A further characteristic amino acid residue in galectin-3, Ser232, is not found in the corresponding GCG position (Lys126) adjacent to the highly conserved Gly127 (Gly233 in the hamster galectin-3 sequence) (Figure 8).
|
The previously published nucleotide sequences of two genes (LECT1, LECT2) from the marine sponge G. cydonium had revealed that they code for galectins. In particular, the deduced DXAXHFNPR(Y) peptide motif, which is highly conserved in all galectin species, was identified within the CRD of the sponge lectin. As revealed by sequencing of the protein in this study, of the 15 amino acid residues within the CRD domain, which show strict conservation throughout the galectin species (Henrick et al., 1998), one is deleted and three are replaced in the deduced LECT1 gene product (the galectin-3 positions Gly131, Gly177, Arg181, and Gly190 correspond to the GCG positions 22 [deleted], Gln67, His71, and Asn80). In the central part of the domain, which is responsible for carbohydrate binding, two nonconservative and one conservative replacement were detected in the motifs WGXEXR (WQXEXH in GCG) and FPFXXG (FPFXXN in GCG). One of these replacements concerns residue Arg71 (substituted by His), which is directly involved in the binding of carbohydrate. Judging on the basis of DNA-derived sequences, the LECT1 gene product exhibits striking deviations from the known galectins of higher organisms. On the level of the expressed protein, three isoforms of the published LECT1 DNA sequence were identified in this study. Alignments based on the corrected sequences of GCG (LECT1) allow the conclusion that the CRD of the sponge lectin exhibits homology to both, the chimera-type galectins (like galectin-3 from hamster) and the prototype galectins (like galectin-1 from hamster). Similarity searches based on corrected isoform sequences revealed only one pre-galectin from another diploblastic animal, Suberites domuncula, as related to GCG but at low homology scores.
Mass spectrometric peptide mapping in the femtomol range and sequencing of proteolytic fragments from affinity-isolated (binding active) sponge galectin did not reveal evidence for the occurrence of a functional LECT2 gene product in the specimen under study. In conclusion, the three protein bands separated by SDS–PAGE represent isoforms of the LECT1 gene (Pfeifer et al., 1993). The sequence identity with the published LECT1 gene (refer to galec3 in Swiss-Prot/TrEMBL from December 19, 2001 or to GCLT1 in Swiss-Prot/TrEMBL from January 5, 1998) ranges for all three isoforms at 98%.
Although the isoforms are largely identical and cannot be discriminated by MALDI-MS, they differ in apparent molecular masses in SDS–PAGE. This phenomenon can be partly explained by the sequence polymorphisms, since nonconservative substitution of amino acids should affect SDS load and electrophoretic mobility of small proteins in gels. The GCG isoforms with different apparent molecular masses display further heterogeneity by separating into several isoelectric variants in 2D gel electrophoresis. We could demonstrate that this heterogeneity is not caused by phosphorylation of the protein. Although the protein exhibits a series of potential phosphorylation sites, the N-terminal target sequence involved in the activation of galectin-3 (Mazurek et al., 2000) is absent in GCG.
The separation of isoelectric forms may represent an artifact, which could arise from differential uptake of ampholine by the partially unfolded protein.
The fact that GCG protein can be isolated in large amounts from the extracellular fluid of the sponge points to an efficient secretory process. Galectins regularly do not follow the classical secretory pathway via the ER and Golgi compartments, but alternative mechanisms were described (Hughes, 1999; Nickel, 2003). The 20-kDa isoform of GCG detected in the sponge by western blot analysis cells may correspond to the previously described 570 bp cDNA and indicate that secretion of the 13- to 16-kDa isoforms requires cleavage of a 50 amino acid peptide located at the N-terminus.
To enable functional studies on GCG, the 15-kDa isoform was recombinantly expressed in Escherichia coli. The pure isoform of the lectin was able to oligomerize to the di- and tetrameric complexes in the same way as the natural mixture of isoforms. No distinct glycan specificity of the recombinant 15-kDa isoform could be revealed in comparative binding studies with the natural isoforms. These findings indicate a close functional relationship between the GCG isoforms described in this study.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
Galectin isolation
The siliceous sponge G. cydonium was collected near Rovinj (Mediterranean Sea). A crude extract was kindly provided by Prof. W.E.G. Müller, University of Mainz, Germany. It was prepared by stirring sponge tissue from several different colonies in Ca2+- and Mg2+-free artificial seawater followed by centrifugation at 10,000 g as described previously (Vaith et al., 1979
). The lectin was purified by affinity chromatography on immobilized lactose conjugated via divinyl sulfone to an agarose matrix (Medac, Hamburg, Germany) (Hanisch et al., 1984). The isolated lectin was aliquoted in phosphate buffered saline (PBS) (5.5 mg Lowry protein/ml).
Analytical and semi-preparative SDS–PAGE
The samples were analyzed in 12.5 or 15% polyacrylamide slab gels with Laemmli buffer system. The protein was dissolved in sample buffer containing 1% SDS (w/v) with or without 1% 2-mercaptoethanol in Tris-buffer and was loaded on a 4% stacking gel. Electrophoresis was performed either in a Bio-Rad Model 220 apparatus at 35 mA/gel for preparative purpose or in a Bio-Rad Mini-PROTEAN II electrophoresis cell at 200 V for analytical purpose. Proteins were either stained with Coomassie Blue or with silver. The Coomassie-stained protein bands were excised, electro-eluted overnight in electrophoresis buffer at 8 mA/tube with a Bio-Rad Model 422 system, and precipitated with methanol/chloroform. After drying in a gentle stream of nitrogen, the protein was solubilized in PBS.
Western blot analysis
For identification of the intracellular 20-kDa isoform, sponge tissue was stirred in Ca2+- and Mg2+-free artificial seawater to wash off secreted protein, and the cells were extracted after homogenization in PBS by stirring overnight at 4°C. The lectin was purified by affinity chromatography on Galß1-3GalNAc immobilized to silicate via polyacrylamide spacer (Syntesome, Munich, Germany). After SDS–PAGE, the protein was semidry blotted in Towbin buffer without SDS and methanol onto nitrocellulose membrane Protan BA 83 (Schleicher & Schuell, Dassel, Germany). The protein was detected with a polyclonal rabbit anti-GCG primary antibody (Eurogentec, Herstal, Belgium) and secondary HRP-bound anti-rabbit-Ig swine antibody (DAKO, Glostrup, Denmark).
Phosphatase treatment
Ten micrograms of GCG or 10 µg ß-casein was mixed with 0.1 units alkaline phosphatase from calf intestine (Fluka, Germany), adjusted to 10 µl with 10 mM NH4HCO3 and incubated at 37°C for 45 min. Controls were treated the same way, but phosphatase was substituted by 10 mM NH4HCO3. The reaction was stopped by diluting the mixture with an appropriate volume of denaturating rehydration buffer (see next paragraph).
One-dimensional isoelectric focusing and two-dimensional gel electrophoresis
To check the presence of phosphorylation sites in GCG, aliquots of 4 µg, either phosphatase treated or untreated, were diluted with rehydration buffer (8 M urea, 2% (w/v) 3-(cyclohexylamino)-1-propanesulfonic acid (CHAPS), 20 mM dithiotreitol (DTT), 0.5% immobilines pH 3–5.6 nonlinear, and a trace of Bromophenole Blue) to 350 µl plus 1.5 µl of pI-marker (gift from Karel Slais, Institute of Analytical Chemistry, Czech Republic) and applied to isoelectric focusing (IEF) strips (pH 3–5.6 nonlinear, 18 cm) via the rehydration technique described by Görg et al. (2004). Strips were then rehydrated for 12 h at 50 V and were focused on the IPGphor system (Amersham Biosciences, Freiburg, Germany) with a current limit of 50 µA per strip at 20°C with the following program: 1 h at 200 V, 1 h at 500 V, 1 h at 1000 V, gradient to 8000 V in 2 h and a final focusing step at 8000 V for 36,000 V h. Subsequently, the strips were fixed and stained with Coomassie R-250 according to standard protocols, and band patterns were documented by scanning the strips on Umax flatbed scanner Power Look III. For 2D gel electrophoresis, the strips were briefly rinsed in aqua dest after the IEF program (IEF strips pH 3–10, nonlinear, 18 cm) was completed, and then prepared for the second dimension by a two-step equilibration process providing cysteine alkylation of the focused proteins at the same time: For that, the strips were incubated two times in equilibration buffer (Tris–HCl 50 mM, pH 8.8; 6 M urea; 30% [v/v] glycerol, and a trace of Bromophenol Blue) for 12 min, to which 1% (w/v) DTT (step one) or 4% (w/v) iodoacetamide (step two) was added, respectively. Subsequently, the strips were loaded on SDS gels (15% acrylamide). Electrophoresis was carried out on a Hoefer SE 600 system at 20°C, for which the current was limited to 25 mA per gel. The gels were fixed and stained with Coomassie according to standard protocols.
Enzymatic digestion of GCG
Prior to proteolytic digestion, the heat-denaturated protein or the electro-eluted single gel bands were equilibrated with digestion buffer on a NAP-5 column (Amersham Biosciences). The digestion buffer was 50 mM NH4HCO3, with or without 1 mM CaCl2, pH 7.8, according to the later-applied protease. Tryptic digestions were performed with Sequencing Grade Modified Trypsin (EC 3.4.21.4
[EC]
) (Promega, Madison, WI). The protease:protein ratio was usually between 1:50 and 1:100 (w/w), and incubation was done overnight at 37°C in digestion buffer with 1 mM CaCl2. Cleavage at Glu-C was achieved with V-8 protease from Staphylococcus aureus (EC 3.4.21.19
[EC]
; endoproteinase Glu-C) (Sigma-Aldrich, Steinheim, Germany). The enzyme was used in an enzyme:substrate ratio of 1:50 (w/w), and the reaction mixture was incubated for 12 h at 37°C in digestion buffer without CaCl2. In case of the pI 6.0 component contained in the 13-kDa band of GCG, automatic spot picking from 2D gels and in-gel digestion with trypsin were performed (ProteineerSP and ProteineerDP, Bruker-Daltonic, Bremen, Germany). For identification of the protein, peptide mass fingerprints were measured by MALDI-MS and were compared with the peptide mass lists generated for GCG.
Matrix-assisted laser desorption ionization-mass spectrometry
The freeze-dried proteolytic fragments were resuspended in 60% acetonitrile, 0.1% TFA, and 1 µl of the mixture was spotted onto a MALDI-sample target. A saturated solution of -cyano-4-hydroxycinnamic acid was used as the matrix for crystallization. The analyses were performed on a Bruker Reflex mass spectrometer (Bruker, Bremen, Germany), and spectra were recorded in the positive ion mode, using a pulsed UV laser beam (nitrogen laser, 
= 337 nm) and an acceleration voltage of 20 kV. The reflector voltage was set to 22.5 kV. Post-Source-Decay fragment spectra were recorded in 14 steps by stepwise reduction of the reflector voltage starting at 30 kV to a final voltage of 0.95 kV and an acceleration voltage of 26.3 kV. Precursor ions were isolated by applying time-dependent beam blanking.
Electrospray ionization mass spectrometry
Tryptic digests of GCG and subfractions obtained after immobilized metal chelate affinity chromatography on Fe3+-loaded ZipTipMC (Millipore) were analyzed LC-ESI-MS/MS. The precursor ion analysis was carried out on a Hybrid Instrument Qstar Pulsar (Applied Biosystems, Darmstadt, Germany) using online injection into the ion source via nanoflow HPLC. The Ultimate LC (LC-Packings/Dionex, USA) was equipped with a RP C18 PepMap column of 75 µm ID. The gradient was run from A to B during 45 min (A: 95% of formic acid in water [0.1%], 5% acetonitril; B: 10% of formic acid in water [0.1%], 90% acetonitril). For identification of the parent ions related to the phosphate substitution, negative ion mode detection was used. The precursor ion was m/z 97 at the capillary voltage of 950 V. For MS to MS/MS switching, information-dependent acquisition (IDA) was applied.
HPLC purification of peptides and Edman sequencing
The tryptic fragments were purified on a SunChrom-HPLC (SunChrom, Friedrichsdorf, Germany) with microhead-pumps at a flow rate of 0.25 ml/min. The separation was performed on a ProC18-RP-column, 2 mm x 250 mm (YMC, Schermbeck, Germany) in an acetonitrile-0.1% TFA-gradient from 5 to 60% in 50 min. Edman sequencing was performed on an ABI 473A (Applied Biosystems) with microcartridge. The first six amino acids of the N-terminus were identified after SDS–PAGE and blotting of the protein onto a Bio-Rad Sequi-Blot PVDF membrane.
Isolation of genomic DNA from G. cydonium and sequencing of PCR amplified GCG isoforms
The sponge specimen was collected from several different colonies in the Mediterranean Sea near Rovinj (Croatia). Genomic DNA of the sponge was isolated with the QIAGEN Blood & Cell Culture DNA Kit (QIAGEN, Hilden, Germany). Due to the binding of genomic DNA to the siliceous skeleton, the standard protocol was changed as follows: After grinding 150 mg of frozen sponge tissue with a mortar, the material was incubated with dilute NaOH solution at pH 8.5. The suspension was centrifuged and the pellet discarded. The neutralized solution was then applied to the kit. The genomic DNA was directly used as a template in a PCR experiment using the 5'–3' sense primer: 5'-GTT TTCGGTGATCTAAAACTGACTGT TCC-3', Tm: 64°C (MWG, Ebersberg, Germany) and the 3'-5'antisense primer: 5'-TTAGTATGTGACTCCGATCGC CTC C-3', Tm: 64°C (MWG). For PCR amplification of the putative LECT2 gene, specifically designed primers were used: 5'-3' sense primer 5'-CAATACAACTCAGCGTCTGCTC-3' (Tm: 66°C) and the 3'-5' antisense primer 5'-CTCCTTATGTCT CTTTTCAAAGTTA-3' (Tm: 66°C). The sense primer for the amplification of the 5' terminal 150 bp extension of the GCG gene (Wagner-Hülsmann et al., 1996) was 5'-ATGC TGGTGTTGACCATCGTTGCT-3' (Tm: 64°C). The PCR products were sequenced on an ABI Prism 377 DNA sequencer (Applied Biosystems, Langen, Germany) with the Taq FS BigDye-terminator cycle sequencing method.
Cloning and expression of a recombinant 15-kDa GCG isoform
Genomic DNA of the sponge was extracted as above after homogenization of frozen tissue (liquid nitrogen) with a mortar. Isolated gDNA was run in a 0.4% agarose gel and was amplified by PCR according to a protocol in the Expand High Fidelity PCR System (Roche, Mannheim, Germany). About 30 ng of gDNA was used with the same sense and antisense primers described above. The PCR product was isolated by electrophoresis in 1.2% agarose using the QIAEX II gel extraction kit (QIAGEN), and was sequenced as above. Prior to ligation, the pGEX-vector 4T-1 was digested in One-Phor-All (OPA) buffer (Amersham-Pharmacia) with the restriction endonucleases EcoR1 and Sal1 (NEB, Beverley, MA, USA) according to the manufacturer’s instructions, and the linearized vector was dephosphorylated with alkaline phosphatase (calf stomach, 30 min, 37°C). After heat inactivation of the enzyme and extraction of the vector DNA with phenol–chloroform–isoamyl alcohol, the ligation of amplified GCG-DNA was performed in OPA buffer with T4 DNA ligase (1–2 units, 16 h, 4°C). The plasmid (1–2 ng) was cloned into competent BL-21 E. coli, which were subsequently plated onto LB-Ampicillin-Glucose agarose. Colonies were picked, grown in 2x YTA medium, and protein expression was induced with 1 mM isopropyl ß-thiogalactoside for 3–4 h at 30°C.
Isolation of a recombinant 15-kDa GCG isoform and binding studies on neoglycoproteins
After cell lysis with lysozyme (1 mg/ml, 20 min) and sonication, the fusion protein was extracted with 20% Triton X-100 (Fluka, Buchs, Switzerland) in PBS (30 min, 4°C). The supernatant after centrifugation was run over a glutathion-Sepharose 4B column (Amersham-Pharmacia) according to the manufacturer’s instructions. The GST-fusion protein was digested with thrombin (10 U/mg in PBS), and the GCG protein was identified by gel electrophoresis and western blot analysis. Neoglycoproteins in 0.1 M carbonate buffer, pH 9.6 (50 µl) were coated onto polystyrene microtitration plates (1–100 µg/ml, Nunc, Wiesbaden, Germany), the wells were blocked with 5% BSA/PBS (1 h, 37°C), and 50 µl solutions of recombinant or natural GCG (20 µg/ml) were incubated overnight at 4°C. Bound galectin was measured with a 1/100 diluted polyclonal anti-GCG rabbit antiserum (1 h, 37°C), followed by biotinylated anti-rabbit Ig (1 h at 37°C; Dako, Hamburg, Germany) and streptavidine-phosphatase (30 min at 37°C; Roche, Mannheim, Germany) and development with p-nitrophenylphosphate in diethanolamine buffer, pH 9.3.
|
Conflict of interest statement |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
None declared.
|
Acknowledgments |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
This study was supported by DFG grants Ha 2092/6-1 and Ha 2092/7-1.
|
Abbreviations |
|---|
BHK, baby hamster kidney; CHAPS, 3-(cyclohexylamino)-1-propanesulfonic acid; CRD, carbohydrate recognition domain; DHB, 2,5-dihydroxybenzoic acid; DTT, dithiotreitol; GCG, Geodia cydonium galectin; HPLC, high-pressure liquid chromatography; IEF, isoelectric focusing; MALDI, matrix-assisted laser desorption ionization; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate buffered saline; PSD, postsource decay
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsConflict of interest statementAcknowledgmentsReferences |
|---|
Ahmed, H. and Vasta, G.R. (1994) Galectins: conservation of functionally and structurally relevant amino acid residues defines two types of carbohydrate recognition domains. Glycobiology, 4, 545–549.
Cooper, D.N.W. and Barondes, S.H. (1999) God must love galectins; He made so many of them. Glycobiology, 9, 979–984.
Feizi, T., Solomon, J.C., Yuen, C.-T., Jeng, K.C.G., Frigeri, L.G., Hsu, D.K., and Liu, F.-T. (1994) The adhesive specificity of the soluble human lectin, IgE-binding protein, toward lipid-linked oligosaccharides. Presence of the blood group A, B, B-like, and H monosaccharides confers a binding activity to tetrasaccharide (lacto-N-tetraose and lacto-N-neotetraose) backbones. Biochemistry, 33, 6342–6349.[CrossRef][Medline]
Goletz, S., Hanisch, F.-G., and Karsten, U. (1997) Novel GalNAc containing glycans on cytokeratins are recognized in vitro by galectins with type II carbohydrate recognition domains. J. Cell Sci., 110, 1585–1596.[Abstract]
Görg, A., Weiss, W., and Dunn, M.J. (2004) Current two-dimensional electrophoresis technology for proteomics. Proteomics, 4, 3665–3685.[CrossRef][ISI][Medline]
Gruic-Sovulj, I., Lüdemann, H.-C., Hillenkamp, F., Weygand-Durasevic, I., Kucan, Z., and Peter-Katalinic, J. (1997) Detection of non-covalent tRNA-aminoacyl-tRNA synthetase complexes by matrix-assisted laser desorption/ionization mass spectrometry. J. Biol. Chem., 272, 32084–32091.
Hanisch, F.-G., Baldus, S.E., and Kümmel, T.A. (1996) Forssman disaccharide is the specific ligand of a galectin from the sponge Geodia cydonium but does not mediate its binding to nuclear protein np56. Glycobiology, 6, 321–336.
Hanisch, F.-G., Saur, A., Müller, W.E.G., Conrad, J., and Uhlenbruck, G. (1984) Further characterization of a lectin and its in vivo receptor from Geodia cydonium. Biochim. Biophys. Acta, 801, 388–395.
Henrick, K., Bawumia, S., Barboni, E.A.M., Mehul, B., and Hughes, R.C. (1998) Evidence for subsites in the galectins involved in sugar binding at the nonreducing end of the central galactose of oligosaccharide ligands: sequence analysis, homology modeling and mutagenesis studies of hamster galectin-3. Glycobiology, 8, 45–57.
Houzelstein, D., Goncalves, I.R., Fadden, A.J., Sidhu, S.S., Cooper, D.N.W., Drickamer, K., Leffler, H., and Poirier, F. (2004) Phylogenetic analysis of the vertebrate galectin family. Mol. Biol. Evol., 21, 1177–1187.
Hughes, R.C. (1999) Secretion of the galectin family of mammalian carbohydrate-binding proteins. Biochim. Biophys. Acta, 1473, 172–185.[Medline]
Leffler, H., Carlsson, S., Hedlund, M., Qian, Y., and Poirier, F. (2004) Introduction to galectins. Glycoconj. J., 19, 433–440.[CrossRef][ISI][Medline]
Mazurek, N., Conklin, J., Byrd, J.C., Raz, A., and Bresalier, R.S. (2000) Phosphorylation of the ß-galactoside-binding protein galectin-3 modulates binding to its ligands. J. Biol. Chem., 275, 36311–36315.
Nickel, W. (2003) The mystery of nonclassical protein secretion. Eur. J. Biochem., 270, 2109–2119.[ISI][Medline]
Ochieng, J., Furtak, V., and Lukyanov, P. (2004) Extracellular functions of galectin-3. Glycoconj. J., 19, 527–535.[CrossRef][ISI][Medline]
Ochieng, J., Leite-Browning, M.L., and Warfield, P. (1998) Regulation of cellular adhesion to extracellular matrix proteins by galectin-3. Biochem. Biophys. Res. Commun., 246, 788–791.[CrossRef][ISI][Medline]
Patterson, R.J., Wang, W., and Wang, J.L. (2004) Understanding the biochemical activities of galectin-1 and galectin-3 in the nucleus. Glycoconj. J., 19, 499–506.[CrossRef][ISI][Medline]
Peter-Katalinic, J. (2005) Methods in enzymology: O-glycosylation of proteins. Methods Enzymol., 405, 139–171.[ISI][Medline]
Pfeifer, K., Haasemann, M., Gamulin, V., Bretting, H., Fahrenholz, F., and Müller, W.E.G. (1993) S-type lectins occur also in invertebrates: high conservation of the carbohydrate recognition domain in the lectin genes from the marine sponge Geodia cydonium. Glycobiology, 3, 179–184.
Sato, S. and Hughes, R.C. (1992) Binding specificity of a baby hamster kidney lectin for H type I and II chains, polylactosamine glycans, and appropriately glycosylated forms of laminin and fibronectin. J. Biol. Chem., 267, 6983–6990.
Seve, A.-P., Felin, M., Doyennette-Moyne, M.-A., Sahraoui, T., Aubery, M., and Hubert, J. (1993) Evidence for a lactose-mediated association between two nuclear carbohydrate-binding proteins. Glycobiology, 3, 23–30.
Strupat, K., Sagi, D., Bönisch, H., Schäfer, G., and Peter-Katalinic, J. (2000) Oligomerization and substrate binding studies of the adenylate kinase by matrix-assisted laser desorption/ionization mass spectrometry. Analyst/Spec. Issue Biol. Mass Spectrom., 125, 563–567.
Vaith, P., Uhlenbruck, G., Müller, W.E.G., and Holz, G. (1979) Sponge aggregation factor and sponge hemagglutinin: possible relationships between two different molecules. Dev. Comp. Immunol., 3, 399–416.[CrossRef][ISI][Medline]
Wagner-Hülsmann, C., Bachinski, N., Diehl-Seifert, B., Blumbach, B., Steffen, R., Pancer, Z., and Müller, W.E.G. (1996) A galectin links the aggregation factor to cells in the sponge (Geodia cydonium) system. Glycobiology, 6, 785–793.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||