Skip Navigation


Glycobiology Advance Access originally published online on December 11, 2005
Glycobiology 2006 16(4):333-342; doi:10.1093/glycob/cwj068
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/4/333    most recent
cwj068v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ihara, H.
Right arrow Articles by Taniguchi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ihara, H.
Right arrow Articles by Taniguchi, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Reaction mechanism and substrate specificity for nucleotide sugar of mammalian {alpha}1,6-fucosyltransferase—a large-scale preparation and characterization of recombinant human FUT8

Hideyuki Ihara2, Yoshitaka Ikeda3,4 and Naoyuki Taniguchi1,2

2 Department of Biochemistry, Osaka University Graduate School of Medicine, B1, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan; 3 Division of Molecular Biology, Department of Biomolecular Sciences, Saga University Faculty of Medicine, 5-1-1 Nabeshima, Saga 849-8501, Japan; and 4 Core Research for Evolution Science and Technology, Japanese Science and Technology Agency, 4-1-8, Honcho, Kawaguchi-shi, Saitama 332-0012, Japan JST


1 To whom correspondence should be addressed; e-mail: proftani{at}biochem.med.osaka-u.ac.jp

Received on October 12, 2005; revised on December 1, 2005; accepted on December 7, 2005


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
FUT8, mammalian {alpha}1,6-fucosyltransferase, catalyzes the transfer of a fucose residue from the donor substrate, guanosine 5'-diphosphate (GDP)-ß-L-fucose, to the reducing terminal GlcNAc of the core structure of asparagine-linked oligosaccharide via an {alpha}1,6-linkage. FUT8 is a typical type II membrane protein, which is localized in the Golgi apparatus. We have previously shown that two neighboring arginine residues that are conserved among {alpha}1,2-, {alpha}1,6-, and protein O-fucosyltransferases play an important role in donor substrate binding. However, details of the catalytic and reaction mechanisms and the ternary structure of FUT8 are not understood except for the substrate specificity of the acceptor. To develop a better understanding of FUT8, we established a large-scale production system for recombinant human FUT8, in which the enzyme is produced in soluble form by baculovirus-infected insect cells. Kinetic analyses and inhibition studies using derivatives of GDP-ß-L-fucose revealed that FUT8 catalyzes the reaction which depends on a rapid equilibrium random mechanism and strongly recognizes the base portion and diphosphoryl group of GDP-ß-L-fucose. These results may also be applicable to other fucosyltransferases and glycosyltransferases.

Key words: fucosyltransferase / FUT8 / baculovirus-insect cell expression system / kinetic analysis / reaction mechanism


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Several types of fucosylation in asparagine-linked oligosaccharide (N-glycan) are known to occur in eukaryotes and are involved in various biological events, including development, differentiation, growth, and human diseases (Miyoshi E, Noda K, Yamaguchi Y, et al., 1999Go; Staudacher et al., 1999Go; Becker and Lowe, 2003Go). Fucose is transferred to acceptor oligosaccharides and proteins by various fucosyltranferases via {alpha}1,2-, {alpha}1,3-, {alpha}1,4-, {alpha}1,6-linkages and protein O-fucosylation (Miyoshi E, Noda K, Yamaguchi Y, et al., 1999Go; Staudacher et al., 1999Go; Becker and Lowe, 2003Go). The {alpha}1,6-fucosylation of N-glycan has been observed in many types of glycoproteins and is known to be particularly abundant in brain tissue (Nakakita et al., 1999Go). Mammalian {alpha}1,6-fucosyltransferase ({alpha}1,6FucT), also called as FUT8, catalyzes the transfer of a fucose residue from guanosine 5'-diphosphate (GDP)-ß-L-fucose, the donor substrate, to the innermost GlcNAc residue in N-glycan through {alpha}1,6-linkage (Figure 1) and has been found in various mammals (Struppe and Staudacher, 2000Go). FUT8 is widely distributed in mammalian tissues and human cancer cell lines (Miyoshi et al., 1997Go).


Figure 1
View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Reaction catalyzed by FUT8. FUT8 transfers a fucose residue from GDP-ß-L-fucose to the innermost GlcNAc of Asn-linked oligosaccharide.

 

It has been shown that {alpha}-fetoprotein, a well-known tumor marker, is extensively fucosylated by FUT8 in hepatocellular carcinoma but not in chronic liver disease despite the elevation of FUT8 expression level (Noda K, Miyoshi E, Uozumi N, Gao CX, et al., 1998Go; Noda K, Miyoshi E, Uozumi N, Yanagidani S, et al., 1998Go). As indicated in our previous study, FUT8 expression levels of mRNA and protein are also highly and specifically elevated in human ovarian serous adenocarcinomas (Takahashi T, Ikeda Y, Miyoshi E, et al., 2000Go). To elucidate the biological significance of FUT8 expression, transfection experiments of FUT8 were performed using cancer cell lines, and the findings indicated that the overexpression of FUT8 suppresses experimental metastasis via the {alpha}1,6-fucosylation of {alpha}5ß1 integrin (Miyoshi E, Noda K, Ko JH, et al., 1999Go). Interestingly, the {alpha}1,6-fucosylation of N-glycan in human IgG1 was reported to suppress antibody-dependent cellular cytotoxicity (Shields et al., 2002Go; Shinkawa et al., 2003Go), and this discovery could provide the basis for the production of an effective therapeutic antibody in the future. Our recent study clearly revealed that the disruption of the FUT8 gene induced severe growth retardation, emphysema, and death during postnatal development. The lack of {alpha}1,6-fucosylation on transforming growth factor-ß1 (TGF-ß1) receptors was found to be involved in these phenotypes of FUT8-null mice (Wang et al., 2005Go). These reports strongly indicate that the {alpha}1,6-fucosylation of N-glycans and FUT8 expression have important roles in various biological events.

FUT8 was first reported by Wilson (Wilson et al., 1976Go) and is known to be a typical type II membrane protein and a Golgi apparatus-resident glycosyltransferase (Uozumi N, Yanagidani S, et al., 1996Go). FUT8 was partially purified from human fibroblast (Voynow et al., 1991Go). Our group succeeded in purifying it from MKN45 cells, a human gastric cancer cell line (Yanagidani et al., 1997Go), and porcine brain (Uozumi N, Yanagidani S, et al., 1996Go). The cDNAs were first cloned from human and porcine (Uozumi N, Yanagidani S, et al., 1996Go; Yanagidani et al., 1997Go), and since then, the cDNAs of FUT8 have also been cloned from mouse and bovine (Hayashi et al., 2000Go; Javaud et al., 2000Go). A genomic analysis and chromosomal mapping of human FUT8 have already been reported (Costache et al., 1997Go; Yamaguchi et al., 1999Go, 2000Go; Coullin et al., 2002Go; Martinez-Duncker et al., 2004Go). A comparison of the amino acid sequences showed that some regions in the primary structures are highly conserved in {alpha}1,2FucT related to H-antigen synthesis, FUT8, bacterial {alpha}1,6FucT known as NodZ, which modifies the Nod factor related to plant root nodulation and O-fucosyltransferase related to Notch signaling (Breton et al., 1998Go; Oriol et al., 1999Go; Takahashi T, Ikeda Y, Tateishi A, et al., 2000Go; Martinez-Duncker et al., 2003Go; Okajima et al., 2005Go). These conserved regions are thought to be implicated in the enzymatic reactions.

By site-directed mutagenesis and kinetic studies, two arginine residues in the conserved regions of human FUT8 have been proposed to play important roles in donor binding (Takahashi T, Ikeda Y, Tateishi A, et al., 2000Go). On the other hand, the substrate specificity of FUT8 toward the acceptor substrate has been studied extensively (Longmore and Schachter, 1982Go; Voynow et al., 1991Go; Shao et al., 1994Go; Staudacher and Marz, 1998Go), and the findings indicate that the reaction of FUT8 requires a ß-linkage between the GlcNAc of the reducing terminal of N-glycan and the asparagine in the consensus sequence of N-glycosylation (Voynow et al., 1991Go) and the ß1,2 GlcNAc residue linked to the {alpha}1,3 mannose arm in the trimannose core structure of N-glycan (Longmore and Schachter, 1982Go; Voynow et al., 1991Go; Shao et al., 1994Go). While motif search and analysis of the substrate specificity of FUT8 have been carried out in detail, the reaction and catalytic mechanism and an X-ray crystallographic structural analysis have not been investigated to date. In fact, FUT8 is known to be an inverting enzyme, the reaction of which involves inversion at the anomeric center of the transferred monosaccharide, but the details of the mechanism of this reaction, which does not require divalent metals, are unknown.

In this study, we report on a large-scale preparation system for recombinant human FUT8 using a baculovirus/insect cell expression system because a large amount of the purified enzyme is needed for its crystallization and structural analyses. The expressed enzyme was purified and examined by the kinetic and inhibition analyses using GDP, one of the products of the FUT8 reaction, to investigate the reaction mechanism of FUT8. Various GDP analogues were also used to examine the structural requirements of the donor substrate. The findings suggest that the glycosyltransferring reaction catalyzed by FUT8 is most probably dependent on a rapid equilibrium random mechanism, which is different from those of other well-characterized glycosyltransferases. It was also found that FUT8 strongly recognizes GDP in its enzyme reaction.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Expression and purification of recombinant human FUT8
To easily produce pure recombinant FUT8 on a large scale, we attempted to express a soluble form of the enzyme using a baculovirus/insect cell expression system. Such a soluble form of FUT8 was designed by the deletion of the transmembrane region and the addition of a polyhistidine tag at C-terminus (Figure 2). Amino acid residues 1–67, which comprise the signal peptide/transmembrane region intrinsic to FUT8, were replaced by the sequence of the signal peptide of gp67 of the baculovirus for efficient secretion, and this manipulation resulted in the insertion of five additional residues, Ala–Asp–Leu–Gly–Ser, immediately before Arg-68 of FUT8 (Figure 2). Thus, the enzyme would be expected to be secreted as an N-terminally extended form by these five amino acids if the cleavage site of the gp67 signal peptide is effective. The soluble form of FUT8 was expressed at high levels by the infected Sf21 cells and was efficiently secreted into the culture medium.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Construction of the recombinant human FUT8. The recombinant FUT8 was designed as the soluble form. The engineered protein contained an added signal sequence of gp67, a baculoviral protein, at the Arg-68 of human FUT8. Polyhistidine tag was also fused at C-terminal of the recombinant FUT8.

 

In the purification of the engineered recombinant FUT8 from the culture medium of the baculovirus-infected insect cells, the protein was concentrated by ammonium sulfate precipitation, followed by column chromatography using a Ni2+-chelating affinity column. This purification procedure is simple but effective for purifying the enzyme, as shown by a single protein band of 60 kD in sodium dodecylsulfate–polyacrylamide gel electrophoresis (SDS–PAGE) analysis (Figure 3A). Two hundred micrograms of the purified enzyme could be obtained from 200 mL of culture medium (Table I). Engineering of the FUT8 protein and the establishment of a convenient purification method enabled us to easily prepare large amounts of the recombinant glycosyltransferase. As indicated by the difference in the relative mobility on SDS–PAGE between reducing and non-reducing conditions, the recombinant FUT8, which contains eight cysteine residues, appeared to contain intramolecular disulfide bonds (Figure 3B).


Figure 3
View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. SDS–PAGE analysis of the purified recombinant FUT8. (A) The purified protein was separated on an 8% SDS gel and was stained by Coomassie Brilliant Blue (CBB). (B) The purified enzyme was separated on a 10% SDS gel under reducing and nonreducing conditions with or without 2-mercaptoethanol abbreviated as 2ME. The finished gel was stained by CBB. (C and D) Protein was oxidized by periodate for the detection of carbohydrate as described in Materials and methods. (C) Oxidized and non-oxidized samples were separated on an 8% SDS gel. Labeled proteins were detected by immunoblot analysis with avidin–biotin complex reaction. Transferrin was used as a positive control. (D) Oxidated and non-oxidated samples were separated on 10% SDS gel. The recombinant FUT8 was detected by immunoblot analysis with anti-tetra His antibody.

 

View this table:
[in this window]
[in a new window]
 
Table I. The purification of recombinant human FUT8 using the baculovirus/insect cell expression system

 

An immunoblot analysis with an anti-polyhistidine antibody indicated that the C-terminal polyhistidine tag remains intact in the recombinant enzyme after its secretion into the culture medium (Figure 3D). In addition, the N-terminal sequence of the recombinant FUT8 was determined to be Ala–Asp–Leu–Gly–Ser–Arg–Ile–Pro–Glu–Gly by N-terminal analysis (data not shown), as expected from the design of the construct (Figure 2). These results indicate that the recombinant FUT8 does not undergo any proteolysis except for the removal of the signal peptide. Because the recombinant FUT8 was fully active, as compared with full-length human FUT8, the loss of the intrinsic N-terminal sequence of residues 1–67 and the fusion of polyhistidine tag at the C-terminal had no effect on enzymatic activity (Yanagidani et al., 1997Go). This suggests that the engineering used in the large-scale preparation was not a problematic operation for structural analyses, for example, for a study of the structural basis of enzyme catalysis and specificity.

To determine whether the recombinant FUT8 is modified by glycosylation, the carbohydrate content was evaluated by periodate oxidation. The aldehyde group generated from the oxidation of the carbohydrate moiety was detected by biotin conjugation followed by avidin-based visualization. As shown in Figure 3C, an obvious signal biotinylation was observed for the recombinant FUT8, suggesting that the enzyme is, in fact, glycosylated. This oxidized protein shown in Figure 3C was identical to FUT8 (Figure 3D), and the slight change in the degree of migration on SDS–PAGE was probably because of biotinylation. Thus, the recombinant FUT8 produced by Sf21 cells appeared to be modified by glycosylation, which could be O-glycosylation or other rather than N-glycosylation because of the absence of its consensus sequence for this type of modification.

Kinetic analysis of recombinant human FUT8
The recombinant FUT8 was enzymatically fully active, comparable with the native human enzyme purified from MKN45 cells (Yanagidani et al., 1997Go). To clarify the reaction mechanism of FUT8, kinetic analyses were carried out using GDP-ß-L-fucose and a fluorescence-labeled oligosaccharide, and the resulting kinetic parameters are shown in Table II and Figure 4. The oligosaccharide acceptor substrate was prepared by labeling the amino group of the asparagine carrying sugar chain with N-[2-(2-pyridylamino)ethyl]-succinamic acid 5-norbornene-2,3-dicarboxyimide ester, and the resulting fluorescent oligosaccharide was analyzed by high-performance liquid chromatography (HPLC) (Mita et al., 2000Go; Inamori et al., 2004Go), as is performed for conventional 2-aminopyridine derivatives of sugar chains. Another Asn-linked oligosaccharide substrate, labeled with 4-(2-pyridylamino)butylamine (PABA) via a carboxyl group, was previously reported and is known to be a good fluorescence-labeled acceptor in an {alpha}1,6FucT activity assay involving an HPLC system (Uozumi N, Teshima T, et al., 1996Go). However, because many difficult steps are needed for the preparation of the PABA-labeled acceptor, we selected the alternative acceptor because of its convenience in preparation, as reported by Mita et al. (2000)Go. When the {alpha}1,6FucT activity assay was carried out by a reversed-phase HPLC, the substrate and the product were separated more completely than in the assay described previously (Mita et al., 2000Go). As a result, the alternative procedure was sufficient for an analysis of the kinetic mechanism of {alpha}1,6FucT in detail (Figure 4A).


View this table:
[in this window]
[in a new window]
 
Table II. Kinetic parameters for recombinant FUT8

 

Figure 4
View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4. Kinetic analysis of the purified recombinant FUT8. (A) A typical chromatogram for the enzyme assay is shown. The enzyme assay for FUT8 reaction with the fluorescence-labeled acceptor substrate is described in the Materials and methods. Nonreacted substrate and product were eluted at 11 and 18 min, respectively. (BD) Double-reciprocal plot for FUT8 reaction. (B) Plot sets with fixed acceptor concentration are shown by double-reciprocal plot indicating 1/velocity versus 1/GDP-ß-L-fucose for FUT8 reaction. Fixed concentrations of acceptor for each plot set are shown in the right of panel. (C) This panel shows the secondary plot of panel B for the determination of kinetic parameters for the acceptor. (D) Plot sets with fixed GDP-ß-L-fucose concentration are shown by a double-reciprocal plot indicating 1/velocity versus 1/acceptor. (E) This panel is the secondary plot of panel D. Kinetic parameters of FUT8 are summarized in Table II.

 

To characterize the reaction catalyzed by FUT8, the kinetic parameters for GDP-ß-L-fucose as the glycosyl donor and the fluorescence-labeled asparagine-linked asialo- and agalacto-biantennary sugar chain as the acceptor substrate were determined. These results are summarized in Table II. In addition, the reaction mechanism of FUT8 was investigated by reciprocal plots of data obtained using various concentrations of donor and acceptor (Figure 4). When the rate data in the presence of a fixed concentration of the acceptor were plotted as a function of the concentration of the donor, the plot set for each concentration of acceptor intersected the X-axis at the same point (Figure 4). These kinetic profiles are consistent with a rapid equilibrium random mechanism, a type of sequential mechanism. To further confirm this, an inhibition study was also carried out using GDP, a product of the bisubstrate reaction. As shown in Figure 5, GDP displayed competitive inhibition when the substrate concentration of any of the donors and acceptors was varied. The Ki value for GDP estimated from secondary plots indicates that GDP apparently serves as a competitive inhibitor of FUT8 (Table III). The results of these kinetic studies strongly suggest that FUT8 binds the substrates, the glycosyl donor, and the acceptor to form a ternary complex before the chemical process, and it is likely that the reaction proceeds through a rapid equilibrium random mechanism (Figure 5C).


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. GDP functions as a competitive inhibitor in the FUT8 reaction. (A and B) GDP was added to the FUT8 reactions at 0, 2, 4, 6, 8, and 10 µM. (A) Concentration of GDP-ß-L-fucose was fixed at 5 µM. (B) Concentration of acceptor was fixed at 5 µM. (C) Scheme of putative reaction mechanism of FUT8. FUT8 is most likely to catalyze the reaction depending on a rapid equilibrium random mechanism.

 

View this table:
[in this window]
[in a new window]
 
Table III. Ki values for various inhibitors of the activity of recombinant FUT8

 

Inhibition analyses of recombinant FUT8 using analogs of GDP-ß-L-fucose
To further determine the specificity of FUT8 for the nucleotide and nucleotide sugar, inhibition analyses using GDP derivatives, analogs, and constituents were carried out. When the inhibitory effects were examined, FUT8 activity was determined with a fixed concentration of 5 µM labeled acceptor and various concentrations of GDP-ß-L-fucose, 4–20 µM, in the presence or absence of inhibitors. The Ki values for the GDP-related compounds are summarized in Table III. Inhibition modes of the compounds were determined from double-reciprocal plots of the FUT8 activity assay data (Figures 6 and 7). Inhibitors such as guanosine 5'-monophosphate (GMP), guanosine 5'-triphosphate (GTP), deoxy-GDP, GDP-glucose, GDP-mannose, and pyrophosphate (PPi), all of which structurally mimic GDP-ß-L-fucose, inhibited FUT8 activity in a competitive manner (Figure 6). Deletion of the 2'-OH group of ribose of GDP and the addition of one phosphate to GDP had only a negligible effect on the donor substrate binding, as implied by Ki values for deoxy-GDP, GTP, and GDP.


Figure 6
View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6. The inhibition of various analogues of GDP-ß-L-fucose in FUT8 reactions. FUT8 reactions with various GDP analogues were carried out using 5 µM of acceptor. GMP (A), GTP (B), deoxy GDP (C), GDP-glucose (D), GDP-mannose (E), and PPi (F) are added to the reactions as inhibitors, respectively. The concentrations of each analogue are described beside the panels. The Ki values for analogues were estimated by re-plots of Km/V for each plot set as a function of the analogue. The Ki values for analogues are summarized in Table III.

 

Figure 7
View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7. Inhibition in FUT8 reactions by other nucleotides. FUT8 reactions with nucleotides were carried out using 5 µM of acceptor. ADP (A), IDP (B), XDP (C), CDP (D), TDP (E), and UDP (F) are added to the reactions as inhibitors, respectively. The concentrations of each nucleotide are described beside the panels. The Ki values for nucleotides are summarized in Table III.

 

Ki for GMP was 640 times higher than that of GDP, indicating that the lack of a ß-phosphate in GDP reduces the strong binding to FUT8, and thus the diphosphate of GDP appears to play an essential role in donor binding, as has been reported previously (Takahashi T, Ikeda Y, Tateishi A, et al., 2000Go). On the other hand, PPi inhibited the enzyme, as evidenced by the Ki value, which was 1200 times higher, compared with the value for GDP, suggesting that the nucleotide moiety, base, and ribose of the donor substrate is also involved in the binding of the donor to FUT8 to a similar extent.

Furthermore, to evaluate the effects of the sugar moiety that is transferred on donor binding, two GDP sugar nucleotides, GDP-mannose and GDP-glucose, as GDP-ß-L-fucose analogs were examined. While FUT8 could not transfer a glucose or a mannose from the respective GDP sugars to the acceptor, even when the incubation time was extended and/or a higher concentration of substrate was used (data not shown), the inhibition assay indicated that both derivatives serve as competitive inhibitors (Figure 6D and E). Their Ki values were comparable (Table III), even though these values were significantly higher than the value for GDP and Km for GDP-ß-L-fucose. These results, therefore, indicate that the epimerism of the OH group at the 2-position is not associated with the binding of the donor substrate. Considering the structural difference between the L-fucose and the D-sugars examined, glucose and mannose, it seems likely that the sugar moiety of GDP-ß-L-fucose does not contribute significantly to the binding and recognition by FUT8 as much as the guanine nucleotide and diphosphate portions of GDP-ß-L-fucose, although the enzyme exhibits a slight preference for L-fucose compared with other sugars.

Inhibition analyses of recombinant FUT8 using other nucleotide diphosphates
To examine the specific structural feature of the nucleotide involved in the specificity of FUT8 to the base portion of a nucleotide, various nucleotides were subjected to the inhibition assay (Figure 7), and the Ki values obtained are summarized in Table III. As a result, it was found that none of the nucleotide diphosphates inhibited FUT8 activity in the concentration range used, compared with the inhibition observed for GDP. Only inosine 5'-diphosphate (IDP), one of the purine nucleotide diphosphates, functioned as a competitive inhibitor (Figure 7B). Interestingly, other purine nucleotide diphosphates, adenosine 5'-diphosphate (ADP) and xanthosine 5'-diphosphate (XDP), inhibited the enzyme in a non-competitive manner (Figure 7A and C). GDP and IDP contain an amide group as a common structural element, which gives rise to a resonance structure, whereas ADP does not contain such an amide. XDP contains an imide which confers a distinct resonance structure of the amide residue. Such a difference in the electron distribution in the purine ring might contribute to the specificity of FUT8 for the purine nucleotide. In addition, although IDP contains an amide structure that is similar to GDP, the Ki value of IDP was estimated to be 2.4 mM, 670 times higher than that for GDP (Table III). These results indicate that the amino/amide group at the 2-position in GDP is an important structural element for the binding of GDP-ß-L-fucose to FUT8.

On the other hand, when the inhibitory effects of pyrimidine-type nucleotides were examined using three pyrimidine nucleotide diphosphates, uridine 5'-diphosphate (UDP), thymidine 5'-diphosphate (TDP), and cytidine 5'-diphosphate (CDP) (Figure 7D–F), these nucleotides competitively inhibited FUT8. However, because these pyrimidine nucleotides inhibit FUT8 only at a similar level to PPi, as indicated by their Ki values, it appears that pyrimidine rings are not capable of being recognized by FUT8.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
To examine precisely the kinetic and physicochemical properties of glycosyltransferases, it is generally essential to establish an expression system that enables the preparation of large amounts of pure recombinant enzyme, because sufficient amounts of the enzymes are often unavailable. Various hosts, for example, bacteria, yeast, and insect cells, can be used for large-scale preparation of recombinant proteins, and sometimes insects themselves are used. We selected insect cells as the host for the expression of recombinant FUT8, because it has been reported that full-length FUT8 and other fucosyltransferases can be successfully expressed in such a system, probably owing to the fact that posttranslational modifications in this system are similar to those in mammalian cells (Shinkai et al., 1997Go; Smithers et al., 1997Go; Takahashi T, Ikeda Y, Tateishi A, et al., 2000Go; Morais et al., 2001Go, 2003Go).

As indicated in our previous study, however, it is difficult to solubilize and purify full-length FUT8 from infected insect cells in spite of it being enzymatically active (Takahashi T, Ikeda Y, Tateishi A, et al., 2000Go), whereas the native enzyme has been purified from various sources, human skin fibroblasts (Voynow et al., 1991Go), porcine brain (Uozumi N, Yanagidani S, et al., 1996Go), and a human gastric cancer cell line (Yanagidani et al., 1997Go). In this study, we designed the construction for the expression of the soluble form on the basis of the data of N-terminal sequencing for the enzyme, which is secreted from MKN45 cells, a human gastric cancer cell line (Yanagidani et al., 1997Go). Because the N-terminus of this enzyme purified from conditioned medium of the cancer cells was found to start at Arg-68 (Yanagidani et al., 1997Go), it was reasonably assumed that the deletion of residues 1–67 of human FUT8 would have no effect on its enzymatic activity. In fact, the engineered recombinant FUT8 in which a cleavable secretory signal sequence is fused at the N-terminal Arg-68 has full enzymatic activity, as shown by the similar specific activities of the recombinant and native enzymes. As a result, the highly purified recombinant FUT8 was readily obtained without solubilization from a cell membrane, and thereby large amounts of enzyme could be made available for various analyses. The enzyme obtained from infected Sf21 did not undergo any proteolytic cleavage at the N- and C-terminal, except for the removal of the aforementioned signal sequence. The western blot analysis combined with the periodate oxidation indicated that the recombinant enzyme was, in fact, modified by carbohydrates. Because the primary structure of FUT8 has no consensus sequence for N-glycosylation, it is probable that FUT8 is modified by another type of glycosylation, for example, O-linked glycosylation such as the mucin type, O-fucosylation, O-glucosylation, and O-mannosylation. The structural identification of the type of glycosylation and its functional involvement remain to be investigated.

The reaction mechanisms of fucose transfer by {alpha}1,2- and {alpha}1,3-fucosyltransferases have been studied but that for FUT8 has not been studied (Beyer and Hill, 1980Go; Murray et al., 1996Go; Qiao et al., 1996Go). It is well known that a major fucosyltransferase, {alpha}1,3/1,4-fucosyltransferase, which is related to Lewis antigen biosynthesis, requires the presence of a divalent metal ions such as Mn2+ and Mg2+ in which the reaction is catalyzed according to an ordered sequential mechanism (Murray et al., 1996Go; Qiao et al., 1996Go). On the other hand, FUT8 does not require divalent metal ions for activity, and it was found that the reaction is consistent with a rapid equilibrium random mechanism, as suggested by the kinetic study reported here. Thus, for the reaction and catalytic mechanisms, FUT8 has properties that are distinct from {alpha}1,3-/1,4-fucosyltransferase, but it is more likely that the mechanisms of FUT8 are similar to that for {alpha}1,2-fucosyltransferase (Beyer and Hill, 1980Go). Furthermore, because the short region associated with donor binding is conserved among {alpha}1,2-, {alpha}1,6-, and protein O-fucosyltransferases (Breton et al., 1998Go; Oriol et al., 1999Go; Takahashi T, Ikeda Y, Tateishi A, et al., 2000Go; Martinez-Duncker et al., 2003Go; Okajima et al., 2005Go), it is reasonable to assume that FUT8 is related more closely to {alpha}1,2-fucosyltransferase than to {alpha}1,3-/1,4-fucosyltransferase. However, while some divalent metal ions are not essential but serve to activate {alpha}1,2-fucosyltransferase (Beyer and Hill, 1980Go), such a type of activation was not observed in FUT8 (Uozumi N, Yanagidani S, et al., 1996Go; Yanagidani et al., 1997Go). The reaction mechanisms of FUT8 and {alpha}1,2-fucosyltransferase are generally similar, but, in detail, these enzymes may differ with respect to, for example, subtle aspects of the catalytic process, activation of the enzyme itself, or regulation by cofactors.

The specificity of FUT8 toward the donor substrate was examined by inhibition analyses using various compounds that are structurally related to GDP-ß-L-fucose. As shown by the inhibition assay results, the binding of the donor substrate to FUT8 mainly depends on the diphosphoryl group and the guanine base of which an amide resonance, especially amino residue at the 2-position, could play a critical role in being recognized by the enzyme. An earlier study on the donor substrate specificity of FUTV, {alpha}1,3-fucosyltransferase, indicated that this fucosyltransferase has the ability to strongly recognize other purine nucleotides, including IDP, XDP, and ADP, as well as GDP (Murray et al., 1996Go), whereas FUT8 appears to bind the other purine diphosphates only weakly. This difference in specificity for purine nucleotides between FUTV and FUT8, even though these enzymes have common characteristics as found in the comparable inhibition by GDP-glucose and GDP-mannose and in the absence of inhibition by pyrimidine diphosphates, is noteworthy. FUT8 has a relatively narrow specificity for donor substrate and, more strictly, recognizes the nucleotide moiety of the "donor substrate," whereas FUTV has a much wider specificity. These findings related to substrate specificity would be useful for developing specific inhibitors of each fucosyltransferase to control fucosylated oligosaccharide biosyntheses. An X-ray crystallographic analysis of FUT8, using recombinant protein prepared by the expression system reported, is currently underway, in an attempt to develop a more clean understanding of the mechanisms of catalysis and reaction of FUT8.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Materials
Restriction endonucleases and DNA-modifying enzymes were purchased from Takara (Kyoto, Japan), Toyobo (Shiga, Japan), and New England Biolabs (Beverly, MA). GDP-ß-L-fucose was purchased from Wako pure chemicals (Osaka, Japan). Other sugar nucleotides were obtained from Sigma (St. Louis, MO). Nucleotides were obtained from the Yamasa Corp. (Chiba, Japan), Jena Bioscience (Jena, Germany), and Sigma. Oligonucleotide primers were synthesized by Greiner Japan (Tokyo, Japan). Antibodies were obtained from the following sources: anti-polyhistidine monoclonal antibody from Qiagen (Valencia, CA) and horseradish peroxidase (HRP)-conjugated anti-mouse IgG antibody from Promega (Madison, WI). N-[2-2-Pyridylaminoethyl]-succinamic acid 5-norbornene-2,3-dicarboxyimide ester was obtained from Wako pure chemicals (Osaka, Japan). Other common chemicals were obtained from Wako pure chemicals, Nacalai Tesque (Kyoto, Japan), and Sigma.

Insect cells
Spodoptera frugiperda (Sf21) cells were maintained at 27°C in Grace's insect media (GIBCO-BRL, Invitrogen, Carlsbad, CA) containing 10% fetal calf serum, 3.33 g/L TC yeastolate (GIBCO-BRL), 3.33 g/L TC lactalbumin hydrolysate (GIBCO-BRL), and 100 mg/L kanamycin.

Site-directed mutagenesis
To insert polyhistidine tag, site-directed mutagenesis experiments were carried out according to Kunkel (1985)Go, as described previously (Ihara et al., 2002Go). A 0.3-kb fragment obtained by the digestion of human FUT8 cDNA (Yanagidani et al., 1997Go) with NcoI and EcoRI was subcloned into pBluescript SK+ (Stratagene, La Jolla, CA), and the resulting plasmid was used for the transformation of CJ236 (dut, ung). The uracil-substituted single-stranded DNA was prepared by infection of the transformed CJ236 with a helper phage M13K07. This template was then used with oligonucleotide primers to insert a polyhistidine tag to the C-terminal of human FUT8. The primer used in this study was 5'-TCCATCTGAGCTTTATCCACCTCCATGATGATGA TGATGATGACCTCCACCAGCTTTCTCAGCCTCA GG-3' for the insertion of polyhistidine tag. The resulting mutation was verified by dideoxy sequencing using a DNA sequencer (model 373A, Applied Biosystems, Foster City, CA), and the entire sequences were subjected to mutagenesis. The corresponding region of the wild-type cDNA was replaced by mutant sequence.

Construction of the transfer vector
A 1.3-kb fragment obtained by the digestion of human FUT8 cDNA (Yanagidani et al., 1997Go) with BspeI and NcoI and a mutant fragment, as described above, was ligated to XmaI and EcoRI sites of a transfer vector, pAcGP67B vector (PharMingen, San Diego, CA). The obtained transfer vector was used to express recombinant human FUT8 in baculovirus/insect cell expression system.

Preparation of recombinant virus
The purified transfer vector plasmid (1 µg) was cotransfected into 5 x 105 Sf21 cells with 10 ng of BaculoGold DNA (PharMingen). The transfection was carried out using the Lipofectin (GIBCO-BRL) method (Felgner et al., 1987Go), as described previously (Ikeda et al., 2000Go). Medium containing the recombinant virus generated by homologous recombinations was collected 5 days after transfection. The recombinant virus was manipulated, as described previously (Piwnica-Worms, 1987Go). The recombinant virus was further amplified to >5 x 107 plaque-forming units/mL before use.

Expression and purification of recombinant human FUT8
A total of 2 x 108 Sf21 cells were infected with the recombinant virus at a multiplicity of infection of >8. The medium was collected ~100 h after infection for the purification of the recombinant human FUT8. The collected medium was first subjected to ammonium sulfate precipitation to concentrate the protein. The resulting precipitate was dialyzed against 50 mM Tris–HCl buffer, 0.5 M NaCl, pH 7.5 (buffer A), and then applied on Ni2+-charged metal-chelating Sepharose (Amersham Pharmacia, Piscataway, NJ) equilibrated with buffer A. After washing with buffer A containing 50 mM imidazole, recombinant enzyme was eluted from the column with buffer A containing 200 mM imidazole. Eluted enzyme was dialyzed against 50 mM Tris–HCl buffer, 0.1 M NaCl, pH 7.5, and then concentrated by Amicon YM-10, ultrafiltration membrane (Millipore, Billerica, MA).

Protein determination
Protein concentrations were determined using BCA kit (Pierce, Rockford, IL), with bovine serum albumin (BSA) as a standard.

Electrophoresis and immunoblot analysis
According to Laemmli (1970)Go, SDS–PAGE was carried out on 8% gels. The separated proteins were transferred onto a nitrocellulose membrane (Protoran, Schleicher & Schuell, Keene, NH), and the resultant blot was blocked with 5% skim milk and 0.5% BSA in phosphate-buffered saline (PBS) containing 0.05% Tween-20. The resulting membrane was incubated with an anti-histidine antibody. After washing with PBS which contained 0.05% Tween-20, the membrane was reacted with a HRP-conjugated rabbit anti-mouse IgG. The immunoreactive protein bands were visualized by chemiluminescence using an ECL system (Amersham Pharmacia).

Detection of oligosaccharides on recombinant protein
The presence of carbohydrate was performed using an ECL glycoprotein-detection system (Amersham Pharmacia). The periodate oxidation of carbohydrate, followed by the biotinylation of the generated aldehyde group for labeling and detection, was performed according to the manufacturer’s instructions.

Enzyme activity assay for {alpha}1,6-fucosyltransferase
FUT8 activity was assayed using a fluorescence-labeled asparagine-linked asialo- and agalacto-biantennary sugar chain as an acceptor substrate, by methods described by Uozumi N, Teshima T, et al. (1996)Go and Mita et al. (2000)Go, with minor modifications. For the preparation of the acceptor substrate, a large-scale preparation of the asparagine-linked biantennary sugar chain was performed, as reported by Seko et al. (1997)Go. The digestion with pronase to the sialoglycopeptide purified from egg yolk (Seko et al., 1997Go) was performed to prepare the asparagine-linked sialoglycan, which was then purified by HPLC with a TSK gel, Amide-80 column (Tosoh, Tokyo, Japan). The purified asparagine-linked sialoglycan was then labeled with N-[2-(2-pyridylamino)ethyl]-succinamic acid 5-norbornene-2,3-dicarboxyimide ester, a fluorescence reagent (Mita et al., 2000Go; Inamori et al., 2004Go). After separation from the free labeling reagent, the fluorescence-labeled asparagine-linked biantennary sugar chain was digested with sialidase and ß-galactosidase to remove the galactose and sialic acid. Finally, the fluorescence-labeled asparagine-linked asialo- and agalacto-biantennary sugar chain was purified using an HPLC system with a reversed phase and amide column, as described previously (Ihara et al., 2002Go), and the structure of the product was verified by mass spectrometry (data not shown). The determination of labeled acceptor concentration was estimated by spectrometry with the free N-[2-(2-pyridylamino)ethyl]-succinamic acid 5-norbornene-2,3-dicarboxyimide ester. Standard assays were performed in a final volume of 20 µL of 50 mM Z-(N-morpholino) ethanesulfonic acid NaOH buffer (pH 7.0) (Uozumi N, Teshima T, et al., 1996Go; Uozumi N, Yanagidani S, et al., 1996; Yanagidani et al., 1997Go). The reaction was terminated by rapidly heating to 100°C after the acceptor and donor substrates had been incubated for 1 h. The reaction mixtures were then centrifuged at 10,000 x g for 10 min, and the resulting supernatants were applied to an HPLC equipped with a TSK-gel, ODS-80TM column (4.6 x 150 mm) (Tosoh) to separate and quantitate the products (Uozumi N, Teshima T, et al., 1996; Uozumi N, Yanagidani S, et al., 1996). Elution was performed isocratically at 55°C using a 20 mM acetate buffer (pH 4.0) containing 0.15% butanol for the enzyme assay (Uozumi N, Teshima T, et al., 1996; Uozumi N, Yanagidani S, et al., 1996). The fluorescence of the column elute was detected with a fluorescence detector (model RF-10AXL, Shimadzu, Kyoto, Japan) at excitation and emission wavelengths of 315 and 380 nm, respectively. The amounts of products were estimated from the fluorescence intensity.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
This research was supported by The 21st Century Center of Excellence Program and by The National Project on Protein Structural and Functional Analyses (Priority Research Program, Protein 3000 Project) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


    Abbreviations
 
ADP, adenosine 5'-diphosphate; FUT8, mammalian {alpha}1,6-fucosyltransferase; GDP, guanosine 5'-diphosphate; GMP, guanosine 5'-monophosphate; GTP, guanosine 5'-triphosphate; HPLC, high-performance liquid chromatography; IDP, inosine 5'-diphosphate; PPi, pyrophosphate; SDS–PAGE, sodium dodecylsulfate–polyacrylamide gel electrophoresis; XDP, xanthosine 5'-diphosphate


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Becker, D.J. and Lowe, J.B. (2003) Fucose: biosynthesis and biological function in mammals. Glycobiology, 13, 41R–53R.

Beyer, T.A. and Hill, R.L. (1980) Enzymatic properties of the ß-galactoside {alpha}1Æ2 fucosyltransferase from porcine submaxillary gland. J. Biol. Chem., 255, 5373–5379.[Abstract/Free Full Text]

Breton, C., Oriol, R., and Imberty, A. (1998) Conserved structural features in eukaryotic and prokaryotic fucosyltransferases. Glycobiology, 8, 87–94.[Abstract/Free Full Text]

Costache, M., Apoil, P.A., Cailleau, A., Elmgren, A., Larson, G., Henry, S., Blancher, A., Iordachescu, D., Oriol, R., and Mollicone, R. (1997) Evolution of fucosyltransferase genes in vertebrates. J. Biol. Chem., 272, 29721–29728.[Abstract/Free Full Text]

Coullin, P., Crooijmans, R.P., Groenen, M.A., Heilig, R., Mollicone, R., Oriol, R., and Candelier, J.J. (2002) Assignment of FUT8 to chicken chromosome band 5q1.4 and to human chromosome 14q23.2Æq24.1 by in situ hybridization. Conserved and compared synteny between human and chicken. Cytogenet. Genome Res., 97, 234–238.[Medline]

Felgner, P.L., Gadek, T.R., Holm, M., Roman, R., Chan, H.W., Wenz, M., Northrop, J.P., Ringold, G.M., and Danielsen, M. (1987) Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc. Natl. Acad. Sci. U. S. A., 84, 7413–7417.[Abstract/Free Full Text]

Hayashi, H., Yoneda, A., Asada, M., Ikekita, M., and Imamura, T. (2000) Molecular cloning of mouse {alpha}-1,6-fucosyltransferase and expression of its mRNA in the developing cerebrum. DNA Seq., 11, 91–96.[Web of Science][Medline]

Ihara, H., Ikeda, Y., Koyota, S., Endo, T., Honke, K., and Taniguchi, N. (2002) A catalytically inactive ß1,4-N-acetylglucosaminyltransferase III (GnT-III) behaves as a dominant negative GnT-III inhibitor. Eur. J. Biochem., 269, 193–201.[Web of Science][Medline]

Ikeda, Y., Koyota, S., Ihara, H., Yamaguchi, Y., Korekane, H., Tsuda, T., Sasai, K., and Taniguchi, N. (2000) Kinetic basis for the donor nucleotide-sugar specificity of ß1,4-N-acetylglucosaminyltransferase III. J. Biochem. (Tokyo), 128, 609–619.[Abstract/Free Full Text]

Inamori, K., Endo, T., Gu, J., Matsuo, I., Ito, Y., Fujii, S., Iwasaki, H., Narimatsu, H., Miyoshi, E., Honke, K., and Taniguchi, N. (2004) N-Acetylglucosaminyltransferase IX acts on the GlcNAc ß1,2-Man {alpha}1-Ser/Thr moiety, forming a 2,6-branched structure in brain O-mannosyl glycan. J. Biol. Chem., 279, 2337–2340.[Abstract/Free Full Text]

Javaud, C., Dupuy, F., Maftah, A., Michalski, J.C., Oriol, R., Petit, J.M., and Julien, R. (2000) Ancestral exonic organization of FUT8, the gene encoding the {alpha}6-fucosyltransferase, reveals successive peptide domains which suggest a particular three-dimensional core structure for the {alpha}6-fucosyltransferase family. Mol. Biol. Evol., 17, 1661–1672.[Abstract/Free Full Text]

Kunkel, T.A. (1985) Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. U. S. A., 82, 488–492.[Abstract/Free Full Text]

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685.[CrossRef][Medline]

Longmore, G.D. and Schachter, H. (1982) Product-identification and substrate-specificity studies of the GDP-L-fucose: 2-acetamido-2-deoxy-ß-D-glucoside (FUC goes to Asn-linked GlcNAc) 6-{alpha}-L-fucosyltransferase in a Golgi-rich fraction from porcine liver. Carbohydr. Res., 100, 365–392.[CrossRef][Web of Science][Medline]

Martinez-Duncker, I., Michalski, J.C., Bauvy, C., Candelier, J.J., Mennesson, B., Codogno, P., Oriol, R., and Mollicone, R. (2004) Activity and tissue distribution of splice variants of {alpha}6-fucosyltransferase in human embryogenesis. Glycobiology, 14, 13–25.[Abstract/Free Full Text]

Martinez-Duncker, I., Mollicone, R., Candelier, J.J., Breton, C., and Oriol, R. (2003) A new superfamily of protein-O-fucosyltransferases, {alpha}2-fucosyltransferases, and {alpha}6-fucosyltransferases: phylogeny and identification of conserved peptide motifs. Glycobiology, 13, 1C–5C.

Mita, Y., Aoyagi, Y., Suda, T., and Asakura, H. (2000) Plasma fucosyltransferase activity in patients with hepatocellular carcinoma, with special reference to correlation with fucosylated species of {alpha}-fetoprotein. J. Hepatol., 32, 946–954.[CrossRef][Medline]

Miyoshi, E., Noda, K., Ko, J.H., Ekuni, A., Kitada, T., Uozumi, N., Ikeda, Y., Matsuura, N., Sasaki, Y., Hayashi, N., and others. (1999) Overexpression of {alpha}1-6 fucosyltransferase in hepatoma cells suppresses intrahepatic metastasis after splenic injection in athymic mice. Cancer Res., 59, 2237–2243.[Abstract/Free Full Text]

Miyoshi, E., Noda, K., Yamaguchi, Y., Inoue, S., Ikeda, Y., Wang, W., Ko, J.H., Uozumi, N., Li, W., and Taniguchi, N. (1999) The {alpha}1-6-fucosyltransferase gene and its biological significance. Biochim. Biophys. Acta, 1473, 9–20.[Medline]

Miyoshi, E., Uozumi, N., Noda, K., Hayashi, N., Hori, M., and Taniguchi, N. (1997) Expression of {alpha}1-6 fucosyltransferase in rat tissues and human cancer cell lines. Int. J. Cancer, 72, 1117–1121.[CrossRef][Web of Science][Medline]

Morais, V.A., Costa, M.T., and Costa, J. (2003) N-glycosylation of recombinant human fucosyltransferase III is required for its in vivo folding in mammalian and insect cells. Biochim. Biophys. Acta., 1619, 133–138.[Medline]

Morais, V.A., Serpa, J., Palma, A.S., Costa, T., Maranga, L., and Costa, J. (2001) Expression and characterization of recombinant human {alpha}-3/4-fucosyltransferase III from Spodoptera frugiperda (Sf9) and Trichoplusia ni (Tn) cells using the baculovirus expression system. Biochem. J., 353, 719–725.[CrossRef][Web of Science][Medline]

Murray, B.W., Takayama, S., Schultz, J., and Wong, C.H. (1996) Mechanism and specificity of human {alpha}-1,3-fucosyltransferase V. Biochemistry, 35, 11183–11195.[CrossRef][Medline]

Nakakita, S., Menon, K.K., Natsuka, S., Ikenaka, K., and Hase, S. (1999) ß1-4Galactosyltransferase activity of mouse brain as revealed by analysis of brain-specific complex-type N-linked sugar chains. J. Biochem. (Tokyo), 126, 1161–1169.[Abstract/Free Full Text]

Noda, K., Miyoshi, E., Uozumi, N., Gao, C.X., Suzuki, K., Hayashi, N., Hori, M., and Taniguchi, N. (1998) High expression of {alpha}-1-6 fucosyltransferase during rat hepatocarcinogenesis. Int. J. Cancer, 75, 444–450.[CrossRef][Web of Science][Medline]

Noda, K., Miyoshi, E., Uozumi, N., Yanagidani, S., Ikeda, Y., Gao, C., Suzuki, K., Yoshihara, H., Yoshikawa, K., Kawano, K., and others. (1998) Gene expression of {alpha}1-6 fucosyltransferase in human hepatoma tissues: a possible implication for increased fucosylation of {alpha}-fetoprotein [erratum in: Hepatology 1999;29:301]. Hepatology, 28, 944–952.[CrossRef][Web of Science]

Okajima, T., Xu, A., Lei, L., and Irvine, K.D. (2005) Chaperone activity of protein O-fucosyltransferase 1 promotes notch receptor folding. Science, 307, 1599–1603.[Abstract/Free Full Text]

Oriol, R., Mollicone, R., Cailleau, A., Balanzino, L., and Breton, C. (1999) Divergent evolution of fucosyltransferase genes from vertebrates, invertebrates, and bacteria. Glycobiology, 9, 324–334.

Piwnica-Worms, H. (1987) Expression of proteins in insect cells using baculovirus vectors. In Ausebel, F.M., Brent, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds), Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, NY, pp. 16.8.1–16.11.7.

Qiao, L., Murray, B.W., Shimazaki, M., Schuultz, J., and Wong, C.H. (1996) Synergistic inhibition of human {alpha}-1,3-fucosyltransferase V. J. Am. Chem. Soc., 118, 7653–7662.

Seko, A., Koketsu, M., Nishizono, M., Enoki, Y., Ibrahim, H.R., Juneja, L.R., Kim, M., and Yamamoto, T. (1997) Occurrence of a sialylglycopeptide and free sialylglycans in hen's egg yolk. Biochim. Biophys. Acta., 1335, 23–32.[Medline]

Shao, M.C., Sokolik, C.W., and Wold, F. (1994) Specificity studies of the GDP-[L]-fucose: 2-acetamido-2-deoxy-ß-[D]-glucoside (Fuc->Asn-linked GlcNAc) 6-{alpha}-[L]-fucosyltransferase from rat-liver Golgi membranes. Carbohydr. Res., 251, 163–173.[Medline]

Shields, R.L., Lai, J., Keck, R., O'Connell, L.Y., Hong, K., Meng, Y.G., Weikert, S.H., and Presta, L.G. (2002) Lack of fucose on human IgG1 N-linked oligosaccharide improves binding to human Fc{gamma}RIII and antibody-dependent cellular toxicity. J. Biol. Chem., 277, 26733–26740.[Abstract/Free Full Text]

Shinkai, A., Shinoda, K., Sasaki, K., Morishita, Y., Nishi, T., Matsuda, Y., Takahashi, I., and Anazawa, H. (1997) High-level expression and purification of a recombinant human {alpha}-1,3-fucosyltransferase in baculovirus-infected insect cells. Protein Expr. Purif., 10, 379–385.[CrossRef][Web of Science][Medline]

Shinkawa, T., Nakamura, K., Yamane, N., Shoji-Hosaka, E., Kanda, Y., Sakurada, M., Uchida, K., Anazawa, H., Satoh, M., Yamasaki, M., and others. (2003) The absence of fucose but not the presence of galactose or bisecting N-acetylglucosamine of human IgG1 complex-type oligosaccharides shows the critical role of enhancing antibody-dependent cellular cytotoxicity. J. Biol. Chem., 278, 3466–3473.[Abstract/Free Full Text]

Smithers, N., Kelly, V.A., Witham, S.J., Edbrooke, M.R., and Britten, C.J. (1997) Expression of a secreted form of human {alpha}1,3 fucosyltransferase VII from insect cells. Biochem. Soc. Trans., 25, 426S.

Staudacher, E., Altmann, F., Wilson, I.B., and Marz, L. (1999) Fucose in N-glycans: from plant to man. Biochim. Biophys. Acta, 1473, 216–236.[Medline]

Staudacher, E. and Marz, L. (1998) Strict order of (Fuc to Asn-linked GlcNAc) fucosyltransferases forming core-difucosylated structures. Glycoconj. J., 15, 355–360.[CrossRef][Web of Science][Medline]

Struppe, E. and Staudacher, E. (2000) Occurrence of GDP-L-fucose: ß-N-acetylglucosamine (Fuc to Asn-linked GlcNAc) {alpha}1,6-fucosyltransferases in porcine, sheep, bovine, rabbit and chicken tissues. Biochim. Biophys. Acta, 1475, 360–368.[Medline]

Takahashi, T., Ikeda, Y., Miyoshi, E., Yaginuma, Y., Ishikawa, M., and Taniguchi, N. (2000) {alpha}1,6Fucosyltransferase is highly and specifically expressed in human ovarian serous adenocarcinomas. Int. J. Cancer, 88, 914–919.[CrossRef][Web of Science][Medline]

Takahashi, T., Ikeda, Y., Tateishi, A., Yamaguchi, Y., Ishikawa, M., and Taniguchi, N. (2000) A sequence motif involved in the donor substrate binding by {alpha}1,6-fucosyltransferase: the role of the conserved arginine residues. Glycobiology, 10, 503–510.[Abstract/Free Full Text]

Uozumi, N., Teshima, T., Yamamoto, T., Nishikawa, A., Gao, Y.E., Miyoshi, E., Gao, C.X., Noda, K., Islam, K.N., Ihara, Y., and others. (1996) A fluorescent assay method for GDP-L-Fuc: N-acetyl-ß-D-glucosaminide {alpha}1-6fucosyltransferase activity, involving high performance liquid chromatography. J. Biochem. (Tokyo), 120, 385–392.[Abstract/Free Full Text]

Uozumi, N., Yanagidani, S., Miyoshi, E., Ihara, Y., Sakuma, T., Gao, C.X., Teshima, T., Fujii, S., Shiba, T., and Taniguchi, N. (1996) Purification and cDNA cloning of porcine brain GDP-L-Fuc: N-acetyl-ß-D-glucosaminide {alpha}1Æ6fucosyltransferase. J. Biol. Chem., 271, 27810–27817.[Abstract/Free Full Text]

Voynow, J.A., Kaiser, R.S., Scanlin, T.F., and Glick, M.C. (1991) Purification and characterization of GDP-L-fucose-N-acetyl beta-D-glucosaminide alpha 1-6fucosyltransferase from cultured human skin fibroblasts. Requirement of a specific biantennary oligosaccharide as substrate. J. Biol. Chem., 266, 21572–21577.[Abstract/Free Full Text]

Wang, X., Inoue, S., Gu, J., Miyoshi, E., Noda, K., Li, W., Mizuno-Horikawa, Y., Nakano, M., Asahi, M., Takahashi, M., and others. (2005) Dysregulation of TGF-ß1 receptor activation leads to abnormal lung development and emphysema-like phenotype in core fucose-deficient mice. Proc. Natl. Acad. Sci. U. S. A., 102, 15791–15796.[Abstract/Free Full Text]

Wilson, J.R., Williams, D., and Schachter, H. (1976) The control of glycoprotein synthesis: N-acetylglucosamine linkage to a mannose residue as a signal for the attachment of L-fucose to the asparagine-linked N-acetylglucosamine residue of glycopeptide from alpha1-acid glycoprotein. Biochem. Biophys. Res. Commun., 72, 909–916.[CrossRef][Web of Science][Medline]

Yamaguchi, Y., Fujii, J., Inoue, S., Uozumi, N., Yanagidani, S., Ikeda, Y., Egashira, M., Miyoshi, O., Niikawa, N., and Taniguchi, N. (1999) Mapping of the {alpha}-1,6-fucosyltransferase gene, FUT8, to human chromosome 14q24.3. Cytogenet. Cell Genet., 84, 58–60.[CrossRef][Web of Science][Medline]

Yamaguchi, Y., Ikeda, Y., Takahashi, T., Ihara, H., Tanaka, T., Sasho, C., Uozumi, N., Yanagidani, S., Inoue, S., Fujii, J., and Taniguchi, N. (2000) Genomic structure and promoter analysis of the human {alpha}1,6-fucosyltransferase gene (FUT8). Glycobiology, 10, 637–643.[Abstract/Free Full Text]

Yanagidani, S., Uozumi, N., Ihara, Y., Miyoshi, E., Yamaguchi, N., and Taniguchi, N. (1997) Purification and cDNA cloning of GDP-L-Fuc: N-acetyl-ß-D-glucosaminide: {alpha}1-6 fucosyltransferase ({alpha}1-6 FucT) from human gastric cancer MKN45 cells. J. Biochem. (Tokyo), 121, 626–632.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
H. Ihara, Y. Ikeda, S. Toma, X. Wang, T. Suzuki, J. Gu, E. Miyoshi, T. Tsukihara, K. Honke, A. Matsumoto, et al.
Crystal structure of mammalian {alpha}1,6-fucosyltransferase, FUT8
Glycobiology, May 1, 2007; 17(5): 455 - 466.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
B. Ma, J. L. Simala-Grant, and D. E. Taylor
Fucosylation in prokaryotes and eukaryotes
Glycobiology, December 1, 2006; 16(12): 158R - 184R.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/4/333    most recent
cwj068v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ihara, H.
Right arrow Articles by Taniguchi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ihara, H.
Right arrow Articles by Taniguchi, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?