Skip Navigation


Glycobiology Advance Access originally published online on December 15, 2005
Glycobiology 2006 16(4):271-280; doi:10.1093/glycob/cwj069
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/4/271    most recent
cwj069v2
cwj069v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Oheda, Y.
Right arrow Articles by Itoh, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oheda, Y.
Right arrow Articles by Itoh, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Elimination of abnormal sialylglycoproteins in fibroblasts with sialidosis and galactosialidosis by normal gene transfer and enzyme replacement

Yukako Oheda2, Masaharu Kotani3, Mai Murata3,4, Hitoshi Sakuraba3,4, Yoshito Kadota2, Yutaka Tatano2,4, Jun Kuwahara2 and Kohji Itoh1,2,4

2 Department of Medicinal Biotechnology, Graduate School of Pharmaceutical Sciences, Institute for Medicinal Resources, The University of Tokushima, 1-78 Sho-machi, Tokushima 770-8505, Japan; 3 Department of Clinical Genetics, The Tokyo Metropolitan Institute of Medical Science, Tokyo Metropolitan Organization for Medical Research, 3-18-22 Honkomagome, Bunkyo, Tokyo 113-8613, Japan; and 4 CREST, JST, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012, Japan


1 To whom correspondence should be addressed; e-mail: kitoh{at}ph.tokushima-u.ac.jp

Received on April 27, 2005; revised on November 22, 2005; accepted on December 9, 2005


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Sialidosis and galactosialidosis are lysosomal storage diseases caused by the genetic defects of lysosomal sialidase (neuraminidase-1; NEU1) and lysosomal protective protein/cathepsin A (PPCA), respectively, associated with a NEU1 deficiency, excessive accumulation of sialylglycoconjugates, and development of progressive neurosomatic manifestations; in addition, the latter disorder is accompanied by simultaneous deficiencies of ß-galactosidase and cathepsin A. We demonstrated that a few soluble N-glycosylated proteins carrying sialyloligosaccharides sensitive to glycopeptidase F (GPF) can be specifically detected in cultured fibroblasts from sialidosis and galactosialidosis cases by blotting with a Maackia amurensis (MAM) lectin. We also examined the therapeutic effects of normal gene transfer and enzyme replacement by evaluating the decreases in sialylglycoconjugates accumulated in fibroblasts with these NEU1 deficiencies. The specific N-glycosylated proteins detected on MAM lectin blotting as well as the granular lysosomal fluorescence due to an avidin–FITC/biotinylated MAM lectin conjugate in sialidosis and galactosialidosis fibroblasts disappeared in parallel with the restoration of the intracellular NEU1 activity after transfection of the recombinant NEU1 fused to HA tag sequence and the wild-type PPCA cDNA as well as administration of the recombinant PPCA precursor protein. The detection method for the abnormal sialylglycoproteins in cultured cells involving MAM lectin was demonstrated to be useful not only for biochemical and diagnostic analyses of NEU1 deficiencies but also for therapeutic evaluation of these conditions.

Key words: galactosialidosis / Maackia amurensis lectin / molecular therapy / sialidosis / sialylglycoprotein


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Lysosomal sialidase (neuraminidase-1, NEU1; EC3.2.1.18) catalyzes the hydrolysis of the non-reducing terminal sialic acid residues of sialylglycoconjugates (d’Azzo et al., 2001Go; Thomas, 2001Go). Sialidosis and galactosialidosis are autosomal recessive inborn metabolic errors characterized by a NEU1 deficiency (d’Azzo et al., 2001Go; Thomas, 2001Go). Sialidosis is caused by a primary defect of the NEU1 gene (chromosomal locus, 6p21) and is accompanied by excess sialylglycoconjugates and neurosomatic manifestations. The clinical phenotypes are classified in two groups: type 1 sialidosis is characterized by a relatively mild phenotype with myoclonus and cherry-red spots, and a more severe and early-onset type 2 sialidosis characterized by the appearance of dysmorphic features in addition to myoclonus and cherry-red spots (Thomas, 2001Go).

Galactosialidosis is an autosomal recessive genetic disorder caused by a primary defect of the protective protein/cathepsin A (PPCA; EC3.4.16.1) gene (chromosomal locus, 20q13.1). PPCA forms a multienzymic complex with NEU1 and acid ß-galactosidase (ß-Gal; EC3.2.1.23), activating the former enzyme and stabilizing the latter one. Thus, a defect of PPCA results in a secondary deficiency of NEU1 and ß-Gal in addition to one of intrinsic cathepsin A. Galactosialidosis exhibits quite heterogeneous clinical features, including visual disturbance, cherry-red spots, coarse facies, skeletal dysplasia as well as neurological abnormalities, including myoclonus and cerebellar ataxia, and is clinically divided into three subtypes: the early infantile, late infantile, and juvenile/adult forms, based on the age of onset and severity (d’Azzo et al., 2001Go).

The accumulation of sialylglycoconjugates in lysosomes of various cells derived from patients with NEU1 deficiencies is believed to cause the main clinical manifestations. Analyses of the storage materials in urine and cultured fibroblasts from such patients have been reported (van Pelt, J., Kamerling, J.P., Vliegenthart, J.F.G., Verheijen, F.W., et al., 1988Go; van Pelt et al. 1989Go; Hommes and Varghese, 1991Go; Takahashi et al., 1991Go). Therapeutic experimental trials for NEU1 deficiencies have also been performed in recent years (Zhou et al., 1995Go; Leimig et al., 2002Go; Bonten et al., 2004Go). In these experiments, it was thought to be very important to identify the accumulated sialylglycoconjugates, including sialyloligosaccharides and sialylglycopeptides, in cells from sialidosis/galactosialidosis cases, and to evaluate their cleavage after therapeutic procedures. However, the previous analytical method (van Pelt, J., Kamerling, J.P., Vliegenthart, J.F.G., Verheijen, F.W., et al., 1988Go; van Pelt et al. 1989Go; Hommes and Varghese, 1991Go) used for detecting sialylglycoconjugates requires multi-step procedures, and large quantities of urine and cultured cells from the patients as samples. Recently, we developed an easy and sensitive method for identifying the abnormal sialylglycoconjugates found in NEU1-deficiency fibroblasts (Kotani et al., 2004Go). In this study, we applied this novel technique for the evaluation of therapeutic experiments, including normal gene transfer and recombinant enzyme replacement.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Detection of abnormal sialylglycoproteins in cultured fibroblasts from cases of NEU1 deficiencies by MAM lectin staining
In an earlier study, we demonstrated that the abnormal sialylglycoconjugates in NEU1-deficiency fibroblasts could be detected by staining with a MAM lectin which recognizes sialyl {alpha}2-3-galactose residues (Kotani et al., 2004Go). In this study, we used the above method to further characterize the sialylglycoconjugates observed in fibroblasts derived from patients with type 1 sialidosis (F319), and early infantile (F598) and juvenile/adult galactosialidosis (F622 and F630). As shown in Figure 1A, NEU1 activity was confirmed to be deficient in these fibroblasts, as compared to that of a normal subject (F592). The cathepsin A (serine carboxypeptidase) activity of PPCA was also deficient in the galactosialidosis fibroblasts, whereas it was normal in the sialidosis cells and the normal subject (Figure 1B). No significant change was observed in the activity of ß-hexosaminidase (Hex), which served as a reference enzyme (Figure 1C). As shown in Figure 1D, several broad bands were specifically detected in extracts derived from both sialidosis and galactosialidosis fibroblasts on western blotting under non-reducing conditions with the MAM lectin, among them a few common ones (>200, 114, and 71 kDa), although their intensity differed among the cases. These bands were markedly weaker in normal subjects. To determine whether the bands detected for the cells from cases of NEU1 deficiencies are glycoproteins or not, the cell extracts were treated with glycopeptidase-F (GPF), which specifically cleaves the N-linked oligosaccharides from the glycoproteins. As shown in Figure 1E, the bands stained with the MAM lectin were found to disappear on treatment with GPF, indicating that the sialylglycoconjugates detected on blotting are N-glycosylated proteins.


Figure 1
View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1. Characterization of abnormal sialylglycoconjugates in fibroblasts from patients with sialidosis and galactosialidosis by MAM lectin staining. (A) NEU1, (B) cathepsin A, and (C) ß-hexosaminidase (Hex) activities in cell extracts. Lane 1, type 1 sialidosis (F319); lane 2, early infantile form galactosialidosis (F598); lane 3, juvenile/adult form galactosialidosis (F622); lane 4, juvenile/adult form galactosialidosis (F630); lane 5, normal subject (F592). (D) A blot stained with MAM lectin. Lane 1, type 1 sialidosis (F319); lane 2, juvenile/adult form galactosialidosis (F622); lane 3, juvenile/adult form galactosialidosis (F630); lane 4, early infantile form galactosialidosis (F598); lane 5, normal subject (F592). (E) A blot stained with MAM lectin of an extract treated without (lanes 1, 3, 5, and 7) and with (lanes 2, 4, 6, and 8) GPF. Lanes 1 and 2, T1; lanes 3 and 4, F622; lanes 5 and 6, F319; lanes 7 and 8, standard N-glycosylated protein (Takara, Tokyo, Japan).

 

We also analyzed the intracellular localization of sialylglycoconjugates with an avidin–fluorescein isothiocyanate (Av-FITC)/biotinylated MAM (Av-FITC-MAM) lectin complex and LysoTracker Red (a probe for intracellular acidic compartments). As shown in Figure 2, marked granular green fluorescence was observed in cultured fibroblasts from cases of sialidosis (F319) and galactosialidosis (F622 and F630), but not in normal fibroblasts (F592). Most of such fluorescence merged with that of the LysoTracker Red, indicating that it was distributed in acidic compartments including lysosomes and endosomes. Relatively strong green fluorescence was also observed on the surface of the fibroblasts (F630), while normal control cells showed less fluorescence.


Figure 2
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2. Staining of cultured fibroblasts derived from patients with sialidosis and galactosidosis with Av-FITC-MAM lectin conjugate and Lysotracker Red. Lysotracker Red, staining pattern with Lysotracker Red (red); FITC-MAM, staining pattern with Av-FITC-MAM lectin conjugate (green); Merge, merged images obtained on double staining with these materials. F319, cells derived from the type 1 sialidosis patient; F622, cells derived from the juvenile/adult form galactosialidosis patient; F630, cells derived from the juvenile/adult form galactosialidosis patient; F592, cells from the normal subject. Magnification, 630x.

 

Correction of abnormal sialylglycoproteins in a fibroblastic cell line from a patient with galactosialidosis by normal gene transfer and enzyme replacement
Next we examined the effects of recombinant PPCA gene introduction on elimination of the abnormal sialylglycoproteins in fibroblastic cell line (T1) from a galactosialidosis case. As shown in Figure 3A and B, NEU1 and cathepsin A activities in the T1 cell line were totally absent (lane 1). In contrast, the two enzyme activities were significantly restored in the transformed cell line (T1-PPCA) stably expressing the normal PPCA gene (lane 2), whereas there was no difference in the reference Hex activity (Figure 3A). Figure 3D shows a blot stained with the MAM lectin. Four broad bands (177, 122, 114, and 71 kDa) were detected on the blots of T1 cells (lane 1) as well as on the blots of skin fibroblasts derived from sialidosis and other galactosialidosis patients. In contrast, the intensities of these bands on blots of the T1-PPCA cells were weaker (lane 2). Figure 3E also shows that the granular fluorescence observed in the T1 cell line stained with the Av-FITC-MAM lectin complex was markedly decreased in the case of the T1-PPCA cell line. These results suggest that sialylglycocojugates accumulated in lysosomes of cultured galactosialidosis fibroblasts could also be degraded on normal PPCA gene expression.


Figure 3
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3. Elimination of abnormal sialylglycocojugates in fibroblastic cell lines from cases of sialidosis and galactosialidosis by normal PPCA gene transfer. (A) NEU1, (B) cathepsin A, and (C) ß-hexosaminidase (Hex) activities in cell extracts. (D) A blot of cell extracts stained with the MAM lectin. Arrowheads indicate the abnormal glycoproteins observed in the T1 cell line with galactosialidosis. Bars indicate the molecular masses of the markers. Lane 1, T1 cell extract; lane 2, T1-PPCA cell extract stably expressing normal human PPCA cDNA. (E) Fluorescence patterns of T1 and T1-PPCA cell lines with Av-FITC-MAM lectin conjugate. Magnification, 630x.

 

Furthermore, we examined the decrease in reactivity to the MAM lectin on administration of a recombinant PPCA precursor fraction to skin fibroblasts derived from a galactosialidosis case. As shown in Figure 4A and B, the NEU1 and cathepsin A activities were dose-dependently restored after administration of the recombinant PPCA precursor to the cells (F630), although the Hex activity did not change (Figure 4C). In parallel with the increase in intracellular NEU1 activity, the intensities of the bands of abnormal sialylglycoproteins (177, 114, and 71 kDa) were dose-dependently decreased on the lectin blot (Figure 4D). Dose-dependent elimination of granular fluorescence with the Av-FITC-MAM lectin complex in the galactosialidosis fibroblasts was also observed after the administration of the recombinant proteins (Figure 4E). In addition, the fluorescence on the cell surface seemed to be decreased. Thus, the removal of the abnormal sialylglycoproteins present in the fibroblasts from a galactosialidosis case corresponded to restoration of the functional NEU1 expression on normal PPCA gene transfer and enzyme replacement.


Figure 4
View larger version (49K):
[in this window]
[in a new window]
 
Fig. 4. Correction of abnormal sialylglycocojugates in skin fibroblasts derived from a galactosialidosis patient by recombinant PPCA protein replacement. (A) NEU1, (B) cathepsin A, and (C) ß-hexosaminidase (Hex) activities in cell extracts before and after administration of the recombinant human PPCA precursor fraction. (D) A blot of cell extracts stained with the MAM lectin. Arrowheads indicate the abnormal glycoproteins observed in the galactosialidosis fibroblasts (F622). (E) Fluorescence patterns on staining with Av-FITC-MAM lectin conjugate. Magnification, 630x. Lane and panel 1, F622 cell extract; lane and panel 2, F622 cell extract treated with 0.3 mL of PPCA precursor fraction; lane and panel 3, F622 cell extract treated with 0.6 mL of PPCA precursor fraction prepared as described under Materials and methods.

 

Elimination of sialylglycoconjugates in fibroblasts with sialidosis by the recombinant sialidase-HA fusion gene transfer
We further analyzed the effect of transient expression of the wild-type NEU1 cDNA fused to tag sequence on elimination of sialylglycoconjugates in fibroblasts from a sialidosis case (F319). As shown in Figure 5A, a specific 48-kDa band corresponding to the NEU1-HA fusion protein was observed in the cells transfected with pCX-NEU1-HA expression vector on immunoblotting with anti-HA tag antibody (lane 3), which was hardly detected in the parent F319 cells (lane 1) and mock-transfected cells (lane 2). NEU1 activity was partly restored in the F319 cells after transfection, but the increase in activity was limited because the fibroblasts did not express the SV-40 T-antigen gene (data not shown). Figure 5B showed that the significant granular green fluorescence observed in the F319 cells stained with the Av-FITC-MAM lectin complex disappeared in the cells exhibiting the HA immunoreactivity after transfection with pCX-NEU1-HA vector. These results indicate that sialylglycocojugates accumulated in the fibroblasts with sialidosis could be also eliminated on expression of the wild-type NEU1 gene.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. Decrease of sialylglycoconjugates in fibroblasts from a sialidosis case by normal NEU1 gene transfer. (A) A blot of cell extracts stained with the anti-HA antibody. Arrowhead indicates the recombinant human NEU1-HA fusion protein expressed in the F319 cells with sialidosis. Bars indicate the molecular masses of the markers. Lane 1, F319 cells; lane 2, mock-transfected F319 cells; lane 3, F319 cells transiently expressing the human NEU1-HA cDNA. (B) Fluorescence patterns of F319 and F319-NEU1-HA cells. The cells were immunostained with anti-HA antibody and stained with Av-FITC-MAM lectin conjugate. Magnification, 630x.

 


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Sialidosis and galactosialidosis are NEU1 deficiencies. In these genetic diseases, a defect in the catabolism of sialic acid-containing oligosaccharides causes the intracellular accumulation of sialylglycoconjugates and their overexcretion in the urine (d’Azzo et al., 2001Go; Thomas, 2001Go). Structural analysis of the oligosaccharides in tissues and urine from such patients has demonstrated the characteristic high contents of sialyl {alpha}2-3-galactose and sialyl {alpha}2-6-galactose residues at their non-reducing termini (Kuriyama et al., 1981Go; van Pelt, J., Kamerling, J.P., Vliegenthart, J.F.G., Verheijen, F.W., et al., 1988Go; van Pelt, J., Kamerling, J.P., Vliegenthart, J.F.G., Hoogeveen, A.T., et al. 1988Go, van Pelt et al. 1989Go). However, so far, there have been few simple and useful detection systems for specific storage materials in cells and tissues from patients with NEU1 deficiencies because of the difficulty in sample preparation and analytical methods. On the other hand, recent progress in enzyme-replacement therapies for lysosomal storage diseases, i.e., Gaucher disease and Fabry disease, have indicated the importance of developing systems for evaluating decreases in storage materials in tissues of such patients after therapeutic trials (Barton et al., 1991Go; Schiffmann et al., 2000Go; Eng et al., 2001Go).

Accordingly, a sensitive and easy method for the detection of sialylglycoconjugates is highly required to develop therapies for sialidosis and galactosialidosis. Recently, we developed a novel detection system involving MAM lectin staining for intracellularly accumulated sialylglycoconjugates in fibroblasts from cases of these NEU1 deficiencies (Kotani et al., 2004Go). A previous study showed that strong granular fluorescence was accumulated in skin fibroblasts from cases of these diseases when the cells were stained with the Av-FITC-MAM lectin complex that binds specifically to the sialyl {alpha}2-3-galactose residues of oligosaccharides, and this staining was well correlated with the results of western blotting.

To characterize the abnormal sialylglycoconjugates accumulated in the skin fibroblasts from cases of NEU1 deficiencies, MAM lectin blotting was performed after treatment of fibroblast soluble extracts with GPF. The results revealed that a few specific N-glycosylated proteins carrying highly sialylated oligosaccharides commonly accumulate in NEU1-deficiency fibroblasts. We could not determine clearly in this study whether the intracellular contents of these abnormal glycoproteins themselves increased or not in the NEU1-deficiency fibroblasts. As the staining patterns with other lectins, including Datura stramonium (DSA), Phaseolus vulgaris (PHA), Arachis hypogaea (PNA), wheat germ agglutinin (WGA), and concanavalin A (ConA), were not significantly different between the NEU1 deficiencies and a normal subject (data not shown), an increase in the content of sialic acid residues in the oligosaccharides is considered to be responsible for the increased reactivity to the MAM lectin. We also could not determine what kind of abnormal glycoproteins were present in NEU1 deficiencies. So far, analysis of the glycoproteins accumulated in NEU1 deficiencies has not been performed. It would be interesting to identify these specific sialylglycoproteins by recently developed glycoproteomic profiling using tandem mass spectrometry and to examine their functions, which may help us elucidate some aspects of the molecular pathogeneses of NEU1 deficiencies.

We also demonstrated that the specific sialylglycoproteins detected on MAM lectin staining were significantly decreased after normal gene transfer and enzyme replacement in the sialidosis and galacotosialidosis fibroblasts in parallel with restoration of the intracellular NEU1 activity. For the normal NEU1 gene transfer, we used the NEU1-HA cDNA encoding the human NEU1 protein fused to the HA tag sequence at the carboxyl terminal. The fusion protein retained the NEU1 ability to associate with PPCA to express enzyme activity. Elimination of the specific sialylglycoproteins was also revealed on introduction of the wild-type PPCA cDNA and administration of the PPCA precursor to the galactosialidosis fibroblasts. These results strongly suggest that the abnormal sialylglycoproteins might serve as disease-related marker proteins for NEU1 deficiencies. Thus, the present detection system should be very useful not only for biochemical and diagnostic analyses of NEU1 deficiencies but also for evaluation of therapeutic approaches for the diseases.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Lectins and antibodies used in this study
Biotin-conjugated lectins, including MAM, were purchased from Seikagaku (Tokyo, Japan). LysoTracker Red, a marker probe for lysosomes, was from Molecular Probes, Inc. (Eugene, OR). Anti-HA polyclonal antibody was from Santa Cruz Biotech. Inc. (Santa Cruz, CA). White egg avidin–fluorescein isothiocyanate (Av-FITC) was from BD Bioscience (San Jose, CA). Horseradish peroxidase (HRP)-conjugated avidin was from ICN Pharmaceutical Inc. (Aurora, OH).

Cell culture
Cultured skin fibroblasts from patients with type 1 sialidosis (F319; genotype, V217M/G243R in the NEU1 gene) (Naganawa et al., 2000Go; Itoh et al., 2002Go), a patient with early infantile form galactosialidosis (F598; genotype, Y395C/Y395C in the PPCA gene) (Itoh et al., 1998Go), two patients with juvenile/adult form galactosialidosis (F622 and F630; both genotypes, Int 7, +3a->g/Int 7, +3a->g) (unpublished cases), and a normal control subject (F592) were obtained with informed consent, and the study was approved by the ethical committee of our institution. The fibroblasts were cultured in Ham’s F-10 medium containing 10% fetal calf serum (FCS) and antibiotics at 37°C in a humidified incubator continuously flushed with a mixture of 5% CO2–95% air.

Construction of expression vector encoding NEU1-HA fusion protein cDNA and transfection
The pCXhygro/NEU1-HA encoding the human NEU1 fused to the HA tag sequence at the carboxyl terminal in flame was constructed as follows. First, a set of the synthetic oligonucleotides, including the HA tag sequence, terminal SalI, and KpnI sites with the phosphate group at their 5¢ ends, forward, 5¢-pTCGACCAGATCTGATATCTACCCATACGACGTCCCAGATTACGCTTAGCTAGCGGTAC-3¢; reverse, 5¢-pCGCTAGCTAAGCGTAATCTGGGACGTCGTATGGGTAGATATCAGATCTGG-3¢, were annealed and then subcloned into SalI- and KpnI-restriction site of pBluescript II SK(-) vector plasmid, generating pBluescript II SK(-)/HA. The pCMVß-Sial vector (Naganawa et al., 2000Go) encoding the human NEU1 cDNA was used as a template for PCR with the following primers to create a EcoRI–SalI site and to eliminate the stop codon for NEU1-HA: forward, 5¢-GCAGGAATTCGAGAGATGACTGGGGAGCGA-3¢; reverse, 5¢-GGCAGTGGCACAGTCGACAGTGTCCCATAG-3¢. The amplified cDNA fragment was subcloned into the EcoRI–SalI site of pBluescript II SK(-)/HA, generating pBluescript II SK(-)/NEU1-HA. The coding region of the fused NEU1-HA gene was excised by digestion with EcoRI and SalI and then was blunted. The fused NEU1-HA cDNA was further subcloned into the blunted XhoI site of pCX-hygro vector (Sakuraba et al., forthcomingGo), generating pCXhygro/NEU1-HA plasmid. The F319 fibroblasts (4 x 105 cells) with sialidosis was seeded onto 60 mm dishes 16 h before lipofection. Lipofection was performed according to the manufacturer’s protocol with a mixture comprising the plasmid vector DNA (10 µg) and cationic lipid reagent Unifector (30 µl) (B-bridge International Inc., San Jose, CA). Twenty-four hours after transfection, the cells were washed with FCS-free Ham’s F-10 medium and then cultured in fresh Ham’s F-10 medium containing 10% FCS before immunoblotting and MAM staining.

Establishment of galactosialidosis fibroblastic cells stably expressing recombinant human PPCA
The pCXN2 vector plasmid containing the human wild-type PPCA was prepared, and the lipofection was performed as previously described (Shimmoto et al., 1993Go). Briefly, the ASVGS-1 (T1) cell line (4 x 105 cells) was seeded onto 60-mm dishes 16 h before transfection as described above. Three days after lipofection, the cells were trypsinized and split 1:5 into 100-mm dishes, and then neomycin-resident cell lines were selected in Ham’s F-10 containing 10% FCS and a final 400 µg/mL of G418. The resultant T1 cell line was designated as T1-PPCA.

Administration of human PPCA precursor to galactosialidosis fibroblasts
The recombinant human PPCA precursor was prepared as previously reported (Itoh et al., 2004Go). Briefly, the conditioned medium of a human neuroblastoma GOTO cell line expressing the human PPCA cDNA previously established (Itoh et al., 2004Go) was loaded onto a concanavalin A-conjugated affinity column (Amersham Bioscience, Piscataway, NJ) pre-equilibrated with 20 mM HEPES buffer (pH 7.2) containing 0.5 M NaCl, 1 mM CaCl2, and 1 mM MnCl2. After washing, the adsorbed glycoproteins were eluted with the buffer containing 0.5 M methyl-{alpha}-mannoside (Sigma, St Louis, MO). The eluate was concentrated with an Amicon Ultra-15 (Millipore, Bedford, MA), and then the buffer containing the recombinant PPCA precursor was replaced by FCS-free Ham’s F-10 medium. The precursor protein was monitored by immunoblotting as described previously (Itoh et al., 2004Go). An aliquot of the concentrated PPCA precursor fraction was added to the cultured medium of the galactosialidosis fibroblasts. Four days after the addition, the fibroblasts were harvested, and then the cell extract was prepared by sonication and centrifugation at 20,000 x g for 15 min at 4°C. The resultant supernatant was analyzed by western blotting with a plant lectin, and the enzyme activities were assayed as described below.

Lectin staining and immunofluorescence of cultured fibroblasts
For staining of cultured fibroblasts with a biotin-conjugated MAM lectin, anti-HA antibody, and LysoTracker Red, cells (~4 x 103 cells) were cultured on a Laboratory-Tek chamber slide (Nunc, Naperville, IL) to subconfluency. For double staining with LysoTracker Red, the cells were first treated with LysoTracker Red (250 nM) in the culture medium for 2 h at 37°C, and then fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS; pH 7.4) for 1 h on ice. After the fixing solution had been removed, the cells were washed with PBS and then pretreated with 5% normal goat serum/1% bovine serum albumin (BSA) (Cedarlane Laboratory, Ontario, Canada) in PBS for 1 h at room temperature for blocking. Then, the cells were treated with biotin-conjugated MAM lectin (10 µg/mL) for 1 h and anti-HA polyclonal antibody (5 µg/mL) overnight at 4°C. After washing with PBS, the cells were treated with Av-FITC (1:500 diluted) and rhodamine-labeled anti-rabbit IgG (1:500 diluted) (BIOSOURCE, Camarillo, CA) for 1 h in the dark. The stained cells were examined under a microscope (Axiovert 100M; Carl Zeiss, Oberkochen, Germany) equipped with a confocal laser scanning imaging system (LSM510; Carl Zeiss). In some experiments, the above procedures were performed after treatment with the recombinant PPCA precursor for 4 days and then removal of the unincorporated protein by rinsing with FCS-free Ham’s F-10 medium.

Western blotting of cultured fibroblasts
Cultured fibroblast lysates derived from 5 x 105 cells were prepared by lysing the cells with distilled water, followed by centrifugation of 25,000 x g for 30 min at 4°C. The supernatants were collected and stored at –80°C until used. Protein concentrations were determined with a DC protein assay kit (Bio-Rad Laboratories, Richmond, CA). Cell lysates with boiling were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) under non-reducing or reducing conditions and then electroblotted onto polyvinylidene difluoride membranes (Immobilon; Nippon Millipore, Tokyo, Japan) according to the method of Towbin et al. (Towbin et al., 1979Go).

The blotted membranes were blocked with 50% Block Ace (Dainippon, Tokyo, Japan) in Tris base-buffered saline (TBS), followed by incubation with biotinylated MAM (1.0–5.0 µg/mL; Honen, Tokyo, Japan) for 1 h at room temperature and anti-HA antibody (5 µg/mL) overnight at 4°C. After washing five times with 0.1% Tween-20/TBS, the membranes were incubated with the HRP-conjugated avidin (1:1000 diluted). The MAM-reacting bands were visualized with a chemiluminescent detection system (Western Lightning Chemiluminescence Reagent PLUS; Perkin Elmer Life Sciences, Inc., Boston, MA) according to the manufacturer’s protocol. In another experiment, deglycosylation with GPF (Genzyme, Boston, UK) of cell lysates was performed according to the method of Martin et al. (Martin et al., 1988Go) before SDS–PAGE.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
This work was supported by grants from JST, CREST, the Ministry of Education, Science, Sports and Culture, the Ministry of Health, Labor and Welfare of Japan, the Tokyo Metropolitan Government, and the Japan Society for the Promotion of Science.


    Abbreviations
 
Av-FITC, avidin–fluorescein isothiocyanate; FCS, fetal calf serum; GPF, glycopeptidase F; Hex, lysosomal ß-hexosaminidase; HRP, horseradish peroxidase; MAM, Maackia amurensis; NEU1, lysosomal sialidase (neuraminidase-1); PBS, phosphate-buffered saline; PPCA, protective protein/cathepsin A; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; TBS, Tris base-buffered saline; ß-Gal, acid galactosidase


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Barton, N.W., Brady, R.O., and Dambrosia, J.M. (1991) Replacement therapy for inherited enzyme deficiency-macrophage-targeted glucocerebrosidase for Gaucher’s disease. N. Engl. J. Med., 324, 1464–1470.[Abstract]

Bonten, E.J., Wang, D., Toy, J.N., Mann, L., Mignardot, A., Yogalingam, G. and d’Azzo, A. (2004) Targeting macrophages with baculovirus-produced lysosomal enzymes: implications for enzyme replacement therapy of the glycoprotein storage disorder galactosialidosis. FASEB J., 18, 971–973.[Abstract/Free Full Text]

d’Azzo, A., Andria, G., Strisciuglio, P., and Galjaard, H. (2001) Galactosialidosis. In Scriver, C.R., Beaudet, A.L., Sly, W.S., and Valle, D. (eds), The Metabolic and Molecular Bases of Inherited Disease, 8th ed. McGraw-Hill, New York, Vol. III, pp. 3811–3826.

Eng, C.M., Guffon, N., Wilcox, W.R., German, D.P., Lee, P., Waldek, S., Caplan, L., Linthorst, G.E., and Desnick, R.J. (2001) Safety and efficacy of recombinant human-galactosidase A replacement therapy in Fabry’s disease. N. Engl. J. Med., 345, 9–16.[Abstract/Free Full Text]

Hommes, F.A., and Varghese, M. (1991) High-performance liquid chromatography of urinary oligosaccharides in the diagnosis of glycoprotein degradation disorders. Clin. Chim. Acta, 203, 211–224.[CrossRef][Web of Science][Medline]

Itoh, K., Naganawa, Y., Matsuzawa, F., Aikawa, S., Doi, H., Sasagasako, N., Yamada, T., Kira, J., Kobayashi, T., Pshezhetsky, A.V., and Sakuraba, H. (2002) Novel missense mutations in the human lysosomal sialidase gene in sialidosis patients and prediction of structural alterations of mutant enzymes. J. Hum. Genet., 47, 29–37.[CrossRef][Web of Science][Medline]

Itoh, K., Satoh, Y., Kadota, Y., Oheda, Y., Kuwahara, J., Shimmoto, M., and Sakuraba, H. (2004) Expression of lysosomal protective protein/cathepsin A in a stably transformed human neuroblastoma cell line during bi-directional differentiation into neuronal and Schwannian cells. Neurochem. Int., 44, 447–457.[CrossRef][Web of Science][Medline]

Itoh, K., Shimmoto, M., Utsumi, K., Mizoguchi, N., Miharu, N., Ohama, K., and Sakuraba, H. (1998) Protective protein/cathepsin A loss in cultured cells derived from an early-infantile form of galactosialidosis patient homozygous for the A1184-G transition (Y395C mutation). Biochem. Biophys. Res. Commun., 247, 12–17.[CrossRef][Web of Science][Medline]

Kotani, M., Yamada, H., and Sakuraba, H. (2004) Cytochemical and biochemical detection of intracellularly accumulated sialyl glycoconjugates in sialidosis and galactosialidosis fibroblasts with Macckia amurensis. Clin. Chim. Acta, 344, 131–135.[CrossRef][Web of Science][Medline]

Kuriyama, M., Ariga, T., Ando, S., Suzuki, M., Yamada, T., and Miyatake, T. (1981) Four positional isomers of sialyloligosaccharides isolated from the urine of a patient with sialidosis. J. Biol. Chem., 256, 12316–12321.[Abstract/Free Full Text]

Leimig, T., Mann, L., Martin, M.P., Bonten, E., Persons, D., Knowles, J., Allay, J.A., Cunningham, J., Nienhuis, A.W., Smeyne, R., and d’Azzo, A. (2002) Functional amelioration of murine galactosialidosis by genetically modified bone marrow hematopoietic progenitor cells. Blood, 99, 3169–3178.[Abstract/Free Full Text]

Martin, B.M., Tsuji, S., LaMarca, M.E., Maysak, K., Eliason, W., and Ginns, E.I. (1988) Glycosylation and processing of high levels of active human glucocerebrosidase in invertebrate cells using a baculovirus expression vector. DNA, 7, 99–106.[Web of Science][Medline]

Naganawa, Y., Itoh, K., Shimmoto, M., Takiguchi, K., Doi, H., Nishizawa, Y., Kobayashi, T., Kamei, S., Lukong, K.E., Pshezhetsky, A.V., and Sakuraba, H. (2000) Molecular and structural studies of Japanese patients with sialidosis type 1. J. Hum. Genet. 45, 241–249.[CrossRef][Web of Science][Medline]

Sakuraba, H., Sawada, M., Matsuzawa, F., Aikawa, S., Chiba, Y., Jigami, Y., and Itoh, K. (Forthcoming) Molecular pathologies of and enzyme replacement therapies for lysosomal diseases. Curr. Drug Targets.

Schiffmann, R., Murray, G.J., Treco, D., Daniel, P., Sellos-Moura, M., Myers, M., Quirk, J.M., Zirzow, G.C., Browski, M., Loveday, K., and others (2000) Infusion of alpha-galactosidase A reduces tissue globotriaosylceramide storage in patients with Fabry disease. Proc. Natl. Acad. Sci. USA, 97, 365–370.[Abstract/Free Full Text]

Shimmoto, M., Fukuhara, Y., Itoh, K., Oshima, A., Sakuraba, H., and Suzuki, Y. (1993) Protective protein gene mutations in galactosialidosis. J. Clin. Invest., 91, 2393–2398.[Web of Science][Medline]

Takahashi, Y., Nakamura, Y., Yamaguchi, S., and Orii, T. (1991) Urinary oligosaccharide excretion, and severity of galactosialidosis and sialidosis. Clin. Chim. Acta, 203, 199–210.[CrossRef][Web of Science][Medline]

Thomas, G.H. (2001) Disorders of glycoprotein degradation: {alpha}-mannosidosis, ß-mannosidosis, fucosidosis, and sialidosis. In Sciver, C.R., Beaudet, A.L., Sly, W.S., and Valle, D. (eds), The Metabolic and Molecular Bases of Inherited Diseases, 8th ed. McGraw-Hill, New York, Vol. III, pp. 3507–3533.

Towbin, H., Staehelin, T., and Gordon, T. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA, 76, 4350–4354.[Abstract/Free Full Text]

van Pelt, J., Hard, K., Kamerling, J.P., Vliegenthart, J.F., Reuser, A.J., and Galjaard, H. (1989) Isolation and structural characterization of twenty-one sialyloligosaccharides from galactosialidosis urine. An intact N,N'-diacetylchitobiose unit at the reducing end of a diantennary structure. Biol. Chem. Hoppe Seyler, 370, 191–203.[Web of Science][Medline]

van Pelt, J., Kamerling, J.P., Vliegenthart, J.F.G., Hoogeveen, A.T., and Galjaard, H. (1988) A comparative study of the accumulated sialic acid-containing oligosaccharides from cultured human galactosialidosis and sialidosis fibroblasts. Clin. Chim. Acta, 174, 325–336.[CrossRef][Web of Science][Medline]

van Pelt, J., Kamerling, J.P., Vliegenthart, J.F.G., Verheijen, F.W., and Galjaard, H. (1988) Isolation and structural characterization of sialic acid-containing storage material from mucolipidosis I (sialidosis) fibroblasts. Biochim. Biophys. Acta, 965, 36–45.[Medline]

Zhou, X.Y., Morreau, H., Rottier, R., Davis, D., Bonten, E.J., Gillemans, N., Wenger, D., Grosveld, F.G., Doherty, P., Suzuki, K., and others (1995) Mouse model for the lysosomal disorder galactosialidosis and correction of the phenotype with overexpressing erythroid precursor cells. Genes Dev., 9, 2623–2634.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/4/271    most recent
cwj069v2
cwj069v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Oheda, Y.
Right arrow Articles by Itoh, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oheda, Y.
Right arrow Articles by Itoh, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?