Glycobiology Advance Access originally published online on November 29, 2005
Glycobiology 2006 16(3):221-229; doi:10.1093/glycob/cwj061
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Helicobacter pylori and toll-like receptor agonists induce syndecan-4 expression in an NF-
B-dependent manner
Departments of Medicine, Digestive Health Center of Excellence, and Microbiology, University of Virginia Health System, Charlottesville, VA 22908-0708
1To whom correspondence should be addressed; e-mail: mfs3k{at}virginia.edu
Received on August 11, 2005; revised on November 9, 2005; accepted on November 13, 2005
| Abstract |
|---|
|
|
|---|
The syndecans are a family of transmembrane heparan sulfate proteoglycans (HSPG) that have been implicated in a wide variety of biological functions including the regulation of growth factor signaling, adhesion, tumorigenesis, and inflammation. In the current studies, we examined the regulation of syndecan-4 gene expression in gastric epithelial cells and macrophages in response to infection with live Helicobacter pylori and purified toll-like receptor (TLR) agonists. H. pylori, PAM3CSK4 (a TLR2 agonist), and Escherichia coli flagellin (a TLR5 agonist) all induced the rapid expression of syndecan-4 mRNA in MKN45 gastric epithelial cells. Similarly, lipopolysaccharide (LPS) (a TLR4 agonist) also induced the expression of syndecan-4 in macrophages. The H. pylori- and TLR-induced increase in syndecan-4 mRNA was blocked by the proteosome inhibitor MG-132 suggesting a role for nuclear factor
B (NF-
B) in the regulation of syndecan-4 gene expression. An 895-bp fragment of the human syndecan-4 promoter was cloned upstream of the luciferase reporter. When transfected into MKN45 cells, the activity of this promoter was inducible by H. pylori and TLR agonists. Inducible activity of the syndecan-4 promoter was blocked by cotransfection with a dominant negative I
B
expression plasmid. Electrophoretic mobility shift assays (EMSA) demonstrated the presence of a highly conserved NF-
B-binding site. Mutation of this site within the context of the full-length syndecan-4 promoter resulted in a complete loss of responsiveness to H. pylori and TLR agonists. These results thus demonstrate that the response of the syndecan-4 gene to infectious agents, or their products, is a direct result of NF-
B binding to the promoter and induction of de novo transcription. Key words: Helicobacter / heparan sulfate / NF-KappaB / syndecan / toll-like receptor
| Introduction |
|---|
|
|
|---|
The toll-like receptors (TLRs) are a family of "pattern recognition receptors" which recognize conserved microbial products, such as lipopolysaccharide (LPS), peptidoglycan (PGN), and nonmethylated bacterial DNA (CpG DNA). A common characteristic of the agonists recognized by this receptor family is that they are all highly conserved products of microbial metabolism that are vital to the microbes and as such are not generally susceptible to antigenic variability or mutation. The 10 different TLRs that have been identified in humans are utilized by innate immune response cells to detect the presence of pathogenic microorganisms. In many cases, the microbial agonist has been identified. For example, TLR2 recognizes PGN (Takeuchi et al., 1999
The primary function of the TLRs is to alert the immune system to the presence of pathogenic microorganisms. Stimulation of cells through TLR agonists results in the production of numerous immunologically important cytokines, chemokines, and effector molecules. Additionally, microbial products also induce the expression of costimulatory molecules on professional antigen presenting cells that are necessary for the activation of T and B cells. Thus, in addition to directly controlling the microbial infection, the innate immune response is also instructive to the adaptive immune response. The expression of TLRs is not limited to cell types traditionally thought of as innate immune effectors (i.e., monocytes and macrophages). Members of the TLR family can also be found to be expressed in most organs including the lung, heart, and gastrointestinal tract.
Infection with Helicobacter pylori, a gram-negative, microaerophilic, flagellated bacteria that adheres to human gastric mucosa, is strongly associated with gastric ulcers and adenocarcinoma. The specific clinical outcome is determined by the interplay of H. pylori virulence factors, host gastric mucosal factors, and the environment. The gastrointestinal epithelium plays critical roles in both the transport of nutrients and as an active barrier against infection. As the first line of defense against the microbe-laden external environment, the epithelial cells lining the gastrointestinal tract must be able to sense and respond to potentially pathogenic microorganisms while maintaining tolerance toward the endogenous bacterial flora. Studies from numerous laboratories have now demonstrated that gastric epithelial cell lines do indeed respond to microbial products through the use of TLRs and, as such, can be considered an active part of the innate immune response. Indeed, we have previously demonstrated that live H. pylori induced nuclear factor
B (NF-
B) activation in MKN45 gastric epithelial cells because of ligation of TLR2 and TLR5, but not TLR4 (Smith et al., 2003
).
The syndecans are a family of four type I transmembrane heparan sulfate proteoglycans (HSPG) which, together with the lipid-linked glypicans, represent the major source of heparan sulfate on the cell surface (Tkachenko et al., 2005
). The proteins are four distinct gene products which are organized such that the heparan sulfate chains are placed distal to the cell surface and contain a conserved cytoplasmic COOH-terminal with characteristic serine and tyrosine residues. The syndecans are ubiquitously expressed with most cell types expressing at least one, and often multiple, members of the family. Typically, syndecan-1 is the predominant form on epithelial cells, syndecan-2 is on fibroblasts, and syndecan-3 is on neuronal tissue. Syndecan-4 is more ubiquitously expressed.
The syndecans bind to a wide variety of soluble and insoluble extracellular effector molecules, such as extracellular matrix components, growth factors, cytokines, and microbial pathogens. Likewise, these HSPG have variably been demonstrated to play important roles in facilitating the formation of active signaling complexes by acting as coreceptors to concentrate and present ligands to the cell surface receptors (Bernfield et al., 1999
). In some cases, the proteins, in fact, actively participate in the enhancement of cell signaling. For example, syndecan-4 is found as a component of focal adhesions and plays a central role in the activation of protein kinase C, organization of the actin cytoskeleton, and cell migration (Oh et al., 1998
; Woods et al., 2000
; VanWinkle et al., 2002
; Thodeti et al., 2003
).
Of H. pylori infection, several reports in the literature have pointed toward a role for heparan sulfate-binding proteins on the bacterial surface as participating in the adhesion of H. pylori to cultured cells (Utt and Wadstrom, 1997
). Additionally, one report indicates that the vacuolating toxin of H. pylori, VacA, binds to immobilized heparan sulfate suggesting that HSPG may play a role in mediating the entry of this toxin into cells (Utt et al., 2001
). Because of the suggested role of syndecan-4 as molecule involved in host-defense mechanisms, we sought to determine whether syndecan-4 expression is regulated in response to microbial-derived factors. The studies described below have indicated that expression of the syndecan-4 gene can be induced in response to infection of gastric epithelial cells with either live H. pylori or purified TLR agonists. Furthermore, we have determined that this response is a direct effect of NF-
B binding to a conserved site in the syndecan-4 promoter.
| Results |
|---|
|
|
|---|
Regulation of syndecan-4 mRNA expression in gastric epithelial cells and macrophages
Previously, we have demonstrated that MKN45 gastric epithelial cells respond to H. pylori through TLR2 and TLR5 (Smith et al., 2003
To further explore this response, we utilized quantitative reverse transcriptionpolymerase chain reaction (RTPCR) to assess the effects of stimulation by PAM3CSK4 or FliC on the expression of SDC-4 in MKN45 cells. The results of the representative experiment shown in Figure 1 demonstrated that both the TLR2 agonist (PAM3CSK4) and the TLR5 agonist (FliC) induced a time-dependent increase in the expression of syndecan-4 mRNA. Over several experiments, we have observed increased levels of syndecan-4 mRNA as early as 1 h following stimulation which peaked at
4 6 h and declined to near baseline levels by 2436 h.
|
Because H. pylori has been demonstrated to induce chemokine and NF-
B activation through TLR2 and TLR5 (Smith et al., 2003
|
Previously, Ishiguro et al. (2001)
demonstrated that intraperitoneal injection of LPS resulted in the up-regulation of syndecan-4 in macrophages and microvascular epithelial cells in vivo. Those authors went on to demonstrate that syndecan-deficient mice were more susceptible to LPS-induced shock because decreased ability of transforming growth factor-ß (TGF-ß) to down-regulate interleukin-1ß (IL-1ß) production. To directly assess the potential effects of microbial products on the expression of syndecan-4 in macrophages, we examined the regulation of syndecan-4 mRNA in response to LPS (a TLR4 agonist) in the murine macrophage cell line RAW 264.7. The results of the representative quantitative RTPCR experiment shown in Figure 3 demonstrated that LPS rapidly induced syndecan-4 expression in these cells. The kinetics of this response were more rapid than that observed in the gastric epithelial cells with mRNA levels reaching maximum at 34 h after the stimulation and returning to baseline levels within 8 h. Similar results were observed using primary bone marrow-derived macrophages (data not shown). Taken together, these results demonstrated that syndecan-4 expression is rapidly induced by live bacteria or bacterial products in epithelial cells and macrophages, two cell types which comprise the first line of defense in the innate immune response.
|
NF-
B-dependent regulation of syndecan-4
One hallmark of many of the genes which are rapidly induced through TLRs is that they are regulated at least in part through NF-
B. Previously Zhang et al. (1999)
demonstrated that the tumor necrosis factor-
(TNF-
)-induced syndecan-4 expression in a human umbilical vein endothelial cell line could be decreased by pretreatment with the proteosome inhibitor lactacystin suggesting a role for NF-
B in this response. Likewise, Zhou et al. (2003)
demonstrated that siRNA blockade of NF-
B p65 expression also inhibited TNF-
-dependent increases in syndecan-4 expression in HeLa cells. To determine whether NF-
B was also essential for the increase in syndecan-4 expression observed in response to bacterial products, the experiments shown in Figure 4 were performed. In Figure 4A, MKN45 cells were pretreated with the proteosome inhibitor, MG-132, before infection with H. pylori for 6 h. Similarly, in Figure 4B, MKN45 cells were treated with the proteosome inhibitor before stimulation with PAM3CSK4 or FliC for 6 h. The expression of syndecan-4 mRNA was analyzed by quantitative RTPCR. In both cases, MG-132 treatment resulted in a near complete inhibition of syndecan-4 gene expression. These results, therefore, indicate that microbial-induced syndecan-4 expression in MKN45 cells is dependent upon NF-
B activation.
|
Characterization of a functional NF-
B-binding site in the human syndecan-4 promoter
We next wanted to determine whether the microbial-induced expression of syndecan-4 was, in fact, because of increased transcription of the syndecan-4 gene and whether this response was dependent upon NF-
B. Using the BAC clone RP11358A17 as a template, we PCR amplified a 935-bp fragment of the human syndecan-4 gene corresponding to sequences from 895 to +40, relative to the transcription start site (+1). This fragment was cloned upstream of the luciferase reporter gene. This reporter construct was transiently cotransfected into MKN45 cells with or without a dominant negative I
B expression plasmid, pCMV-I
B S32/36A (Brockman et al., 1995
). This dnI
B construct expresses a mutant I
B
protein which cannot be phosphorylated at serines 32 and 36 and thus renders it insensitive to degradation. The resultant I
B/NF-
B complex is thereby maintained in the cytoplasm. As shown in Figure 5, H. pylori, infection induced a significant (6- to 7-fold) increase in syndecan-4 promoter activity which was nearly completely blocked by cotransfection of I
B-S32/36A. The same effect of IkB S32/36A overexpression was observed on syndecan-4 promoter activity induced in response to PAM3CSK4 or FliC (data not shown). Previously, Zhang et al. (1999)
demonstrated that a 690-bp promoter fragment could generate a 2-fold response to TNF-
in an endothelial cell line. These results therefore indicated that the syndecan-4 gene is transcriptionally up-regulated in response to H. pylori infection and that response is dependent upon NF-
B.
|
Although the results described above and in the literature (Zhang et al., 1999
, 2003
) are consistent with a role for NF-
B in the regulation of syndecan-4 gene expression, neither of the previously published studies formally demonstrated NF-
B binding sites within the promoter of either the mouse or human genes. Both the mouse and the human syndecan-4 genes contain identical potential NF-
B-binding sites (GGGGAATTCC) upstream of the transcription start site: 97 to 88 in human and 84 to 75 in mouse. To determine whether the region of the human syndecan-4 promoter between 97 and 88 is in fact a bona fide NF-
B-binding site, we performed a series of electrophoretic mobility shift assays (EMSA) experiments with nuclear extracts from MKN45 cells. EMSA was performed using a radiolabeled double-stranded oligonucleotide corresponding to sequences of the human syndecan-4 promoter between 112 and 77. In the representative experiment shown in Figure 6A, MKN45 cells were stimulated with live H. pylori for 60 or 120 min, before the isolation of nuclear proteins. This EMSA demonstrated the presence of an H. pylori-inducible complex which was evident 1 h after infection. To confirm that this complex did indeed contain NF-
B proteins, the antibodies specific for two components of the NF-
B complex, p50 and p65, or PU.1 (as a negative control) were added to nuclear extracts from cells infected with H. pylori for 60 min before the addition of radiolabeled probe. Addition of either of the two antibodies specific for NF-
B proteins, but not PU.1 decreased the formation of the inducible complex thus indicating that the H. pylori-inducible complex contained NF-
B p50 and p65. We also examined the ability of stimulation specifically through TLR2 or TLR5 to induce the formation of this complex. In Figure 6B and C, EMSA were performed using nuclear extracts prepared from MKN45 cells stimulated with PAM3CSK4 or FliC for 30 or 60 min. Results of these experiments also demonstrated that the purified TLR agonists could induce NF-
B binding to the syndecan-4 promoter fragment. Furthermore, as shown in the right side of Figure 6B, this complex could be competed using unlabeled oligonucleotides corresponding to the NF-
B site from the Ig
enhancer or the wild-type (WT) syndecan-4 sequence but not by oligonucleotides containing a six base-pair mutation within the syndecan-4 NF-
B site. Taken together, these EMSA studies therefore demonstrated that the human syndecan-4 gene contains a bona fide NF-
B-binding motif.
|
Finally, to determine whether this NF-
B-binding site was indeed functional and involved in the response of the human syndecan-4 gene to H. pylori and TLR agonists, we mutated the NF-
B site in the human syndecan-4 promoter reporter construct to GGctcgagCC. This is the same sequence which was demonstrated in Figure 6B to be incapable of binding NF-
B. Both the WT and m
B reporter constructs were then transiently transfected into MKN45 cells. As shown in Figure 7A, mutation of the NF-
B site resulted in a nearly complete inhibition of inducible promoter activity in responses to H. pylori infection. Likewise, the mutant promoter construct could not be activated in response to stimulation with PAM3CSK4 or flagellin (Figure 7B). These data, therefore, demonstrated that DNA sequences, consistent with an NF-
B-binding site, within the human syndecan-4 promoter were essential for the ability of the gene to respond to bacteria and bacterial products. Notably, mutation of this site had no effect on basal (unstimulated) promoter activity demonstrating a specific role for this NF-
B-binding site in inducible responses.
|
| Discussion |
|---|
|
|
|---|
Several studies have indicated pivotal roles for the syndecans in host defense (Ishiguro et al., 2002
This study examined the expression of syndecan-4 in the gastric epithelial cell line MKN45 in response to infection with H. pylori or stimulation with purified TLR agonists. We observed that the expression of the syndecan-4 mRNA was significantly increased in response to live H. pylori, PAM3CSK4, and flagellin. Furthermore, as suggested by Ishiguro et al. (2001)
, syndecan-4 mRNA expression was also increased in response to LPS treatment of the murine macrophage cell line RAW 264.7. These findings suggest that syndecan-4 may play a significant role in the host defense against microbial infection. A role for LPS-induced syndecan-4 expression in macrophages has been suggested (Ishiguro et al., 2001
). The increased sensitivity of syndecan-4-deficient mice to endotoxic shock was likely because of a decreased ability of their macrophages to down-regulate the expression of IL-1ß in response to TGF-ß, a ligand for syndecan-4. This would imply that syndecan-4 plays a negative regulatory role in the host-immune response.
The role which syndecan-4 might play in the epithelial cell response to microbial infection remains open to speculation. Several different mechanisms can be envisioned. Like many other cell-surface receptors, the syndecan ectodomains are shed from the cell surface both constitutively during heparan sulfate turnover and in a regulated fashion in response to tissue injury, growth factor stimulation, and microbial infection (Subramanian et al., 1997
; Fitzgerald et al., 2000
). These shed ectodomains maintain their abilities to interact with target ligands and alter the ability of these extracellular effectors to induce cellular responses. Many pathogens, including H. pylori, may exploit cell-surface HSPG to bind host cells (Utt and Wadstrom, 1997
; Duensing et al., 1999
; Utt et al., 2001
). Thus induced shedding of syndecan-4 ectodomains may play a protective role by decreasing H. pylori binding to the cell surface. In fact, many studies have demonstrated the increased production of heparin-binding EGF (HB-EGF) in H. pylori-infected tissues (Romano et al., 1998
; Schiemann et al., 2002
; Tuccillo et al., 2002
) which could potentially induce the shedding of syndecans-4 from the cell surface (Fitzgerald et al., 2000
). The physiological role of syndecan-4 in H. pylori infection is currently under investigation in our laboratory.
A second possible role for increased syndecan-4 expression during an inflammatory response may relate to the described abilities of HSPG, including the syndecans, to bind a variety of host-derived growth factors and chemokines (Slimani et al., 2003
; Tkachenko et al., 2005
). It has been proposed that cell-surface heparan sulfates can bind leukocyte chemoattractants and promote leukocyte recruitment through the formation of cell-surface chemokine gradients (Lipscombe et al., 1998
; Gotte and Echtermeyer, 2003
; Gotte, 2003
; Kohrgruber et al., 2004
). Because the primary response of epithelial cells to microbial infection is the production of numerous chemokines, it could be postulated that increases in cell-surface syndecan-4 expression may facilitate the development of chemokine gradients. The establishment of such chemokine gradients is essential for the recruitment of effector leukocytes into the area of infection. Indeed, macrophage and neutrophil recruitment is one of the hallmarks of the H. pylori-induced inflammatory response. Alternatively, as described by Ishiguro et al. (2001)
, syndecan-4 may play a negative feedback role by aiding in the binding of anti-inflammatory molecules. Additionally, HSPG have been demonstrated to bind the important anti-inflammatory cytokine IL-10 and modulate its activity (Salek-Ardakani et al., 2000
). Thus, this ability to bind critical effector molecules has the potential to result in positive or negative effects on the host response to infection.
The other significant findings from this study are the demonstration that microbial-induced syndecan-4 expression is mediated through the activation of NF-
B and the formal identification of a functional NF-
B-binding site within the human syndecan-4 promoter. Previous studies by Zhang et al. (1999)
and Zhou et al. (2003)
have demonstrated an important role for NF-
B activation in the inducible expression of syndecan-4 by TNF-
. However, neither study specifically determined whether NF-
B acts directly to induce syndecan-4 expression or whether the effect on syndecan-4 expression was secondary to the inhibition of NF-
B activity. In this study, we demonstrated that the microbial-induced expression of syndecan-4 is a direct result of NF-
B binding to a conserved site in the proximal promoter region of the gene. By EMSA, we demonstrated that H. pylori, PAM3CSK4, and flagellin could all induce the binding of NF-
B to an oligonucleotide derived from the human syndecan-4 promoter. More importantly, mutation of that NF-
B-binding site resulted in a loss of responsiveness of the syndecan-4 promoter to all three stimuli. Taken together, these results provide the first formal demonstration that NF-
B is directly involved in the regulation of syndecan-4 gene expression. Furthermore, the kinetics of syndecan-4 mRNA induction following microbial stimulation, that is, as early as 1 h, suggest that this is a primary response to infection.
In summary, H. pylori or other related microbial products can induce the expression of syndecan-4 mRNA in gastric epithelial cells and macrophages. The response of the syndecan-4 gene to infection is a direct result of the ability of these microbes and their products to activate NF-
B through interactions with members of the TLR family. Activated NF-
B can then bind directly to a conserved site on the syndecan-4 promoter to enhance transcription of the gene. This response may play an important role in the development of the host response to infection which needs to be investigated further.
| Materials and methods |
|---|
|
|
|---|
Cell culture and transfection
MKN45 cells were purchased from the JCRB Cell Bank (Shinjuku, Japan), and AGS and RAW 264.7 cells were from ATCC (Manassas, VA). AGS cells were cultured in HAMs F-12 + 10% fetal bovine serum (FBS) and MKN45 in RPMI 1640 + 10% FBS (Hyclone, South Logan, UT). MKN45 cells were transfected in 24-well plates using LipofectAmine 2000 (Invitrogen, Carlsbad, CA). Each transfection contained 600 ng syndecan-4/Luc, 50 ng pTK-renilla (Promega, Madison, WI), and 1.5 µL Lipofectamine 2000. Transfections were performed in triplicate, cultured for 24 h, and then stimulated as indicated. Luciferase activities were determined using the dual luciferase kit from Promega and all activities normalized to the activity of the cotransfected TK-renilla plasmid. Transfections with the dominant negative S32/36A I
B plasmid contained, in addition to the luciferase plasmids, 100 ng of either the dnI
B plasmid or the empty pCMV4 vector as a negative control. The S32/36A I
B
plasmid was a gift of Dean Ballard, Vanderbilt University (Nashville, TN).
TLR agonists
PAM3CSK4 was purchased from EMC Microcollections (Tuebingen, Germany). Recombinant His-tagged E. coli flagellin was prepared, as previously described by Donnelly and Steiner (2002)
. The E. coli FliC expression plasmid was a gift from Ted Steiner, University of British Columbia, Vancouver, British Columbia, Canada. Following nickel agarose affinity purification, the protein was concentrated, imidazole removed, and buffer exchanged into phosphate-buffered saline (PBS) using an Amicon Ultra centrifugal filter device (Millipore, Bedford, MA). Finally, endotoxin was removed by chromatography on polymyxin B agarose (Pierce, Rockford, IL). Purity and protein concentration was determined by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE) followed by Coomassie blue staining. Bovine serum albumin was used as a known concentration standard. FliC prepared in this way was devoid of TLR2 or TLR4 agonist activity as determined using HEK293 cells transfected with TLR2 or TLR4, as previously described (Carl et al., 2002
). H. pylori, strain 26695, was from K. Eaton (Ohio State University, Columbus, OH) and was cultured, as previously described (Smith et al., 2003
).
Flow cytometric analysis of syndecan-4 expression
MKN45 cells were stimulated as indicated and removed from the plates by gentle scraping in PBS + 2 mM ethylenediaminetetraacetic acid (EDTA) and stained for flow cytometric analysis essentially, as described by Freissler et al. (2000)
. Cells were incubated with mouse monoclonal 8G3 (a kind gift from G. David, University of Leuven, Leuven, Belgium) (David et al., 1992
) at 30 µg/mL for 1 h in PBS with 2% FBS, 1 mM MgCl2, 0.5 mM CaCl2, washed twice, and then incubated with flourescein isothiocyanate-conjugated goat anti-mouse antibody (Santa Cruz, Santa Cruz, CA). Isotype-matched nonspecific mouse monoclonal was used to assess background staining. Dead cells were excluded based upon staining with 7-amino-actinomycin D.
Cloning of the human syndecan-4 promoter
A bacterial artificial chromosome containing the entire human syndecan-4 gene, RP11358A17, was obtained from the BACPAC Resources Center at the Childrens Hospital Oakland Research Institute (Oakland, CA). A 935-bp fragment of the human syndecan-4 gene was amplified using pfx polymerase (Invitrogen) from the BAC clone using hSDC4 F3 (5'-GCAT AAGCTTCACCTCTCTGGCTCA AGCAGTCCT-3') and hSDC4 + 40R (5'-CGATAAG CTTGGCACCGCG GACTGGAGAAG-3'). The fragment was digested with HindIII and cloned upstream of the luciferase gene in pA3Luc (Maxwell et al., 1989
). The sequence of the cloned promoter was verified by automated DNA sequencing. To generate the promoter containing the mutated NF-
B site, recombinant PCR was performed using the cloned wild-type promoter used as a template. To generate a mutation in the putative NF-
B-binding element, primers hSDC4 m
B F (5'-GGCCTCGCTTCCACTGGCTCGAGCCGGGCGGG GTG-3') and hSDC4 m
B R (the reverse complement of A) were used to mutate six base pairs within the putative NF-
B, thus creating a new XhoI site. PCR 1 was performed with hSDC4 F3 and hSDC4 m
B R. A second reaction was performed with hSDC4 m
B F and hSDC4 + 40R. The resulting PCR products were purified, and equal molar amounts mixed and used as templates in a third PCR using the two outside primers (hSDC4 F3 and hSDC4 + 40R). The final PCR product was digested with HindIII and cloned into pA3Luc.
EMSA
Nuclear extracts were prepared, and EMSA reactions were performed essentially, as previously described (Smith et al., 1998
). Sequences of the oligonucleotides used are summarized in Table I. Antibodies specific for NF-
B p50 (SC-114), p65 (SC-109), and PU.1 (SC-352) were obtained from Santa Cruz and used at 2 µL per reaction. Following electrophoresis, the gels were dried and imaged using A Molecular Dynamics Storm 840 phosphorimager.
|
Quantitative RTPCR
Total RNA was purified using the Trizol reagent (Invitrogen). RT of 0.5 µg of total cellular RNA was performed in a final volume of 20 µL containing 5x first-strand buffer, 1 mM of each dNTP, 20 U of placental RNase inhibitor, 5 µM of random hexamer, and 9 U of MMLV reverse transcriptase (Invitrogen). After incubation at 37°C for 45 min, the samples were heated for 5 min at 92°C to end the reaction and stored at 20°C until PCR use. Two microliters of cDNA was subjected to real-time, quantitative PCR using the MJ Research Opticon system with SYBR Green I (Molecular Probes, Carlsbad, CA) as a fluorescent reporter. Syndecan-4 and hypoxanthine phosphoribosyltransferase (HPRT) cDNAs were amplified in separate reactions. Duplicate PCRs were performed for each sample, and the average threshold cycle number was determined using the Opticon software. Levels of syndecan-4 expression were normalized to HPRT levels using the formula 2(Rt Et), where Rt is the threshold cycle for the reference gene (HPRT), and Et is the threshold cycle for the experimental gene (
CT method). Data are thus expressed as arbitrary units. Sequences for the oligonucleotides used are provided in Table I.
| Acknowledgments |
|---|
|
|
|---|
This work was supported by NIH RO1-AI34358 and American Cancer Society RSG-01-034-01-TBE (M.F.S.).
| Abbreviations |
|---|
EMSA, electrophoretic mobility shift assays; FBS, fetal bovine serum; HPRT, hypoxanthine phosphoribosyltransferase; HSPG, heparan sulfate proteoglycans; IL, interleukin; LPS, lipopolysaccharide; NF-
B, nuclear factor
B; PBS, phosphate-buffered saline; RTPCR, reverse transcriptionpolymerase chain reaction; TLR, toll-like receptor; WT, wild-type| References |
|---|
|
|
|---|
Bernfield, M., Gotte, M., Park, P.W., Reizes, O., Fitzgerald, M.L., Lincecum, J., and Zako, M. (1999) Functions of cell surface heparan sulfate proteoglycans. Annu. Rev. Biochem., 68, 729777.[CrossRef][Web of Science][Medline]
Brockman, J.A., Scherer, D.C., McKinsey, T.A., Hall, S.M., Qi, X., Lee, W.Y., and Ballard, D.W. (1995) Coupling of a signal response domain in I kappa B alpha to multiple pathways for NF-kappa B activation. Mol. Cell Biol., 15, 28092818.[Abstract]
Carl, V.S., Brown-Steinke, K., Nicklin, M.J., and Smith, M.F. Jr. (2002) Toll-like receptor 2 and 4 (TLR2 and TLR4) agonists differentially regulate secretory interleukin-1 receptor antagonist gene expression in macrophages. J. Biol. Chem., 277, 1744817456.
David, G., van der Schueren, B., Marynen, P., Cassiman, J.J., and van den Berghe, H. (1992) Molecular cloning of amphiglycan, a novel integral membrane heparan sulfate proteoglycan expressed by epithelial and fibroblastic cells. J. Cell Biol., 118, 961969.
Donnelly, M.A. and Steiner, T.S. (2002) Two nonadjacent regions in enteroaggregative Escherichia coli flagellin are required for activation of toll-like receptor 5. J. Biol. Chem., 277, 4045640461.
Duensing, T.D., Wing, J.S., and van Putten, J.P. (1999) Sulfated polysaccharide-directed recruitment of mammalian host proteins: a novel strategy in microbial pathogenesis. Infect. Immun., 67, 44634468.
Fitzgerald, M.L., Wang, Z., Park, P.W., Murphy, G., and Bernfield, M. (2000) Shedding of syndecan-1 and -4 ectodomains is regulated by multiple signaling pathways and mediated by a TIMP-3-sensitive metalloproteinase. J. Cell Biol., 148, 811824.
Freissler, E., Meyer auf der Heyde, A., David, G., Meyer, T.F., and Dehio, C. (2000) Syndecan-1 and syndecan-4 can mediate the invasion of OpaHSPG-expressing Neisseria gonorrhoeae into epithelial cells. Cell Microbiol., 2, 6982.[CrossRef][Web of Science][Medline]
Gotte, M. (2003) Syndecans in inflammation. FASEB J., 17, 575591.
Gotte, M. and Echtermeyer, F. (2003) Syndecan-1 as a regulator of chemokine function. ScientificWorldJournal, 3, 13271331.[CrossRef][Medline]
Hayashi, F., Smith, K.D., Ozinsky, A., Hawn, T.R., Yi, E.C., Goodlett, D.R., Eng, J.K., Akira, S., Underhill, D.M., and Aderem, A. (2001) The innate immune response to bacterial flagellin is mediated by toll-like receptor 5. Nature, 410, 10991103.[CrossRef][Medline]
Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000) A toll-like receptor recognizes bacterial DNA. Nature, 408, 740745.[CrossRef][Medline]
Ishiguro, K., Kadomatsu, K., Kojima, T., Muramatsu, H., Iwase, M., Yoshikai, Y., Yanada, M., Yamamoto, K., Matsushita, T., Nishimura, M., and others. (2001) Syndecan-4 deficiency leads to high mortality of lipopolysaccharide-injected mice. J. Biol. Chem., 276, 4748347488.
Ishiguro, K., Kojima, T., and Muramatsu, T. (2002) Syndecan-4 as a molecule involved in defense mechanisms. Glycoconj. J., 19, 315318.[CrossRef][Web of Science][Medline]
Kohrgruber, N., Groger, M., Meraner, P., Kriehuber, E., Petzelbauer, P., Brandt, S., Stingl, G., Rot, A., and Maurer, D. (2004) Plasmacytoid dendritic cell recruitment by immobilized CXCR3 ligands. J. Immunol., 173, 65926602.
Lipscombe, R.J., Nakhoul, A.M., Sanderson, C.J., and Coombe, D.R. (1998) Interleukin-5 binds to heparin/heparan sulfate. A model for an interaction with extracellular matrix. J. Leukoc. Biol., 63, 342350.[Abstract]
Maxwell, I.H., Harrison, G.S., Wood, W.M., and Maxwell, F. (1989) A DNA cassette containing a trimerized SV40 polyadenylation signal which efficiently block spurious plasmid-initiated transcription. Biotechniques, 7, 276280.[Web of Science][Medline]
Oh, E.S., Woods, A., Lim, S.T., Theibert, A.W., and Couchman, J.R. (1998) Syndecan-4 proteoglycan cytoplasmic domain and phosphatidylinositol 4,5-bisphosphate coordinately regulate protein kinase C activity. J. Biol. Chem., 273, 1062410629.
Park, P.W., Pier, G.B., Hinkes, M.T., and Bernfield, M. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature, 411, 98102.[CrossRef][Medline]
Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Du Huffel, C.V.X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., and others. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science, 282, 20852088.
Romano, M., Ricci, V., Di Popolo, A., Sommi, P., Del Vecchio, B.C., Bruni, C.B., Ventura, U., Cover, T.L., Blaser, M.J., Coffey, R.J., and Zarrilli, R. (1998) Helicobacter pylori upregulates expression of epidermal growth factor-related peptides, but inhibits their proliferative effect in MKN 28 gastric mucosal cells. J. Clin. Invest., 101, 16041613.[Web of Science][Medline]
Salek-Ardakani, S., Arrand, J.R., Shaw, D., and Mackett, M. (2000) Heparin and heparan sulfate bind interleukin-10 and modulate its activity. Blood, 96, 18791888.
Schiemann, U., Konturek, J., Assert, R., Rembiasz, K., Domschke, W., Konturek, S., and Pfeiffer, A. (2002) mRNA expression of EGF receptor ligands in atrophic gastritis before and after Helicobacter pylori eradication. Med. Sci. Monit., 8, CR53CR58.
Slimani, H., Charnaux, N., Mbemba, E., Saffar, L., Vassy, R., Vita, C., and Gattegno, L. (2003) Interaction of RANTES with syndecan-1 and syndecan-4 expressed by human primary macrophages. Biochim. Biophys. Acta, 1617, 8088.[Medline]
Smith, M.F. Jr., Carl, V.S., Lodie, T.A., and Fenton, M.J. (1998) Secretory interleukin-1 receptor antagonist gene expression requires both a PU.1 and a novel composite NF-
B/PU.1/GA-binding protein binding site. J. Biol. Chem., 273, 2427224279.
Smith, M.F. Jr., Mitchell, A., Li, G., Ding, S., Fitzmaurice, A.M., Ryan, K., Crowe, S., and Goldberg, J.B. (2003) Toll-like receptor (TLR) 2 and TLR5, but not TLR4, are required for Helicobacter pylori-induced NF-kappa B activation and chemokine expression by epithelial cells. J. Biol. Chem., 278, 3255232560.
Subramanian, S.V., Fitzgerald, M.L., and Bernfield, M. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J. Biol. Chem., 272, 1471314720.
Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K., and Akira, S. (1999) Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity, 11, 443451.[CrossRef][Web of Science][Medline]
Thodeti, C.K., Albrechtsen, R., Grauslund, M., Asmar, M., Larsson, C., Takada, Y., Mercurio, A.M., Couchman, J.R., and Wewer, U.M. (2003) ADAM12/syndecan-4 signaling promotes beta 1 integrin-dependent cell spreading through protein kinase Calpha and RhoA. J. Biol. Chem., 278, 95769584.
Tkachenko, E., Rhodes, J.M., and Simons, M. (2005) Syndecans: new kids on the signaling block. Circ. Res., 96, 488500.
Tuccillo, C., Manzo, B.A., Nardone, G., DArgenio, G., Rocco, A., Di Popolo, A., Della, V.N., Staibano, S., De Rosa, G., Ricci, V., and others. (2002) Up-regulation of heparin binding epidermal growth factor-like growth factor and amphiregulin expression in Helicobacter pylori-infected human gastric mucosa. Dig. Liver Dis, 34, 498505.[CrossRef][Web of Science][Medline]
Underhill, D.M., Ozinsky, A., Smith, K.D., and Aderem, A. (1999) Toll-like receptor-2 mediates mycobacteria-induced proinflammatory signaling in macrophages. Proc. Natl. Acad. Sci. U. S. A., 96, 1445914463.
Utt, M. and Wadstrom, T. (1997) Identification of heparan sulphate binding surface proteins of Helicobacter pylori: inhibition of heparan sulphate binding with sulphated carbohydrate polymers. J. Med. Microbiol., 46, 541546.
Utt, M., Danielsson, B., and Wadstrom, T. (2001) Helicobacter pylori vacuolating cytotoxin binding to a putative cell surface receptor, heparan sulfate, studied by surface plasmon resonance. FEMS Immunol. Med. Microbiol., 30, 109113.[CrossRef][Web of Science][Medline]
VanWinkle, W.B., Snuggs, M.B., De Hostos, E.L., Buja, L.M., Woods, A., and Couchman, J.R. (2002) Localization of the transmembrane proteoglycan syndecan-4 and its regulatory kinases in costameres of rat cardiomyocytes: a deconvolution microscopic study. Anat. Rec., 268, 3846.[CrossRef][Medline]
Woods, A., Longley, R.L., Tumova, S., and Couchman, J.R. (2000) Syndecan-4 binding to the high affinity heparin-binding domain of fibronectin drives focal adhesion formation in fibroblasts. Arch. Biochem. Biophys., 374, 6672.[CrossRef][Web of Science][Medline]
Zhang, Y., Pasparakis, M., Kollias, G., and Simons, M. (1999) Myocyte-dependent regulation of endothelial cell syndecan-4 expression. Role of TNF-alpha. J. Biol. Chem., 274, 1478614790.
Zhou, A., Scoggin, S., Gaynor, R.B., and Williams, N.S. (2003) Identification of NF-kappa B-regulated genes induced by TNFalpha utilizing expression profiling and RNA interference. Oncogene, 22, 20542064.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






