Skip Navigation


Glycobiology Advance Access originally published online on October 26, 2005
Glycobiology 2006 16(2):83-95; doi:10.1093/glycob/cwj051
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/2/83    most recent
cwj051v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tian, E.
Right arrow Articles by Ten Hagen, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, E.
Right arrow Articles by Ten Hagen, K. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Expression of the UDP-GalNAc : polypeptide N-acetylgalactosaminyltransferase family is spatially and temporally regulated during Drosophila development

E. Tian and Kelly G. Ten Hagen1

Developmental Glycobiology Unit, NIDCR, National Institutes of Health, Building 30, Room 4a400, 30 Convent Drive, MSC 4370, Bethesda, MD 20892-4370


1 To whom correspondence should be addressed; e-mail: kelly.tenhagen{at}nih.gov

Received on April 8, 2005; revised on September 30, 2005; accepted on October 18, 2005


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
The UDP-GalNAc : polypeptide N-acetylgalactosaminyltransferase (ppGaNTase or ppGalNAcT or pgant) enzyme family is responsible for the first committed step in the synthesis of mucin-type O-glycans on protein substrates. Previous work from our group has demonstrated both sequence and functional conservation between members of this family in mammals and the fruit fly, Drosophila melanogaster. One member of this family in Drosophila has been shown to be essential for viability and development. In an effort to understand the developmental stages and processes in which O-glycosylation is involved, we have determined the expression pattern of each functional family member as well as putative isoforms during Drosophila development. Our studies indicate that isoforms are expressed in discrete spatial and temporal fashions during development, with some isoforms being found uniquely in restricted areas of the developing embryo (brain, trachea, pharynx, esophagus, proventriculus, and amnioserosa), whereas others are found in multiple regions and overlap with the expression of other isoforms (salivary glands, posterior midgut, anterior midgut, and the fore-/hindgut) during embryogenesis. Additionally, we examined expression patterns in imaginal discs from third instar larvae, which will become the adult structures. Most isoforms are also expressed in the imaginal discs, with some showing unique transcript localization and spatial regulatory control. Thus, this report provides insight into the specific regions during Drosophila development that may require O-linked glycosylation in vivo as well as which isoforms may act cooperatively in certain tissues and which may be uniquely responsible for glycosylation in others.

Key words: development / Drosophila embryogenesis / in situ hybridization / O-glycosylation / pgant


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Mucin-type O-linked glycosylation is initiated by a multigene family of enzymes known as the UDP-GalNAc : polypeptide N-acetylgalactosaminyltransferases (ppGaNTases or ppGalNAcTs in mammals; pgants in Drosophila). Sequence analyses have demonstrated that this posttranslational modification and the enzyme family responsible for it, are highly conserved across species being found in mammals, insects, worms, and some types of fungi (reviewed in Ten Hagen et al., 2003aGo). Amino acid sequence comparison of members of the mammalian and Drosophila families has revealed the existence of orthologous pairs between flies and mammals (Schwientek et al., 2002Go; Ten Hagen and Tran, 2002Go; Ten Hagen et al., 2003aGo,bGo). These orthologs share functional conservation as well, showing similar substrate preferences and preferred sites of addition in in vitro assays (Ten Hagen et al., 2003bGo). Such sequence and functional conservation suggests that members of this family may play key roles in eukaryotic development and validates the use of Drosophila as a model system to dissect the significance of O-linked glycosylation in various developmental processes.

Studies in Drosophila melanogaster have revealed that at least one member of this gene family (pgant35A) is required for viability (Schwientek et al., 2002Go; Ten Hagen and Tran, 2002Go). However, the developmental processes, cellular defects and molecular substrates involved in this lethality remain unknown. In an effort to determine when and where this gene, as well as the other members of this family are required during development, we have performed RNA in situ hybridization of pgant family members during embryonic and larval development. The data that emerge give a picture of the temporal and spatial transcriptional regulation of this gene family and provide insight into the regions within the developing embryo and imaginal discs that may require O-glycans for proper formation and function. Regions of the developing embryo and discs that express multiple isoforms (and hence may be subject to functional compensation), as well as those in which a single isoform is expressed, are defined. Additionally, this information will aid us when searching for specific defects and putative substrates affected in mutants for members of this gene family.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
The family of pgants in Drosophila
Blast searches of the Drosophila genome database reveal 14 putative members of this family that are annotated as such in FlyBase (Table I). Nine of the 14 putative isoforms listed have been shown to have enzymatic activity in vitro, confirming their designation as transferases. Of the remaining five members, three await in vitro confirmation of activity (CG30463, CG10000, and CG31776) but contain conserved residues known to be required for enzymatic activity as defined by prior mutagenesis and structural studies (Hagen et al., 1999Go; Fritz et al., 2004Go). However, two remaining isoforms (CG7304 and CG7579) lack the invariant DXH motif (DAQ in CG7304 and NGH in CG7579) and have alterations in other critical residues within the catalytic domain known to be essential for enzymatic activity (Hagen et al., 1999Go). Moreover, CG7304 and CG7579 lie in proximity to pgant8 in the 71F region of chromosome 3L, suggesting they arose as gene duplications and have acquired sequence changes over time. We therefore analyzed the expression patterns of all the functional and putative transferase genes, with the exception of CG7304 and CG7579, as they most likely represent inactive polypeptide GalNAc transferases.


View this table:
[in this window]
[in a new window]
 
Table I. Drosophila pgants annotated in FlyBase

 

pgant expression during early fly embryogenesis (stages 1–3)
To determine the temporal and spatial expression pattern of pgant genes, we performed whole mount in situ hybridization by using nonradioactive DIG-labeled RNA probes for each functional family member and predicted isoform. Among 12 pgant isoforms, nine showed detectable expression during stages 1–3, representing maternal RNA (pgant1, 2, 3, 4, 7, 8, 35A, CG30463, and CG31776) (Figure 1A, C, E, G, M, O, Q, S, and W). High levels of maternal mRNA were detected for pgant1, 3, 7, and 35A (Figure 1A, E, M, and Q), whereas less staining was seen for pgant2, 4, 8, CG30463, and CG31776 (Figure 1C, G, O, S, and W). No maternal mRNA could be detected for pgant5, 6, and CG10000 at these stages, when compared to the patterns of sense riboprobe controls (Figure 1I–L, U, and V).


Figure 1
View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1. pgant isoform expression during embryonic stages 1–3. Expression patterns using antisense riboprobes (A, C, E, G, I, K, M, O, Q, S, U, and W) and sense riboprobe controls (B, D, F, H, J, L, N, P, R, T, V, and X) for each isoform (labeled on the left) are shown. Orientation of the embryo is anterior to the left, posterior to the right, dorsal is up and ventral is down.

 

pgant expression during cellular blastoderm (stages 4–6)
As development proceeds, a single cell layer surrounding the central yolk develops, representing the blastoderm stage (stages 4–6). pgant1, 7, and 35A are strongly expressed with a very slight anterior gradient (Figure 2A, M, and Q). pgant2, 3, 4, 8, and CG30463 have various levels of expression, with slight anterior gradients seen for pgant3, 8, and CG30463 (Figure 2C, E, G, O, and S). CG31776 shows slight expression in the cell layer surrounding the yolk relative to the sense control (Figure 2W and X). pgant5, 6, and CG10000 still show no detectable expression relative to sense controls during these stages (Figure 2I–L, U, and V).


Figure 2
View larger version (53K):
[in this window]
[in a new window]
 
Fig. 2. pgant expression during cellular blastoderm stages 4–6. Expression patterns using antisense riboprobes (A, C, E, G, I, K, M, O, Q, S, U, and W) and sense riboprobe controls (B, D, F, H, J, L, N, P, R, T, V, and X) for each isoform are shown. Anterior is to the left, and posterior is to the right. Dorsal is up.

 

pgant expression during germ band elongation (stages 9–11)
After cellular blastoderm, the three germ layers are generated during gastrulation (stages 6–8), and a pocket structure is formed by invagination of endoderm and mesoderm cells during germ band elongation (stages 9–11). The cells from the endoderm form the anterior and posterior midgut rudiments, and ectodermal cells form foregut and hindgut. Seven pgant isoforms (pgant1, 3, 4, 5, 7, 8, and 35A) (Figure 3A, E, G, I, M, O, and Q) are expressed in the primordiums of fore-, mid- and hindgut. CG30463 is expressed in the developing anterior midgut and amnioserosa (Figure 3S). CG31776 shows slight expression in the mesoderm relative to the sense control (Figure 3W and X). No expression above background could be detected for pgant2, 6, and CG10000 during these stages (Figure 3C, D, K, L, U, and V).


Figure 3
View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3. pgant expression during germ band elongation stages 9–11. Expression patterns using antisense riboprobes (A, C, E, G, I, K, M, O, Q, S, U, and W) and sense riboprobe controls (B, D, F, H, J, L, N, P, R, T, V, and X) for each isoform are shown. Anterior is to the left, and posterior is to the right. Dorsal is up. amg, anterior midgut rudiment; as, amnioserosa; hg, hindgut primordium; and pmg, posterior midgut rudiment.

 

Expression of pgant in tissue-specific patterns during germ band retraction (stages 12–13)
At stage 12, the germ band begins to retract, and internal structures continue to form. The germ band retraction ends at stage 13, when the cells of most organ primordia begin to differentiate. As the primordia of the salivary glands invaginates from ectodermal cells at stage 12, expression of pgant1, 5, 6, 7, 35A, and CG30463 is detected in the glands and continues throughout most of embryogenesis (Figure 4A, B, I–L, M, N and Q–T). Posterior midgut and hindgut expression is still seen for pgant1, 5, 7, 8, and 35A at these stages (Figure 4A, B, I, J, and M–R). Additionally, pgant6 expression is now first seen in the salivary glands and posterior midgut and hindgut (Figure 4K and L). pgant3 expression is found uniquely in the posterior spiracle (Figure 4E and F). Specific expression in the developing tracheal branches and brain is seen for pgant2 at this stage (Figure 4C and D). pgant4 also shows specific expression in the proventriculus that continues until the end of embryogenesis (Figure 4G and H). CG30463 is still expressed in the amnioserosa region during dorsal closure (Figure 4S and T). Very weak expression of CG31776 was seen in the somatic mesoderm region (Figure 4W and X). No specific expression could be detected For CG10000 (Figure 4U and V). No substantial signal is seen for the sense control probes (Figure 4A'–L').


Figure 4
View larger version (78K):
[in this window]
[in a new window]
 
Fig. 4. pgant expression during germ band retraction at stages 12–13. Expression pattern of antisense riboprobe (AX) and sense riboprobe control (A9L9) for each isoform is shown. Lateral (A, C, E, G, I, K, M, O, Q, S, U, and W) and dorsal views (B, D, F, H, J, L, N, P, R, T, V, and X) are presented. Anterior is to the left, and posterior is to the right. as, amnioserosa; br, developing brain; pv, proventriculus; ps, posterior spiracle; sg, salivary glands; and tb, tracheal branch.

 

pgant expression during stages 14–15
From stage 14–15, the head complex vanishes from the surface into the interior of the embryo, and dorsal closure is completed by the invagination of the amnioserosa. Hindgut expression is weaker but continues for pgant1, 5, 6, 7, 8, and 35A (Figure 5A, B, I–N, Q and R). Salivary gland expression continues for pgant1, 5, 6, 7, 35A, and CG30463 during these stages (Figure 5A, B, I–N, and Q–T). pgant5 expression is also seen in the posterior spiracles (Figure 5I and J). CG30463 shows diffuse posterior staining, possibly due to remaining amnioserosa (Figure 5S and T). Specific expression in the dorsal longitudinal trachea is seen for pgant2 (Figure 5C and D). pgant3 expression is seen now in the pharynx, esophagus, and posterior spiracles (Figure 5E and F). pgant4 expression continues to be seen in the proventriculus (Figure 5G and H). No expression was detected for CG10000 or CG31776 (Figure 5U, V, K', W, X, and L').


Figure 5
View larger version (77K):
[in this window]
[in a new window]
 
Fig. 5. pgant expression during head involution and dorsal closure at stages 14–15. Expression patterns using antisense riboprobes (AX) and sense riboprobe controls (A9L9) for each isoform are shown. Lateral (A, C, E, G, I, K, M, O, Q, S, U, and W) and dorsal views (B, D, F, H, J, L, N, P, R, T, V, and X) for each antisense riboprobe are presented. Anterior is to the left, and posterior is to the right. sg, salivary glands; dlt, dorsal longitudinal trachea; ph, pharynx; es, esophagus; ps, posterior spiracles; and pv, proventriculus.

 

pgant expression during differentiation (stages 16–17)
Salivary gland expression continues for pgant1, 5, 6, 35A, and CG30463 (Figure 6A, B, I–L, and Q–T). pgant 1, 5, 6 and 7 expression is also now detected in the antennomaxillary complex (Figure 6A, B, and I–N). Expression in the posterior spiracles is now seen for pgant1, 3, 5, and 35A (Figure 6A, B, E, F, I, J, Q, and R). Specific expression of pgant2 in the trachea (Figure 6C and D) and pgant4 in the proventriculus (Figure 6G and H) continues to be seen. pgant35A expression is now seen in the dorsal tracheal trunk as well (Figure 6Q and R). Expression in the epidermis is detected for pgant3, 5, 6, 7, and CG31776 (Figure 6E, F, I–N, W, and X), but this signal may be due to nonspecific binding as the epidermal tissue is known to be subject to background staining. CG10000 expression is first detected very weakly in the midgut (Figure 6U and V). All pgant embryonic expression patterns are summarized in Table II.


Figure 6
View larger version (77K):
[in this window]
[in a new window]
 
Fig. 6. pgant expression during differentiation at stages 16–17. Expression patterns using antisense riboprobe (AX) and sense riboprobe control (A9L9) for each isoform are shown. Lateral (A, C, E, G, I, K, M, O, Q, S, U, and W) and dorsal views (B, D, F, H, J, L, N, P, R, T, V, and X) of each antisense riboprobe are presented. Anterior is to the left. sg, salivary glands; dlt, dorsal longitudinal trachea; pv, proventriculus; amx, antennomaxillary complex; ph, pharynx; es, esophagus; and ps, posterior spiracles.

 

View this table:
[in this window]
[in a new window]
 
Table II. Summary of pgant expression during Drosophila embryogenesis

 

pgant expression in third instar larval imaginal discs
From fate map studies, imaginal discs of the larvae derive from the embryonic epidermal invaginations and will eventually form the structures of the adult fly. We examined the expression of the pgant genes in four major imaginal discs of third instar larvae. Ten of the twelve pgant isoforms (pgant1, 2, 3, 4, 5, 6, 7, 35A, CG30463, and CG31776) are expressed in third instar imaginal discs. No imaginal disc expression could be detected for pgant8 or CG10000 (Figure 7). pgant 4, 5, 6, and 7 are ubiquitously expressed in all discs, with pgant4 expression being weak (Figure 7). However, the remainder of the isoforms showed varying extents of localized expression within discs, which are described in more detail below.


Figure 7
View larger version (49K):
[in this window]
[in a new window]
 
Fig. 7. pgant expression in imaginal discs from third instar larvae. The name of each isoform is listed to the left. Imaginal discs are labeled at the top as follows: wing disc (first and second columns); eye–antennal disc (third and fourth columns); leg disc (fifth and sixth columns); and haltere disc (seventh and eighth columns). Antisense riboprobes are shown in the first, third, fifth, and seventh columns. Sense riboprobe controls are shown in the second, fourth, sixth, and eighth columns. Orientation of the wing disc is anterior to the left and posterior to the right. Orientation of the eye–antennal disc is anterior to the top and posterior to the bottom.

 

pgant expression in wing imaginal discs
The wing imaginal disc will give rise to many adult structures including the wing blade, hinge, pleura, notum, and flight muscles. In addition to the ubiquitous expression of pgant 4, 5, 6, 7, 35A, and CG31776, pgant1 shows increased levels of expression in the presumptive pleura and notum. pgant2 expression is present in clusters of cells in the presumptive pleura and notum. pgant3 and CG30463 have enhanced levels of expression in the notum and ventral wing pouch. Additional CG30463 expression is also detected in the hinge region (Figure 7).

pgant expression in eye–antennal imaginal discs
The eye-antennal disc will form the adult head, antennae, and eye structures. pgant1, 3, 4, 5, 6, 7, 35A, and CG31776 show ubiquitous expression throughout the presumptive eye, antennal, and head regions of these discs. However, pgant2 shows a very distinct band of expression at the morphogenic furrow and weaker expression in the presumptive eye posterior to the furrow; no expression is detected in the presumptive antennal or head region anterior to the furrow. Additionally, CG30463 expression is detected in the presumptive eye region only (Figure 7).

pgant expression in leg and haltere imaginal discs
Leg imaginal discs give rise to the legs and body wall structures of the adult fly. Haltere imaginal discs form the halteres, an organ on each side of the fly that aids in maintaining balance. pgant1, 3, 4, 5, 6, 7, 35A, CG30463, and CG31776 are all expressed ubiquitously to varying degrees in the leg and haltere imaginal discs. Additionally, slightly higher expression for pgant1 is seen in the periphery of the leg disc. No expression above background is detected in the leg or haltere discs for pgant2 (Figure 7). All pgant imaginal disc expression patterns are summarized in Table III.


View this table:
[in this window]
[in a new window]
 
Table III. Summary of pgant expression in imaginal discs

 


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
In this report, we describe the embryonic and imaginal disc expression patterns of 12 members of the Drosophila melanogaster UDP-GalNAc : polypeptide N-acetylgalactosaminyltransferase gene family (summarized in Table I). The pgant family of enzymes is responsible for the first committed step in the synthesis of mucin-type O-glycans in many organisms. One member of this family has been shown to be essential for viability and development in Drosophila (Schwientek et al., 2002Go; Ten Hagen and Tran, 2002Go). Although semi-quantitative polymerase chain reaction (PCR) analysis has shown various expression levels during embryonic, larval, pupal, and adult stages of Drosophila development (Ten Hagen et al., 2003bGo), this does not address the specific time and areas where expression of each isoform takes place. To define the regions and times during development most likely to be affected by mutations in these genes and to catalog the potential for functional redundancy amongst family members during embryogenesis and metamorphosis, we have determined the temporal and spatial expression patterns of this family by in situ hybridization.

While 14 putative members of this family are found upon performing blast homology searches against the Drosophila genome, two of these (CG7304 and CG7579) lack the invariant "DXH" motif known to be required for transferase activity, as well as other highly conserved or invariant residues known to be crucial (Hagen et al., 1999Go). These isoforms are clustered in the 71F region of chromosome 3L, suggesting that they arose by gene duplication events and have since acquired mutations rendering them no longer functional. Our studies were therefore, confined to the 12 members that represent proven or potentially functional transferases.

In situ hybridizations reveal that some members (pgant1, pgant3, pgant7, and pgant35A) are highly represented as maternal RNA transcripts. This suggests that their presence early in development might be necessary. In later stages (9–11), there is a great deal of overlap in expression in the developing anterior midgut, posterior midgut, foregut, and hindgut regions, with seven of the nine confirmed isoforms and one predicted isoform being expressed there. Additionally, five of the nine confirmed isoforms and one predicted isoform show very high or moderate levels of expression in the developing salivary glands, beginning at stages 12–13. Although much information exists regarding the migration and development of salivary glands and onset of salivary gland secretion during Drosophila embryogenesis (Andrew et al., 2000Go), little is known regarding the role of O-glycosylation in these processes. Our results point to extensive O-glycosylation occurring within the salivary gland and digestive tract during development and suggests the presence of a great deal of functional redundancy.

Although most (but not all) isoforms are expressed in the developing digestive tract and salivary glands, there are some very unique expression patterns that emerge for certain members of this family. These members, in particular, may represent good targets for determining function of these transferases in a single tissue or region, by avoiding the complications associated with the expression of other family members in the same tissue. For example, pgant3 is uniquely expressed in the pharynx and esophagus at stages 14–17. Additionally, pgant2 expression is first detected in the developing tracheal branches during stages 12–13 and continues to be expressed in the dorsal trachea throughout the remainder of embryonic development. pgant35A expression is also detected in the dorsal longitudinal trachea at stages 16–17. One of the putative transferases, CG30463, is uniquely expressed in the amnioserosa, suggesting its involvement in the migration and attachment of cells during the process of dorsal closure. pgant4 also displays unique expression, being found in the proventriculus at stage 13 and increasing in expression there throughout the rest of embryonic development. Interestingly, members of the core-1 ß1–3 galactosyltransferase family, which modify the O-linked GalNAc by the addition of a ß1–3-linked galactose, are also expressed very specifically in the amnioserosa (CG9520) (Muller et al., 2005Go) and proventriculus (CG7440) (from the Berkeley Drosophila Genome Project [BDGP] In Situ Expression Database), suggesting a role for the O-linked core-1 structure in both dorsal closure and proventricular development.

Two of the nine isoforms had in situ hybridization patterns present on the BDGP In Situ Expression Database (pgant1 and pgant7). For pgant1, our results are in agreement, but we also detect expression in the anterior and posterior midgut, hindgut, posterior spiracles, and antennomaxillary complex; additionally, we do not see substantial epidermal staining. For pgant7, our results agree with maternal staining and epidermal expression, but we also see expression in the midgut, hindgut, salivary glands, and antennomaxillary complex. It is unclear what probes were used in the BDGP expression studies, but additional expression detected in our study may reflect sensitivity differences.

Previous studies examining lectin staining patterns during Drosophila development support our expression data for the pgant family members. Embryos incubated with SBA lectin (which detects GalNAc) resulted in staining of salivary glands, trachea, posterior midgut, and spiracles (Fredieu and Mahowald, 1994Go). Studies by D’Amico and Jacobs (1995)Go also showed staining to foregut, hindgut, trachea and esophagus and pharynx. However, staining with PNA (which detects the core1 structure, Galß1,3 GalNAc) detected predominantly neuronal structures and the brain (Fredieu and Mahowald, 1994Go; D’Amico and Jacobs, 1995). Although we detected some expression in the brain (pgant2), we did not see expression in other neuronal structures. This may be due to levels below our limits of detection in these cells. Our data provides information as to which specific isoform(s) are responsible for glycosylating proteins present in these developing tissues.

Drosophila imaginal discs are derived from invaginations of the embryonic epidermis. During larval stages and metamorphosis, the cells of the imaginal discs undergo extensive proliferation and pattern formation to eventually generate the structures of the adult fly. As an experimental model, imaginal discs are quite useful for understanding the genetic control of organ growth and differentiation as well as the signaling pathways involved in pattern formation (Ramirez-Weber and Kornberg, 2000Go; Weinkove and Leevers, 2000Go; Affolter et al., 2001Go). Our in situ hybridization data showed that most of pgant family members (pgant1, 2, 3, 4, 5, 6, 7, and 35A) and two predicted isoforms (CG30463 and CG31776) are expressed in the third instar larval imaginal discs, implying a role for mucin-type O-glycosylation during disc growth and differentiation. Two isoforms (pgant8 and CG10000) are not expressed in any imaginal disc, suggesting they are dispensable for imaginal disc development. Interestingly, a number of isoforms show very specific spatial expression patterns in certain discs. For example, pgant1, 2, 3, and CG30463 were specifically expressed in regions of the wing disc destined to become the wing blade, wing hinge, or body wall. It will be interesting to interrogate the role of each isoform in the development of the wing, as much is known regarding the signaling pathways that operate there. Additionally, pgant2 and CG30463 have expression patterns specific to the presumptive eye; CG30463 is found in the eye region only while pgant2 expression is highest in the morphogenic furrow (a moving band of cells that will differentiate into photoreceptors) and the eye region posterior to the furrow, where cells have already differentiated into photoreceptors. The expression within the furrow mimics that seen for the transforming growth factor-ß (TGF-ß) superfamily member decapentaplegic (dpp), a secreted molecule that acts as an inducer of Drosophila eye development (Pignoni and Zipursky, 1997Go; Affolter et al., 2001Go). Additionally, two other glycosyltransferases (OFUT1 and fringe), which are known to modify Notch signaling, are also expressed in the eye disc (Cho and Choi, 1998Go; Bruckner et al., 2000Go; Moloney et al., 2000Go; Okajima and Irvine, 2002Go). The expression pattern seen for CG30463 and pgant2 strongly suggest a role for mucin-type O-glycosylation in the signaling pathways controlling eye development.

The biological import of this enzyme family remains to be elucidated. One member of this family clearly has physiological consequences in humans; ppGaNTase-T3 is associated with the disease familial tumoral calcinosis, which results in hyperphosphatemia and spontaneous subdermal tumors (Topaz et al., 2004Go). However, the mechanism by which ppGaNTase-T3 is involved in disease manifestation as well as the significance of other members of the family is still unknown. Mice deficient in other ppGaNAcTs (T1, T4, T5, and T13) remain viable and fertile, with no obvious phenotypic abnormalities (unpublished data; Hennet et al., 1995Go; Zhang et al., 2003Go). We previously described the mRNA expression of murine ppGaNTases during embryonic development, demonstrating both unique expression patterns and extensive overlap in expression amongst the isoforms (Kingsley et al., 2000Go). While these individual enzymes likely play key roles in the modification of substrates within the animal, the redundancy generated by a family of this size may allow for the loss of one or a few members, without severe developmental consequences. Knowing when and where each transferase is expressed relative to the other family members aids us in not only focusing on tissues and times during development when O-glycans are needed, but also where functional redundancy may play a role. With regard to the pgant35A, the isoform known to be essential in Drosophila, our expression results point to a role for this enzyme in both embryonic development and later in the imaginal tissues destined to become the adult structures. Further phenotypic analysis of this mutant will now be centered around the stages and organ systems where this gene is expressed. Additionally, comparing the expression patterns of the pgant genes to those of other genes using bioinformatics tools may allow the identification of similarly expressed genes and provide insights into potential in vivo substrates of these enzymes (Klebes et al., 2002Go; Gurunathan et al., 2004Go).


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Preparation of Drosophila pgants RNA probes
Previously cloned and characterized pgant cDNAs (Ten Hagen et al., 2003bGo) present in the pBluescript SK+ and KS+ vector (Stratagene) were used to generate RNA probes for in situ hybridization. cDNA clones of pgant3 (GH09147) (GenBank AF145655 [GenBank] ), pgant4 (AT25481), and pgant8 (RE06471) (GenBank AY070966 [GenBank] ) were purchased from Research Genetics (Invitrogen). All riboprobes were synthesized using the DIG RNA labeling kit (Roche). Briefly, pgant1 cDNA (Fly-4a) was linearized with SpeI and transcribed by T7 RNA polymerase (to generate the antisense probe) or linearized with XhoI and transcribed with T3 polymerase (to generate the sense probe). pgant 2 cDNA (FlyC-1a) was linearized with SpeI or EcoRI and transcribed by T7 RNA polymerase (antisense probe) or linearized with XhoI and transcribed by T3 RNA polymerase (sense probe). pgant3 cDNA (GH09147) was linearized with EcoRI and transcribed by T7 RNA polymerase (antisense probe) or linearized with XhoI and transcribed by T3 polymerase (sense probe). pgant4 cDNA (AT25481) was linearized with EcoRI and transcribed by T3 RNA polymerase (antisense probe) or linearized with NotI and transcribed by T7 RNA polymerase (sense probe). pgant5 cDNA (pBSFlyE) was linearized with SpeI and transcribed by T7 RNA polymerase (antisense probe) or linearized with XhoI and transcribed by T3 RNA polymerase (sense probe). pgant6 cDNA (FlyF-1a) was linearized with EcoRI and transcribed by T7 RNA polymerase (antisense probe) or linearized with XhoI and transcribed by T3 polymerase (sense probe). pgant7 cDNA (Fly-42a) was linearized with EcoRI and transcribed by T7 RNA polymerase (antisense probe) or linearized with XhoI and transcribed by T3 polymerase (sense probe). pgant8 cDNA (RE06471) was linearized with XhoI and transcribed by T3 RNA polymerase (antisense probe) or linearized by BamHI and transcribed by T7 polymerase (sense probe). pgant35A cDNA was linearized with XhoI and transcribed by T3 RNA polymerase (antisense probe) or linearized with NotI and transcribed by T7 polymerase (sense probe). CG30463 cDNA was linearized with NotI and transcribed by T7 RNA polymerase (antisense probe) or linearized with SalI and transcribed by T3 polymerase (sense probe). CG10000 cDNA was linearized with XhoI and transcribed by T3 RNA polymerase (antisense probe) or linearized with BamHI and transcribed by T7 polymerase (sense probe). CG31776 cDNA was PCR amplified using the primers CG31776–1285S (dAATTA ACCCTCACTAAAGGGTACGACAAGAATCCGAA GC) and CG31776–1796AS (dTAATACGACTCACTATAG GGTTGCCAACCTTATGACCAC), containing T3 and T7 promoters, respectively. The 512-bp PCR product was used directly to synthesize riboprobes using T3 (sense) or T7 (antisense) polymerases.

Collection and fixation of fly embryos and third instar larval imaginal discs
Embryos were collected at 6 and 18 h after egg lay on grape juice agar plates. The embryos were dechorionated and fixed according to Tautz and Pfeifle (1989)Go. Briefly, embryos were dechorionated in 100% bleach for 1–3 min. After rinsing with water, embryos were transferred to 2.5 mL of 4% formaldehyde, 160 mM KCl, 40 mM NaCl, 4 mM EGTA, 30 mM Pipes. To this mixture, 2.5 mL heptane was added, and then embryos were vortexed vigorously for 20–25 min. The lower aqueous phase was removed, and 4 mL methanol was added to break the vitelline membrane. The embryos were then transferred and stored in methanol at –20°C. The imaginal discs were dissected from third instar wandering larvae, fixed with 4% formaldehyde plus 50 mM EGTA for 30 min, rinsed with methanol and ethanol, and stored in ethanol at –20°C.

Whole mount in situ hybridization
Whole mount fly embryo in situ hybridization was performed as previously described (Tautz and Pfeifle, 1989) with modifications to the 3-day procedure. Briefly, fixed embryos were treated with formaldehyde/PBT (PBS with 0.1% Tween 20), then with 50 µg/mL Proteinase K for 3–5 min and then fixed again with 4% formaldehyde/PBT. Hybridization was performed at 60°C overnight using 0.1 µg/mL DIG RNA probe for individual isoforms. Washing was performed with serial dilutions of the hybridization buffer in PBT the next day. Embryos were then incubated with anti-DIG-AP antibody (Roche, 1:2000 in PBT) overnight at 4°C. Wash and color development was performed using BM Purple AP substrate (Roche). Embryos were equilibrated in 70% glycerol/PBT and stored at 4°C until mounting and photography. Embryo staging was performed according to Hartenstein (1993)Go. The procedure for whole mount imaginal disc in situ hybridization is the same as described above for embryos, except that acetone was used in place of Proteinase K (Nagaso et al., 2001Go). Imaginal discs were dissected under stereoscope after staining and mounted as described above.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
We thank Dr. Lawrence Tabak and Dr. Judy Kassis for very helpful discussions.


    Abbreviations
 
GalNAc, N-acetylgalactosamine; kb, kilobase(s); PCR, polymerase chain reaction; ppGaNTase or ppGalNAcT or pgant, UDP-GalNAc : polypeptide N-acetylgalactosaminyltransferase


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Affolter, M., Marty, T., Vigano, M.A., and Jazwinska, A. (2001) Nuclear interpretation of Dpp signaling in Drosophila. EMBO J., 20, 3298–3305.[CrossRef][Web of Science][Medline]

Andrew, D.J., Henderson, K.D., and Seshaiah, P. (2000) Salivary gland development in Drosophila melanogaster. Mech. Dev., 92, 5–17.[CrossRef][Web of Science][Medline]

Bruckner, K., Perez, L., Clausen, H., and Cohen, S. (2000) Glycosyltransferase activity of fringe modulates Notch-Delta interactions. Nature, 406, 411–415.[CrossRef][Medline]

Cho, K.O. and Choi, K.W. (1998) Fringe is essential for mirror symmetry and morphogenesis in the Drosophila eye. Nature, 396, 272–276.[CrossRef][Medline]

D’Amico, P. and Jacobs, J.R. (1995) Lectin histochemistry of the Drosophila embryo. Tissue Cell, 27, 23–30.[CrossRef][Web of Science][Medline]

Fredieu, J.R. and Mahowald, A.P. (1994) Glycoconjugate expression during Drosophila embryogenesis. Acta Anat. (Basel)., 149, 89–99.[Web of Science][Medline]

Fritz, T.A., Hurley, J.H., Trinh, L.B., Shiloach, J., and Tabak, L.A. (2004) The beginnings of mucin biosynthesis: the crystal structure of UDP-GalNAc: polypeptide alpha-N-acetylgalactosaminyltransferase-T1. Proc. Natl. Acad. Sci. U. S. A., 101, 15307–15312.[Abstract/Free Full Text]

Gurunathan, R., Emden, B.V., Panchanathan, S., and Kumar, S. (2004) Identifying spatially similar gene expression patterns in early stage fruit fly embryo images: binary feature versus invariant moment digital representations. BMC Bioinformatics, 5, 1–13.[Free Full Text]

Hagen, F.K., Hazes, B., Raffo, R., deSa, D., and Tabak, L.A. (1999) Structure-function analysis of the UDP-N-acetyl-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase. Essential residues lie in a predicted active site cleft resembling a lactose repressor fold. J. Biol. Chem., 274, 6797–6803.[Abstract/Free Full Text]

Hartenstein, V. (1993) In Atlas of Drosophila Development. Cold Spring Harbor Laboratory Press, New York, pp. 2–52.

Hennet, T., Hagen, F.K., Tabak, L.A., and Marth, J.D. (1995) T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination. Proc. Natl. Acad. Sci. U. S. A., 92, 12070–12074.[Abstract/Free Full Text]

Kawamura, K., Shibata, T., Saget, O., Peel, D., and Bryant, P.J. (1999) A new family of growth factors produced by the fat body and active on Drosophila imaginal disc cells. Development, 126, 211–219.[Abstract]

Kingsley, P.D., Ten Hagen, K.G., Maltby, K.M., Zara, J., and Tabak, L.A. (2000) Diverse spatial expression patterns of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase family member mRNAs during mouse development. Glycobiology, 10, 1317–1323.[Abstract/Free Full Text]

Klebes, A., Biehs, B., Cifuentes, F., and Kornberg, T.B. (2002) Expression profiling of Drosophila imaginal discs. Genome Biol., 3, 1–16.[Medline]

Moloney, D.J., Panin, V.M., Johnston, S.H., Chen, J., Shao, L., Wilson, R., Wang, Y., Stanley, P., Irvine, K.D., Haltiwanger, R.S., and Vogt, T.F. (2000) Fringe is a glycosyltransferase that modifies Notch. Nature, 406, 369–375.[CrossRef][Medline]

Muller, R., Hulsmeier, A.J., Altmann, F., Ten Hagen, K., Tiemeyer, M., and Hennet, T. (2005) Characterization of mucin-type core-1 ß1–3 galactosyltransferase homologous enzymes in Drosophila melanogaster. FEBS J., 272, 4295–4305.[CrossRef][Medline]

Nagaso, H., Murata, T., Day, N., and Yokoyama, K.K. (2001) Simultaneous detection of RNA and protein by in situ hybridization and immunological staining. J. Histochem. Cytochem., 49, 1177–1182.[Abstract/Free Full Text]

Okajima, T. and Irvine, K.D. (2002) Regulation of notch signaling by O-linked fucose. Cell, 111, 893–904.[CrossRef][Web of Science][Medline]

Pignoni, F. and Zipursky, S.L. (1997) Induction of Drosophila eye development by Decapentaplegic. Development, 124, 271–278.[Abstract]

Ramiez-Weber, F.A. and Kornberg, T.B. (2000) Signaling reaches to new dimensions in Drosophila imaginal discs. Cell, 103, 189–192.[CrossRef][Web of Science][Medline]

Schwientek, T., Bennett, E.P., Flores, C., Thacker, J., Hollmann, M., Reis, C.A., Behrens, J., Mandel, U., Keck, B., Schafer, M.A., and others. (2002) Functional conservation of subfamilies of putative UDP-N-acetylgalactosaminyltransferases in Drosophila, Caenorhabditis elegans, and mammals. J. Biol. Chem., 277, 22623–22638.[Abstract/Free Full Text]

Tautz, D. and Pfeifle, C. (1989) A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma, 98, 81–85.[CrossRef][Web of Science][Medline]

Ten Hagen, K.G. and Tran, D.T. (2002) A UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase is essential for viability in Drosophila melanogaster. J. Biol. Chem., 277, 22616–22622.[Abstract/Free Full Text]

Ten Hagen, K.G., Fritz, T.A., and Tabak, L.A. (2003a) All in the family: the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases. Glycobiology, 13, 1R–16R.

Ten Hagen, K.G., Tran, D.T., Gerken, T.A., Stein, D.S., and Zhang, Z. (2003b) Functional characterization and expression analysis of members of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase family from Drosophila melanogaster. J. Biol. Chem., 278, 35039–35048.[Abstract/Free Full Text]

Topaz, O., Shurman, D.L., Bergman, R., Indelman, M., Ratajczak, P., Mizrachi, M., Khamaysi, Z., Behar, D., Petronius, D., Friedman, V., and others. (2004) Mutations in GALNT3, encoding a protein involved in O-linked glycosylation, cause familial tumoral calcinosis. Nat. Genet., 36, 579–581.[CrossRef][Web of Science][Medline]

Weinkove, D. and Leevers, S.J. (2000) The genetic control of organ growth: insights from Drosophila. Curr. Opin. Genet. Dev., 10, 75–80.[CrossRef][Web of Science][Medline]

Zhang, Y., Iwasaki, H., Wang, H., Kudo, T., Kalka, T.B., Hennet, T., Kubota, T., Cheng, L., Inaba, N., Gotoh, M., and others. (2003) Cloning and characterization of a new human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase, designated-GalNAc-T13, that is specifically expressed in neurons and synthesizes GalNAc alpha-serine/threonine antigen. J. Biol. Chem., 278, 573–584.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
K. G. T. Hagen, L. Zhang, E Tian, and Y. Zhang
Glycobiology on the fly: Developmental and mechanistic insights from Drosophila
Glycobiology, February 1, 2009; 19(2): 102 - 111.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhang, Y. Zhang, and K. G. T. Hagen
A Mucin-type O-Glycosyltransferase Modulates Cell Adhesion during Drosophila Development
J. Biol. Chem., December 5, 2008; 283(49): 34076 - 34086.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
T. A Gerken, K. G Ten Hagen, and O. Jamison
Conservation of peptide acceptor preferences between Drosophila and mammalian polypeptide-GalNAc transferase ortholog pairs
Glycobiology, November 1, 2008; 18(11): 861 - 870.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Aoki, M. Porterfield, S. S. Lee, B. Dong, K. Nguyen, K. H. McGlamry, and M. Tiemeyer
The Diversity of O-Linked Glycans Expressed during Drosophila melanogaster Development Reflects Stage- and Tissue-specific Requirements for Cell Signaling
J. Biol. Chem., October 31, 2008; 283(44): 30385 - 30400.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
E Tian and K. G T. Hagen
O-linked glycan expression during Drosophila development
Glycobiology, August 1, 2007; 17(8): 820 - 827.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Aoki, M. Perlman, J.-M. Lim, R. Cantu, L. Wells, and M. Tiemeyer
Dynamic Developmental Elaboration of N-Linked Glycan Complexity in the Drosophila melanogaster Embryo
J. Biol. Chem., March 23, 2007; 282(12): 9127 - 9142.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E Tian and K. G. T. Hagen
A UDP-GalNAc:Polypeptide N-Acetylgalactosaminyltransferase Is Required for Epithelial Tube Formation
J. Biol. Chem., January 5, 2007; 282(1): 606 - 614.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/2/83    most recent
cwj051v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tian, E.
Right arrow Articles by Ten Hagen, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, E.
Right arrow Articles by Ten Hagen, K. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?