Skip Navigation


Glycobiology Advance Access originally published online on October 19, 2005
Glycobiology 2006 16(2):165-172; doi:10.1093/glycob/cwj050
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/2/165    most recent
cwj050v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Maliekal, P.
Right arrow Articles by Van Schaftingen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maliekal, P.
Right arrow Articles by Van Schaftingen, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Identification of the sequence encoding N-acetylneuraminate-9-phosphate phosphatase

Pushpa Maliekal2, Didier Vertommen3, Ghislain Delpierre2 and Emile Van Schaftingen1,2

2 Laboratory of Physiological Chemistry, Université Catholique de Louvain and the Christian de Duve Institute of Cellular Pathology, Avenue Hippocrate 75, B-1200 Brussels, Belgium; and 3 Hormone and Metabolism Unit, Université Catholique de Louvain and the Christian de Duve Institute of Cellular Pathology, Avenue Hippocrate 75, B-1200 Brussels, Belgium


1 To whom correspondence should be addressed; e-mail: vanschaftingen{at}bchm.ucl.ac.be

Received on September 2, 2005; revised on October 10, 2005; accepted on October 12, 2005


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
The synthesis of N-acetylneuraminate (Neu5Ac), the main form of sialic acid, proceeds in vertebrates through the condensation of N-acetylmannosamine 6-phosphate and phosphoenolpyruvate to Neu5Ac-9-phosphate, followed by the dephosphorylation of the latter by a specific phosphatase. The sequence encoding Neu5Ac-9-phosphate phosphatase (Neu5Ac-9-Pase; E.C. 3.1.3.29 [EC] ) has not been determined until now. In this work, we have purified Neu5Ac-9-Pase more than 1000-fold from rat liver. Its dependency on Mg2+ and the fact that it was inhibited by vanadate and Ca2+ suggested that it belonged to the haloacid dehalogenase family of phosphatases. Trypsin digestion and mass spectrometry analysis of a polypeptide of about 30 kDa that co-eluted with the activity in the last purification step indicated the presence of a protein designated "haloacid dehalogenase-like hydrolase domain containing 4." The human ortholog of this protein is encoded by a 2-exon gene present on chromosome 20p11. The human protein was overexpressed in Escherichia coli as a fusion protein with a polyHis tag and purified to homogeneity. The recombinant enzyme displayed a >230-fold higher catalytic efficiency on Neu5Ac-9-phosphate than on its second best substrate. Its properties were similar to those of the enzyme purified from rat liver. Neu5Ac inhibited the enzymatic activity by 50% at 15 mM, indicating that no significant inhibition is exerted at physiological concentrations of Neu5Ac. The identification of the gene encoding Neu5Ac-9-Pase will facilitate studies aimed at testing its potential implication in unexplained forms of glycosylation deficiency.

Key words: glycosylation / haloacid dehalogenase family / N-acetylmannosamine 6-phosphate / sialic acid


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Sialic acids are nine-carbon sugars with a carboxylate group that are found as components of many glycoproteins, glycolipids, and polysaccharides in animals, viruses, and bacteria. The main form of sialic acid, N-acetylneuraminate (Neu5Ac), is often present as the terminal sugar of N-glycans on glycoproteins and glycolipids and plays an important role in protein–protein and cell–cell recognition (Varki, 1997Go; Schauer, 2000Go). This compound is synthesized from N-acetylmannosamine in bacteria and from N-acetylmannosamine 6-phosphate in higher eukaryotes in an enzymatic reaction in which the pyruvate moiety of phosphoenolpyruvate is added to the first carbon of the aldohexosamine or of its 6-phospho-derivative (Watson et al., 1966Go; Corfield et al., 1985Go; Vann et al., 1997Go; Lawrence et al., 2000Go). Bacterial Neu5Ac synthase (neuB) and mammalian N-acetylneuraminate-9-phosphate (Neu5Ac-9-P) synthase are homologous proteins, sharing about 35% sequence identity (Lawrence et al., 2000Go). The Neu5Ac-9-P that is formed in mammals needs to be dephosphorylated before it can be used by CMP-Neu5Ac synthase (Roseman et al., 1961Go). Evidence has been provided for the fact that this reaction is catalyzed by a specific phosphatase (Jourdian et al., 1964Go), which is present in the cytosol and shows a wide tissue distribution (Van Rinsum et al., 1984Go), but the sequence of this enzyme has never been identified. Identification of the gene encoding Neu5Ac-9-Pase would be particularly relevant, because an increasing number of defects in the biosynthesis of glycosylated proteins leading to congenital disorders of glycosylation (CDG) (Jaeken and Carchon, 2004Go) or muscular dystrophies (Grewal and Hewitt, 2003Go) have been identified. Mutations in the Neu5Ac-9-Pase gene could be responsible for one of the forms of these disorders that has not yet received a molecular explanation. The purpose of this work was to identify the enzyme involved in the dephosphorylation of Neu5Ac-9-P.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Purification and identification of Neu5Ac-9-P phosphatase
Neu5Ac-9-Pase was substantially purified from rat liver by a procedure involving chromatographic steps on diethylaminocthyl (DEAE)-Sepharose, phenyl-Sepharose, Sephacryl S-200, and UnoQ (a high resolution anion exchanger gel). The phosphatase activity was followed during the purification by measuring the release of [32P]Pi from [32P]Neu5Ac-9-P. The phosphatase was eluted as a single peak in each of the purification steps, indicating the presence of a single enzyme species. This is illustrated in Figure 1 for the DEAE-Sepharose column, which allowed the separation of Neu5Ac-9-Pase from Neu5Ac-9-P synthase. The overall yield of the purification was rather low (0.8%, Table I), but this was due to the fact that only the most active fractions were used after each step of the purification procedure.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Purification of Neu5Ac-9-Pase by chromatography on DEAE-Sepharose—A liver preparation containing 20 g protein was applied on a DEAE-Sepharose column as described in Materials and methods. Fractions of 6 mL were collected. The activities of Neu5Ac-9-Pase and Neu5Ac-9-P synthase (Chen et al., 2002Go) were determined. Protein was assayed with the Bradford assay. The NaCl gradient is also shown.

 

View this table:
[in this window]
[in a new window]
 
Table I. Purification of Neu5Ac-9-Pase from rat liver

 

Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS–PAGE) analysis of the fractions of the UnoQ column revealed the presence of several polypeptides in the most purified preparation (Figure 2). Three of them, which co-eluted best with the enzymatic activity, were cut out of the gel and digested with trypsin. The resulting tryptic peptides were sequenced by tandem mass spectrometry. This led to the identification of band 1 as dihydrodiol dehydrogenase (gi-15208398), band 2 as alpha-tocopherol transfer protein (gi-6981682), and band 3 as a mixture of 6-phosphogluconolactonase (gi-13384778), and a rat protein of unknown function annotated as "haloacid dehalogenase-like hydrolase domain containing 4 (HDHD4)" (gi-57863283), a protein with a predicted molecular mass of 27.8 kDa. The peptides that led to the identification of this protein are underlined in the sequence shown in Figure 3.


Figure 2
View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2. Co-elution of Neu5Ac-9-Pase with a {approx}30-kDa polypeptide from an UnoQ anion exchange column—Panel A: A preparation of enzyme (240 mU in 1.6 mL) purified by chromatography on DEAE-Sepharose, phenyl-Sepharose, and Sephacryl S-200 was applied on an UnoQ column. Protein was eluted with a NaCl gradient. Fractions of 0.5 mL were collected. The Neu5Ac-9-Pase activity was determined, and protein was measured with the Bradford assay. Panel B: The indicated fractions were analyzed by SDS–PAGE (90 µL/lane). The gel was stained with Coomassie blue. The indicated bands were cut out from the gels submitted to trypsin digestion and analyzed by mass spectrometry.

 

Figure 3
View larger version (76K):
[in this window]
[in a new window]
 
Fig. 3. Alignment of rat and human HDHD4 (Neu5Ac-9-Pase) with homologous sequences. The following sequences are aligned: Rattus norvegicus (Rnor, gi-34859431), Homo sapiens (Hsap, gi-23308749), Xenopus laevis (Xlae, gi-46250196), Danio rerio (Drer, gi-63101958), and Drosophila melanogaster (Dmel, gi-28381565). Only the first 280 residues of the latter sequence are shown. Completely conserved residues are shown in boldface type. The underlined residues correspond to the peptides identified by mass spectrometry. Asterisks indicate the extremely conserved residues in phosphatases of the HAD family (see text).

 

As the haloacid dehalogenase family of proteins comprises a series of phosphatases (Aravind et al., 1998Go; Collet et al., 1998Go), HDHD4 was an interesting candidate. Basic local alignment search tool searches indicated the presence of proteins sharing a high degree of identity with rat HDHD4 in man and other mammals (88–97% identity), Gallus gallus (71%), Xenopus laevis (59%), fishes (47–49%), and insects (32–36%). The human sequence comprises 248 amino acids and is encoded by a 2-exon gene (gi-23308749) present on chromosome 20p11. The alignment in Figure 3 shows that the HDHD4 orthologs shared the three motifs found in phosphatases of the haloacid dehalogenase (HAD) family, namely a first motif comprising two extremely conserved aspartates, a second motif comprising a conserved serine or threonine, and a third motif comprising a conserved lysine and two conserved aspartates. The first aspartate in the first motif forms a phosphoaspartate during the catalytic cycle (Collet et al., 1998Go). These findings suggested therefore that the HDHD4 protein was a phosphatase.

Phosphatases of the HAD family have a set of kinetic characteristics that distinguish them from other phosphatases. Like all enzymes that form a phosphoenzyme during the catalytic cycle, they are inhibited by vanadate (Macara, 1980Go). Furthermore, their activity is dependent on the presence of Mg2+ (Collet et al., 1999Go; Selengut and Levine, 2000Go), which plays a critical role in catalysis (Ridder and Dijkstra, 1999Go; Peeraer et al., 2004Go). Finally, Ca2+ inhibits their activity by replacing Mg2+ and preventing the nucleophilic attack by the aspartate that covalently binds the phosphate group (Peeraer et al., 2004Go). We therefore tested these properties on our partially purified Neu5Ac-9-Pase, assayed with a concentration of 50 µM Neu5Ac-9-P. The activity of the enzyme was found to be totally dependent on the presence of Mg2+, which half-maximally activated the enzyme at 100 µM. Vanadate and Ca2+ both inhibited the enzyme, causing 50% inhibition at 12 µM and 450 µM, respectively. These findings agreed with the idea that Neu5Ac-9-Pase was a phosphatase of the HAD family, and that it presumably corresponded to HDHD4.

The Km of rat liver Neu5Ac-9-Pase was also determined. A value of 430 µM was obtained. We also tested the effect of Neu5Ac on Neu5Ac-9-Pase. In the presence of 50 µM or 250 µM substrate, 50% inhibition was reached at 15 mM Neu5Ac.

Expression and characterization of recombinant human Neu5Ac-9-P phosphatase
To confirm the identity of the phosphatase purified from rat liver, human HDHD4 was expressed in Escherichia coli as a fusion protein with a N-terminal polyhistidine. SDS–PAGE analysis showed that extracts from bacteria that had been cultured for 16 h at 22°C in the presence of the inducer isopropyl-1-thio-ß-d-galactopyranoside (IPTG) contained a soluble polypeptide of {approx}30 kDa (data not shown), which was absent from noninduced cells (data not shown). The recombinant protein was purified to homogeneity by affinity chromatography on Ni2+-agarose gel (data not shown). By using this procedure, 1.4 mg of pure enzyme was obtained from a 500 mL culture.

The purified recombinant protein catalyzed the dephosphorylation of Neu5Ac-9-P with a Km of 90 µM and a Vmax of 112 µmol/min/mg protein. As summarized in Table II, it also dephosphorylated other compounds, but with a catalytic efficiency that was at least 200-fold lower, and for most of them more than 10,000-fold lower. Interestingly, the second and third best substrates (fructose 1,6-bisphosphate and 6-phosphogluconate) were, like Neu5Ac-9-P, rather bulky compounds with a negatively charged function on their first carbon.


View this table:
[in this window]
[in a new window]
 
Table II. Specificity of human recombinant Neu5Ac-9-Pase

 

Like for the rat liver enzyme, the activity of human recombinant Neu5Ac-9-Pase was dependent on Mg2+ and inhibited by vanadate (50% inhibition at 19 µM vanadate) and Ca2+. As shown in Figure 4, the inhibition exerted by the latter was competitive with Mg2+. Like for the rat liver enzyme, Neu5Ac caused a 50% inhibition at {approx}15 mM Neu5Ac.


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Inhibition of human recombinant Neu5Ac-9-Pase by Ca2+. The effect of Ca2+ on Neu5Ac-9-Pase was assayed in the presence of 0.25 ({blacksquare}), 1 ({blacktriangleup}), 2.5 ({blacktriangledown}), and 10 (bullet) mM Mg2+. The results are shown as a Dixon plot (Dixon, 1953Go) and are means ± SEM for three independent experiments. The inset shows the values of the intercept with the "x" axis (I50, i.e., the concentration of Ca2+ at which 50% inhibition is observed) versus the concentration of Mg2+.

 


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Identification of the sequence encoding Neu5Ac-9-P phosphatase
We report in this article the identification of HDHD4, a member of the haloacid dehalogenase family of proteins, as Neu5Ac-9-Pase. This identification was based on the findings that the enzyme purified from rat liver co-eluted with a polypeptide with a similar molecular mass as HDHD4 and comprising peptides corresponding to HDHD4. This was confirmed by the observation that purified recombinant HDHD4 acted as a Neu5Ac-9-Pase with a catalytic efficiency that was more than two orders of magnitude higher than for any other substrate that was tested. Furthermore, the recombinant protein displayed kinetic characteristics that were similar to those of the enzyme purified from rat liver. This includes dependency on Mg2+ and sensitivity to inhibition by vanadate and by Ca2+. The specific activity of the recombinant pure enzyme ({approx}110 U/mg protein) was about 150-fold higher than that of our most purified preparation, indicating that the latter was still quite impure, in agreement with the results of the SDS–PAGE analysis. The fact that the specific activity of the pure enzyme is about 195,000-fold higher than that of a crude liver extract indicates that Neu5Ac-9-Pase is a minor protein in rat liver.

Reaction mechanism and inhibition by Ca2+
Like many phosphatases acting on low-molecular-weight substrates, Neu5Ac-9-Pase belongs to the HAD family. This is indicated by the presence of the three characteristic motifs found in phosphatases of this family. The first one comprises a DXDXT/V sequence (DLDNT in this case), the first aspartate of which has been shown to be phosphorylated in phosphoserine phosphatase and phosphomannomutase (Collet et al., 1998Go). Neu5Ac-9-Pase proceeds most likely also via a phosphoenzyme mechanism, as suggested by its sensitivity to vanadate (Macara, 1980Go) and by the conservation of the phosphorylatable aspartate close to its amino terminus.

Like phosphoserine phosphatase, Neu5Ac-9-Pase is inhibited by Ca2+. Structural studies have recently allowed to rationalize this effect (Peeraer et al., 2004Go). In phosphoserine phosphatase, Mg2+ binds to the phosphate group of the substrate, to Asp179 (human phosphoserine phosphatase) and to only one of the oxygens of the ß-carboxyl group of the first aspartate of the DXDXT motif (Asp20). This allows the other oxygen of the ß-carboxyl group of Asp20 to adopt the appropriate orientation for attacking the phosphorus of the phosphate group. Because of its larger ionic radius, Ca2+ binds to both oxygens of the carboxyl group of Asp20, making that the carboxyl oxygen that normally should attack the phosphate is too far away from the phosphate group and not appropriately oriented to perform a nucleophilic attack. Due to the high conservation of the residues that participate in catalysis in all phosphatases of the HAD family, it is likely that this sensitivity to Ca2+ is shared by all members of this family, as we show, indeed, this to be the case for Neu5Ac-9-Pase. It should be stressed that, at physiological concentrations of Mg2+ (of the order of 1 mM), the inhibition requires concentrations of Ca2+ that are several orders of magnitude higher than the physiological cytosolic concentrations of this divalent cation.

In vivo regulation of Neu5Ac-9-P phosphatase
The activity of phosphoserine phosphatase, another enzyme of the HAD family, is inhibited by physiological concentrations of the reaction product L-serine, which acts as a feedback inhibitor in mammalian cells (Snell, 1984Go). Our results indicate that, in marked contrast, Neu5Ac-9-Pase is only poorly inhibited by its product Neu5Ac. The physiological concentration of the latter is indeed of the order of 100 µM (Ferwerda et al., 1983Go), whereas 50% inhibition of the enzymatic activity was observed at {approx}15 mM Neu5Ac. This is consistent with the fact that sialuria is due to mutations in the bifunctional enzyme UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase that abolish the inhibition exerted by CMP-Neu5Ac (Seppala et al., 1991Go, 1999Go). If feedback inhibition by sialic acid was also exerted at the level of Neu5Ac-9-Pase, mutations that abolish the allosteric regulation of the bifunctional enzyme should not produce a large increase in the formation of sialic acid.

Distribution of Neu5Ac-9-P phosphatase in nature
As schematized in Figure 5, bacteria make Neu5Ac directly through the condensation of N-acetylmannosamine with phosphoenolpyruvate (Vann et al., 1997Go; Ringenberg et al., 2003Go), whereas mammals form it from N-acetylmannosamine 6-phosphate via Neu5Ac-9-P as an intermediate (Watson et al., 1966Go). Because the enzymes catalyzing the formation of Neu5Ac-9-P in mammals and Neu5Ac in bacteria are homologous (Lawrence et al., 2000Go), the presence of a Neu5Ac/Neu5Ac-9-P synthase homolog in a given species does not allow one to conclude whether the synthesis of sialic acid proceeds in this species from phosphorylated or nonphosphorylated N-acetylmannosamine. The presence of a protein sharing at least {approx}50% sequence identity with rat or human Neu5Ac-9-Pase in the genomes of mammals, chicken, xenopus, and fishes indicates that sialic acid synthesis proceeds via the 9-phosphate intermediate in these species. This is consistent with the finding that the genome of vertebrates comprises a gene encoding the bifunctional enzyme UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase, which provides the required N-acetylmannosamine 6-phosphate. This bifunctional enzyme is missing in insects, whereas the Neu5Ac/Neu5Ac-9-P synthase homolog is present and has been demonstrated to form Neu5Ac-9-P from N-acetylmannosamine 6-phosphate, as well as 2-keto-3-deoxy-D-glycero-D-galacto-nononate 9-phosphate (KDN-9-P) from mannose 6-phosphate (Kim et al., 2002Go). The finding that insect cells form Neu5Ac when they are supplemented with N-acetylmannosamine (Kim et al., 2002Go) or transfected with the mammalian bifunctional enzyme (Viswanathan et al., 2003Go) suggests that the Neu5Ac-9-Pase homolog of insects may act, indeed, to dephosphorylate Neu5Ac-9-P. Its physiological function, in the absence of N-acetylmannosamine supplements, is presumably to dephosphorylate KDN-9-P. The mammalian Neu5Ac-9-Pase is also probably able to dephosphorylate different types of sialate 9-phosphates. This is indicated by the finding that mammalian cells convert N-acyl-modified analogs of mannosamine to sialic acid derivatives that are incorporated in sialoglycoconjugates (Keppler et al., 2001Go).


Figure 5
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. Pathways of N-acetylneuraminate synthesis and N-acetylmannosamine degradation in vertebrates and bacteria. (1) UDP-N-acetylglucosamine-2-epimerase, is known as neuC in bacteria; it forms a bifunctional enzyme with (2) N-acetylmannosamine kinase in eukaryotes. Bacteria phosphorylate N-acetylmannosamine with (3) N-acetylmannosamine kinase (nanK) or with N-acetylmannosamine phosphotransferase, whereas only the first option exist in eukaryotes. (4) N-acetylmannosamine-6-phosphate-2-epimerase (nanE); (5) N-acetylglucosamine-2-epimerase; (6) N-acetylneuraminate synthase (neuB); (7) N-acetylneuraminate-9-phosphate synthase; (8) N-acetylneuraminate-9-phosphate phosphatase; (9) CMP-N-acetylneuraminate synthase (neuA in bacteria).

 

One may wonder why sialic acid synthesis proceeds through a 9-phospho-intermediate in vertebrates (Watson et al., 1966Go) but not in bacteria (Vann et al., 1997Go; Ringenberg et al., 2003Go). This may have to do with the existence of different enzymes for the catabolism of N-acetylmannosamine. In higher eukaryotes, an epimerase converts nonphosphorylated N-acetylmannosamine to N-acetylglucosamine (Ghosh and Roseman, 1965Go). The catabolic role of this enzyme has been demonstrated by showing that its overexpression reduces the formation of sialic acid in Jurkat cells (Luchansky et al., 2003Go). In marked contrast, N-acetylmannosamine degradation in bacteria involves its phosphorylation to N-acetylmannosamine 6-phosphate, which is then converted to N-acetylglucosamine 6-phosphate by a specific epimerase, encoded by the nanE gene (Plumbridge and Vimr, 1999Go; Walters et al., 1999Go). It may therefore be advantageous for vertebrates to catalyze the phosphorylation of N-acetylmannosamine as soon as it is formed, to avoid its conversion to N-acetylglucosamine and minimize a futile cycle that costs two high-energy bonds per cycle. On the opposite, avoiding the phosphorylation of N-acetylmannosamine precludes its degradation by nanE in bacteria.

Implications for the study of glycosylation defects
As mentioned in the Introduction, glycosylation defects are an expanding group of disorders, which generally lead to multiorgan involvement. Nearly 20 enzyme or transporter deficiencies have been identified thanks to a combination of enzyme activity analysis, functional assays of protein glycosylation in fibroblasts, and mutation search in the relevant genes (Jaeken and Carchon, 2004Go). However, many cases of glycosylation defects remain unsolved, and it is likely that some of them are due to Neu5Ac-9-Pase deficiency. In principle, Neu5Ac-9-Pase deficiency should be identifiable through analysis of the Neu5Ac-9-Pase activity in fibroblasts or other cell types. However, the Neu5Ac-9-Pase assay requires a noncommercially available substrate and is therefore not widely available, in marked contrast with mutation screening. Furthermore, a common observation made with glycosylation defects is that the enzyme deficiencies underlying the affection are usually only partial (Grunewald et al., 2001Go), consistent with glycosylation being indispensable for life. It is therefore likely that Neu5Ac-9-Pase deficiency, if it exists in patients, is incomplete. The identification of mutations in Neu5Ac-9-Pase gene and the testing of their effect on the enzymatic activity would be particularly important to establish that the glycosylation defect is indeed due to a Neu5Ac-9-Pase deficiency.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Materials
DEAE-Sepharose, phenyl-Sepharose, Sephacryl S-200, UnoQ and HisTrap were from GE Healthcare (Amersham) (Little Chalfont, Buckinghamshire, UK). Biogel P2 was from Bio-Rad Laboratories (Hercules, CA), Dowex 1-X8 (200 mesh; Cl form) was from Acros Organics (Geel, Belgium). Mannosamine was from Sigma and phosphorylated compounds were from Sigma or Roche. Acetic anhydride and poly(ethylene glycol) 6000 were from Merck (Darmstadt, Germany). Alkaline phosphatase, hexokinase, Pwo polymerase, and restriction enzymes were from Roche. Amicon membrane YM10 was from Millipore (Bedford, MA).

Synthesis of N-acetylneuraminate 9-phosphate
Mannosamine 6-phosphate was synthesized by incubating mannosamine (20 mM) for 6 h at 37°C with yeast hexokinase (14 U/mL) in the presence of 50 mM Hepes, pH 8, 25 mM ATP-Mg, 1 mM DTT, 100 µg/mL bovine serum albumin. The reaction mixture was heated at 90°C for 5 min and centrifuged. The supernatant was brought to pH 8 with NaOH and incubated with 500 mM acetic anhydride for 50 min at 20°C. The resulting N-acetylmannosamine 6-phosphate was purified by anion-exchange chromatography on Dowex 1-X8 (Cl) and gel filtration on Biogel P2 fine column (0.9 x 50 cm) equilibrated with water. Its titre was determined by measuring the inorganic phosphate (Fiske and Subbarow, 1925Go) liberated by alkaline phosphatase. [32P]N-acetylmannosamine 6-phosphate was similarly prepared, except that the phosphorylation reaction contained 200 µM mannosamine, 50 µM ATP-Mg, and 8 x 108 cpm [{gamma}-32P]ATP (reaction volume = 0.25 mL), and that the incubation lasted only 60 min.

Neu5Ac-9-P was synthesized by incubating 2.5 mM N-acetylmannosamine 6-phosphate with 40 mM Hepes, pH 7.4, 12.5 mM MgCl2, 1 mM MnCl2, 5 mM phosphoenolpyruvate, and 5 mU/mL Neu5Ac-9-P synthase (partially purified from rat liver; Figure 1) for 2 h at 37°C in a final volume of 10 mL. The reaction was stopped by adding 2.5 mL of ice-cold 10% (w/v) HClO4. After neutralization with K2CO3 and elimination of the precipitate by centrifugation, the preparation was diluted to 100 mL with water and applied on an anion-exchange column (Dowex 1-X8 Cl resin, 12 mL). The column was washed with 30 mL water, and a linear NaCl gradient (0–500 mM in 200 mL) was applied to elute the phosphate esters (assayed as the inorganic phosphate liberated by alkaline phosphatase). After concentration to 1.5 mL, the Neu5Ac-9-P preparation (17.5 µmol in total) was freed from NaCl by gel filtration on a Biogel P2 fine column (0.9 x 50 cm) and concentrated to 1 mL. The preparation was stored at –20°C. Radiolabeled [32P]Neu5Ac-9-P was similarly prepared from 5 x 108 cpm [32P]N-acetylmannosamine 6-phosphate in a final volume of 3 mL and was purified by anion-exchange chromatography.

Purification of Neu5Ac-9-P phosphatase
All purification steps were performed at 4°C, and the enzymatic preparations were stored on ice between steps. Protein concentration was estimated either by measuring A280 or by the Bradford assay using bovine serum albumin as a standard (Bradford, 1976Go). The livers of eight males, {approx}400 g rats were homogenized in 3 volumes (w/v) of buffer A (25 mM Hepes, pH 7.1, 5 µg/mL leupeptin, 5 µg/mL antipain, 1 mM DTT, and 25 mM KCl). The homogenate was centrifuged for 30 min at 16,000 x g. NaCl and poly(ethylene glycol) 6000 were added to the extract (350 mL) at final concentrations of 50 mM NaCl and 6% (w/v), respectively. The preparation was stirred on ice for 30 min and centrifuged for 30 min at 16,000 x g. The resulting supernatant (300 mL) was diluted 7-fold with buffer A and loaded on a Blue-Sepharose column (125 mL, equilibrated with buffer A), on which the phosphatase activity was not retained (this step was included to permit the purification of another, unrelated enzyme that was retained on the Blue-Sepharose column). The flow-through ({approx}2 L) was applied on a DEAE-Sepharose column (110 mL) equilibrated with buffer A. This column was washed with 400 mL of the same buffer before application of a NaCl gradient (0–0.5 M in 725 mL).

The active fractions from two such preparations were pooled and divided in three equal parts. Each of these parts (about 45 mL) was supplemented with solid NaCl to reach a final concentration of 3 M and applied on a phenyl-Sepharose column (8.5 mL) equilibrated with buffer B (25 mM Hepes, pH 7.4, 5 µg/mL of leupeptin, 5 µg/mL of antipain and 1 mM DTT) containing 3 M NaCl. The column was washed with 20 mL of the same buffer, and retained protein was eluted with a linear decreasing gradient of NaCl (3–0 M in 100 mL). The active fractions from the three columns were pooled (42 mL) and concentrated to 5 mL in an Amicon cell equipped with a 10-kDa cut-off membrane. This sample was loaded onto a 1.6 cm x 60 cm Sephacryl S-200 column equilibrated with 25 mM of Hepes, pH 7.4, 100 mM of NaCl, 1 mM of DTT, 5 µg/mL of leupeptin, 5 µg/mL of antipain. Two fractions containing Neu5Ac-9-Pase activity were pooled, diluted in 5 mL of buffer B, and loaded on an UnoQ (1 mL) column equilibrated in buffer B. After washing (three column volumes), retained protein was eluted with a NaCl gradient (0–350 mM in 15 mL), and 0.5 mL fractions were collected for activity measurement and SDS–PAGE analysis.

Protein identification by mass spectrometry
In-gel tryptic digestions of protein bands and desalting of the peptides were performed as described (Foultier et al., 2003Go). Peptides were analyzed by nanoelectrospray ionization-tandem MS (MS/MS) in a LCQ Deca XP Plus ion trap mass spectrometer (ThermoFinnigan) fitted with a nanoelectrospray probe. The data were analyzed with the X-calibur software (ThermoFinnigan), and the proteins were identified with TurboSEQUEST in the BioWorks software suite (ThermoFinnigan).

Overexpression and purification of human Neu5Ac-9-P phosphatase
A 5' primer containing the putative ATG codon (CCATATGGGGCTGAGCCGCGTGC) in an NdeI site (in bold) and a 3' primer containing the putative stop codon (AGGATCCTTAAGTGGACATACTGACTTTGCA) flanked by a BamHI site were used to polymerase chain reaction (PCR)-amplify a human liver cDNA library (GenBank accession NP_689880 [GenBank] ) with Pwo polymerase. An {approx}750 bp product was obtained, which was subcloned in pBlueScript and checked by sequencing. An NdeI–BamHI fragment was removed from the pBlueScript plasmid and ligated in pET-15b expression vector. This vector was used to transform E. coli BL21(DE3) strains. The resulting bacteria were grown in 500-mL M9 medium supplemented with 0.5 mg/L biotin, 0.5 mg/L thiamine, 2 g/L glucose, 1 g/L casamino acids, 0.1 g/L ampicillin, and 25 mg/L chloramphenicol. The culture was grown at 37°C until A600 reached 0.5–0.6. It was then cooled on ice for 20 min and the inducer IPTG was added to a final concentration of 0.4 mM. After a further incubation at 22°C for 16 h, the cells were collected by centrifugation, resuspended in 25 mL of buffer C (20 mM Hepes, pH 7.4, 0.5 mM phenylmethylsulphonyl fluoride, 5 µg/mL leupeptin, 5 µg/mL antipain, 1 mg/mL lysozyme) and submitted to three cycles of freezing and thawing. The bacterial extract was incubated on ice for 1 h with 5 mg of DNaseI in the presence of 10 mM of MgSO4 and centrifuged for 30 min at 10,000 x g. The resulting supernatant (20 mL) was recentrifuged for 30 min at 15,000 x g, filtered on a 0.22-µm filter, diluted 2-fold in buffer D (50 mM Hepes, pH 7.4, 300 mM NaCl) and applied on a HisTrap HP column (1 mL). The column was washed with buffer D, and the retained protein was eluted by applying an imidazole (pH 8) gradient (15, 30, 60, 90, 150, and 300 mM) in buffer D. The His-tagged protein was eluted with 150-mM imidazole. The fraction (3.3 mL) containing Neu5Ac-9-Pase as determined by SDS–PAGE analysis, was supplemented with 10% (w/v) glycerol and stored at –70°C.

Assays of Neu5Ac-9-P phosphatase and synthase
Neu5Ac-9-Pase was measured radiochemically. Except if otherwise indicated, the incubation mixture contained 5000 cpm of [32P]Neu5Ac-9-P, 50 µM unlabelled Neu5Ac-9-P, 25 mM Hepes, pH 7.4, 25 mM KCl, 1 mM MgCl2, 1 mM DTT, 50 µg/mL bovine serum albumin and the enzyme preparation. Incubations were carried out at 37°C and stopped at several times by adding 1 volume of 10% (w/v) ice-cold trichloroacetic acid. The mixture was centrifuged for 10 min at 16,000 x g at 4°C. The released [32P]Pi was measured in the supernatant by extraction as a phosphomolybdate complex (McClard, 1979Go). The kinetic properties were determined on the rat liver enzyme purified up to the phenyl-Sepharose step or on the homogeneous recombinant human enzyme. Care was taken to use enzyme dilutions and incubation times for which no more than 25% of the substrate was consumed. Under these conditions, the production of substrate was linear with time and proportional to the concentration of enzyme. One unit of enzyme is the amount that catalyzes the conversion of one µmol/min under the specified assay conditions. Neu5Ac-9-P synthase was assayed as described by Chen et al. (2002)Go.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
This work was supported by the Directorate General Higher Education and Scientific Research, French Community of Belgium, the Fund for Medical Scientific Research, the Interuniversity Attraction Poles Program, Belgian Science Policy. P.M. is fellow of the Fonds pour l’Encouragement à la Recherche dans l’Industrie et dans l’Agriculture, and G. Delpierre, Chargé de Recherche of the Belgian Fonds National de la Recherche Scientifique.


    Abbreviations
 
DEAE, diethylaminocthyl; HAD, haloacid dehalogenase; IPTG, isopropyl-1-thio-ß-d-galactopyranoside; Neu5Ac, N-acetylneuraminate; Neu5Ac-9-P, N-acetylneuraminate 9-phosphate; Neu5Ac-9-Pase, N-acetylneuraminate-9-phosphate phosphatase; SDS–PAGE, Sodium dodecyl sulphate-polyacrylamide gel electrophoresis


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 References
 
Aravind, L., Galperin, M.Y., and Koonin, E.V. (1998) The catalytic domain of the P-type ATPase has the haloacid dehalogenase fold. Trends Biochem. Sci., 23, 127–129.[CrossRef][ISI][Medline]

Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248–254.[CrossRef][ISI][Medline]

Chen, H., Blume, A., Zimmermann-Kordmann, M., Reutter, W., and Hinderlich, S. (2002) Purification and characterization of N-acetylneuraminic acid-9-phosphate synthase from rat liver. Glycobiology, 12, 65–71.[Abstract/Free Full Text]

Collet, J.-F., Stroobant, V., Pirard, M., Delpierre, G., and Van Schaftingen, E. (1998) A new class of phosphotransferases phosphorylated on an aspartate residue in an amino-terminal DXDX (T/V) motif. J. Biol. Chem., 273, 14107–14112.[Abstract/Free Full Text]

Collet, J.-F., Stroobant, V., and Van Schaftingen, E. (1999) Mechanistic studies of phosphoserine phosphatase, an enzyme related to P-type ATPases. J. Biol. Chem., 274, 33985–33990.[Abstract/Free Full Text]

Corfield, A.P., Clamp, J.R., and Wagner, S.A. (1985) The metabolism of sialic acids in isolated rat colonic mucosal cells. Biochem. J., 226, 163–174.[ISI][Medline]

Dixon, M. (1953) The determination of enzyme inhibitor constants. Biochem. J., 1, 170–171.

Ferwerda, W., Blok, C.M., and Van Rinsum, J. (1983) Synthesis of N-acetylneuraminic acid and of CMP-N-acetylneuraminic acid in the rat liver cell. Biochem. J., 216, 87–92.[ISI][Medline]

Fiske, C.H. and Subbarow, Y. (1925) The colorimetric determination of phosphorus. J. Biol. Chem., 66, 375–400.[Free Full Text]

Foultier, B., Troisfontaines, P., Vertommen, D., Marenne, M.-N., Rider, M., Parsot, C., and Cornelis, G.R. (2003) Identification of substrates and chaperone from the Yersinia enterocolitica 1B Ysa type III secretion system. Infect. Immun., 71, 242–253.[Abstract/Free Full Text]

Ghosh, S. and Roseman, S. (1965) The sialic acids V. N-acyl-D-glucosamine, 2-epimerase. J. Biol. Chem., 240, 1531–1536.[Free Full Text]

Grewal, P.K. and Hewitt, J.E. (2003) Glycosylation defects: a new mechanism for muscular dystrophy? Hum. Mol. Genet., 12, R259–R264.

Grunewald, S., Schollen, E., Van Schaftingen, E., Jaeken, J., and Matthijs, G. (2001) High residual activity of PMM2 in patients’ fibroblasts: possible pitfall in the diagnosis of CDG-Ia (phosphomannomutase deficiency). Am. J. Hum. Genet., 68, 347–354.[CrossRef][ISI][Medline]

Jaeken, J. and Carchon, H. (2004) Congenital disorders of glycosylation: a booming chapter of pediatrics. Curr. Opin. Pediatr., 16, 434–439.[CrossRef][ISI][Medline]

Jourdian, G.W., Swanson, A.L., Watson, D., and Roseman, S. (1964) Isolation of sialic acid 9-phosphatase from human erythrocytes. J. Biol. Chem., 239, PC2714–PC2716.

Keppler, O.T., Horstkorte, R., Pawlita, M., Schmidt, C., and Reutter, W. (2001) Biochemical engineering of the N-acyl side chain of sialic acid: biological implications. Glycobiology, 2, 11R–18R.

Kim, K., Lawrence, S.M., Park, J., Pitts, L., Vann, W.F., Betenbaugh, M.J., and Palter, K.B. (2002) Expression of a functional Drosophila melanogaster N-acetylneuraminic acid (Neu5Ac) phosphate synthase gene: evidence for endogenous sialic acid biosynthetic ability in insects. Glycobiology, 12, 73–83.[Abstract/Free Full Text]

Lawrence, S.M., Huddleston, K.A., Pitts, L.R., Nguyen, N., Lee, Y.C., Vann, W.F., Coleman, T.A., and Betenbaugh, M.J. (2000) Cloning and expression of the human N-acetylneuraminic acid phosphate synthase gene with 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid biosynthetic ability. J. Biol. Chem., 275, 17869–17877.[Abstract/Free Full Text]

Luchansky, S.J., Yarema, K.J., Takahashi, S., and Bertozzi, C.R. (2003) GlcNAc 2-epimerase can serve a catabolic role in sialic acid metabolism. J. Biol. Chem., 278, 8035–8042.[Abstract/Free Full Text]

Macara, I.G. (1980) Vanadium, an element in search of a role. Trends Biochem. Sci., 5, 92–94.

McClard, R.W. (1979) Synthesis and purification of [1-32P]fructose-1,6-bisphosphate with high specific radioactivity. Anal. Biochem., 96, 500–503.[CrossRef][ISI][Medline]

Peeraer, Y., Rabijns, A., Collet, J.-F., Van Schaftingen, E., and De Ranter, C. (2004) How calcium inhibits the magnesium-dependent enzyme human phosphoserine phosphatase. Eur. J. Biochem., 271, 3421–3427.[ISI][Medline]

Plumbridge, J. and Vimr, E. (1999) Convergent pathways for utilization of the amino sugars N-acetylglucosamine, N-acetylmannosamine, and N-acetylneuraminic acid by Escherichia coli. J. Bacteriol., 181, 47–54.

Ridder, I.S. and Dijkstra, B.W. (1999) Identification of the Mg2+ binding site in the P-type ATPase and phosphatase members of the HAD (haloacid dehalogenase) superfamily by structural similarity to the response regulator protein CheY. Biochem. J., 339, 223–226.

Ringenberg, M.A., Steenbergen, S.M., and Vimr, E.R. (2003) The first committed step in the biosynthesis of sialic acid by Escherichia coli K1 does not involve a phosphorylated N-acetylmannosamine intermediate. Mol. Microbiol., 50, 961–975.[CrossRef][ISI][Medline]

Roseman, S., Jourdian, G.W., Watson, D., and Rood, R. (1961) Enzymatic synthesis of sialic acid 9-phosphates. Proc. Natl. Acad. Sci. U. S. A., 47, 958–961.[Free Full Text]

Schauer, R. (2000) Achievements and challenges of sialic acid research. Glycoconj. J., 17, 485–499.[CrossRef][ISI][Medline]

Selengut, J.D. and Levine, R.L. (2000) MDP-1: a novel eukaryotic magnesium-dependent phosphatase. Biochemistry, 39, 8315–8324.[CrossRef][Medline]

Seppala, R., Tietze, F., Krasnewich, D., Weiss, P., Ashwell, G., Barsh, G., Thomas, G.H., Packman, S., and Gahl, W.A. (1991) Sialic acid metabolism in sialuria fibroblasts. J. Biol. Chem., 266, 7456–7461.[Abstract/Free Full Text]

Seppala, R., Lehto, V.-P., and Gahl, W.A. (1999) Mutations in the human UDP-N-acetylglucosamine 2-epimerase gene define the disease sialuria and the allosteric site of the enzyme. Am. J. Hum. Genet., 64, 1563–1569.[CrossRef][ISI][Medline]

Snell, K. (1984) Enzymes of serine metabolism in normal, developing and neoplastic rat tissues. Adv. Enzyme Regul., 22, 325–400.[CrossRef][ISI][Medline]

Van Rinsum, J., Van Dijk, W., Hooghwinkel, G.J., and Ferwerda, W. (1984) Subcellular localization and tissue distribution of sialic acid-forming enzymes. N-acetylneuraminate-9-phosphate synthase and N-acetylneuraminate 9-phosphatase. Biochem. J., 223, 323–328.[ISI][Medline]

Vann, W.F., Tavarez, J.J., Crowley, J., Vimr, E., and Silver, R.P. (1997) Purification and characterization of the Escherichia coli K1 neuB gene product N-acetylneuraminic acid synthetase. Glycobiology, 7, 697–701.[Abstract/Free Full Text]

Varki, A. (1997) Sialic acids as ligands in recognition phenomena. FASEB J., 11, 248–255.[Abstract]

Viswanathan, K., Lawrence, S., Hinderlich, S., Yarema, K.J., Lee, Y.C., and Betenbaugh, M.J. (2003) Engineering sialic acid synthetic ability into insect cells: identifying metabolic bottlenecks and devising strategies to overcome them. Biochemistry, 42, 15215–15225.[CrossRef][Medline]

Walters, D.M., Stirewalt, V.L., and Melville, S.B. (1999) Cloning, sequence, and transcriptional regulation of the operon encoding a putative N-acetylmannosamine-6-phosphate epimerase (nanE) and sialic acid lyase (nanA) in Clostridium perfringens. J. Bacteriol., 181, 4526–4532.[Abstract/Free Full Text]

Watson, D.R., Jourdian, G.W., and Roseman, S. (1966) The sialic acids. VIII. Sialic acid 9-phosphate synthetase. J. Biol. Chem., 241, 5627–5636.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Preumont, K. Snoussi, V. Stroobant, J.-F. Collet, and E. Van Schaftingen
Molecular Identification of Pseudouridine-metabolizing Enzymes
J. Biol. Chem., September 12, 2008; 283(37): 25238 - 25246.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Castilho, M. Pabst, R. Leonard, C. Veit, F. Altmann, L. Mach, J. Glossl, R. Strasser, and H. Steinkellner
Construction of a Functional CMP-Sialic Acid Biosynthesis Pathway in Arabidopsis
Plant Physiology, May 1, 2008; 147(1): 331 - 339.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/2/165    most recent
cwj050v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Maliekal, P.
Right arrow Articles by Van Schaftingen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maliekal, P.
Right arrow Articles by Van Schaftingen, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?