Glycobiology Advance Access originally published online on August 23, 2005
Glycobiology 2006 16(1):1-10; doi:10.1093/glycob/cwj031
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Carbohydrate-dependent inhibition of Helicobacter pylori colonization using porcine milk
2 Department of Clinical Chemistry, Sahlgrenska University Hospital, S-413 45 Göteborg, Sweden; 3 Division of Clinical Immunology, Karolinska Institutet, Karolinska University Hospital at Huddinge, S-141 86 Stockholm, Sweden; 4 Department of Medical Biochemistry and Biophysics, Umeå University, S-901 87 Umeå, Sweden; 5 Department of Physiology and Biochemistry, Szent István University, H-1400 Budapest, Hungary; and 6 Department of Surgery, Sahlgrenska University Hospital, S-413 45 Göteborg, Sweden
1 To whom correspondence should be addressed; e-mail: anki.gustafsson{at}clinchem.gu.se
Received on January 14, 2005; revised on July 29, 2005; accepted on August 17, 2005
| Abstract |
|---|
|
|
|---|
Breast milk has a well-known anti-microbial effect, which is in part due to the many different carbohydrate structures expressed. This renders it a position as a potential therapeutic for treatment of infection by different pathogens, thus avoiding the drawbacks of many antibiotics. In a previous study, we showed that pigs express the Helicobacter pylori receptors, sialyl Lewis x (Lex) and Leb, on various milk proteins. Here, we investigate the pig breed- and individual-specific expression of these epitopes, as well as the inhibitory capacity of porcine milk on H. pylori binding and colonization. Milk proteins from three different pig breeds were analysed by western blotting using antibodies with known carbohydrate specificity. An adhesion assay was used to investigate the capacity of pig milk to inhibit H. pylori binding to neoglycoproteins carrying Leb and sialyl-di-Lex.
1,3/4-fucosyltransferase transgenic FVB/N mice, known to express Leb and sialyl Lex in their gastric epithelium, were colonized by H. pylori and were subsequently treated with Leb- and sialyl Lex-expressing or nonexpressing porcine milk, or water (control) only. The degree of H. pylori colonization in the different treatment groups was quantified. The expression of the Leb and sialyl Lex carbohydrate epitopes on pig milk proteins was breed- and individual specific and correlated to the ability of porcine milk to inhibit H. pylori adhesion in vitro and H. pylori colonization in vivo. Milk from certain pig breeds may have a therapeutic and/or prophylactic effect on H. pylori infection. Key words: carbohydrates / Helicobacter pylori / infection / milk / porcine
| Introduction |
|---|
|
|
|---|
Helicobacter pylori is a gram-negative bacterium whose main host is man. It resides in the gastric mucosa or adheres to the epithelial cells lining the stomach. Some 50% of the world population is infected by the bacterium, with a higher incidence in developing countries. H. pylori is associated with the development of peptic ulcer disease, mucosa-associated lymphoid-tissue (MALT) lymphoma and gastric adenocarcinoma (Blaser, 1996
Today, treatment of H. pylori infection involves different antibiotics in combination with drugs reducing stomach acidity (Meurer and Bower, 2002
). However, the treatment is complicated by the occurrence of H. pylori strains resistant to commonly used antibiotics (Megraud, 2001
) as well as patient allergy to antibiotics. Also, the benefit of eradicating H. pylori from its human host has been debated (Richter, 2001
). This, in conjunction with the overall negative effect that antibiotics may have on the human gastrointestinal microbiota, has led researchers to investigate new pathways for treatment of infection by H. pylori as well as other pathogens.
Breast milk is known to have a general anti-microbial effect (Hamosh, 1998
). In addition, milk contains free oligosaccharides and glycoconjugates such as glycoproteins and glycolipids (Newburg, 1995
, 1999; Burgoyne et al., 1998; Hamosh, 1998
; Mather et al., 1998) believed to confer protection of the infant against a variety of different pathogens, for example H. pylori, by preventing pathogen adhesion (Holmgren et al., 1983
; Andersson et al., 1986
; Stromqvist et al., 1995
; Peterson et al., 1998
; Newburg, 1999
; Schwertmann et al., 1999
; Kunz et al., 2000
; Herrera-Insua et al., 2001
). For instance, purified human milk
-casein was shown to inhibit H. pylori adhesion to sections of human gastric mucosa (Stromqvist et al., 1995
) and whole human milk inhibited H. pylori adhesion to Kato III cells, irrespective of whether or not the donor was infected with H. pylori (Clyne et al., 1997).
Blocking of H. pylori adhesion to stomach epithelial cells may provide an alternative treatment for infected patients, presumably not resulting in eradication nor supporting the development of H. pylori strains resistant to antibiotics. The two adhesins expressed by H. pylori recognize and bind to the carbohydrate epitopes Lewis (Le)b (BabA) and sialyl Lex (SabA). These epitopes are therefore of major importance for the colonization and infection by H. pylori. As a consequence, Leb and sialyl Lex, or similar carbohydrate epitopes, may act as decoys for H. pylori thereby preventing H. pylori binding and colonization. A recent study by Ruiz-Palazios (Ruiz-Palacios et al., 2003
) showed that the presence of the Campylobacter jejuni-binding epitope Fuc
12Galß14GlcNAc (H type 2) on mouse milk glycoconjugates, as a result of transgenic expression of the human
1,2-fucosyltransferase (FUT1) in the dams, could prevent infection by this bacterium in the suckling pups. This shows that the concept of blocking pathogen adhesion as a mean to prevent infection has potentials. However, earlier studies trying to interfere with proteincarbohydrate interactions between the pathogen and its host have been less successful. Mysore et al. (1999)
treated H. pylori-infected rhesus monkeys with the free oligosaccharide NeuAc
2,3Galß1,4Glc (3'-sialyllactose). This resulted in clearance of the pathogen in 50% of the animals, but in the animals that had a higher degree of colonization, H. pylori infection persisted. A potential multivalent presentation of the H type 2 antigen on mouse milk glycoproteins may explain the treatment efficacy observed by Ruiz-Palazios. Simple oligosaccharides, as used in the Mysore study, may not provide binding affinities high enough to accomplish efficient blocking of a microbe adhering to the mucosal cell by multiple attachment sites.
In a previous study (Gustafsson et al., 2005
), we showed that the H. pylori-binding carbohydrate epitopes Leb and sialyl Lex were expressed on porcine milk proteins. Here, we show that expression of Leb and sialyl Lex on porcine milk proteins is breed- and individual specific and has the capacity to inhibit binding of different H. pylori strains to sialyl Lex and Leb neoglycoproteins. This inhibitory capacity of pig milk correlates to the expression levels of sialyl Lex and Leb on several pig milk glycoproteins. Further, in vivo studies with H. pylori colonized mice show that animals fed with pig milk containing Leb- and sialyl Lex-expressing glycoproteins show a lower degree of colonization compared to animals fed with Leb- and sialyl Lex-negative milk or water only, indicating that porcine milk containing these epitopes may have a therapeutic effect on H. pylori infections.
| Results |
|---|
|
|
|---|
Characterization of H. pylori-binding epitopes on milk proteins from defined pig breeds
The expression of sialyl Lex and Leb in three different pig strains, Finnish Landrace (FL), Hungarian Large White (HLW), and a crossbreed between these two strains, HLW x FL, were examined.
Sialyl Lex expression was seen on milk proteins in several of the individual milk samples from the FL as well as the crossbreed, HLW x FL (Figure 1a and b; specific antibody binding labelled with *). The approximate sizes of the sialyl Lex-expressing proteins are 150, 75, and 50 kDa. In contrast, no staining was seen of proteins in the HLW pig samples (Figure 1c). To verify the expression of sialyl Lex epitopes on pig milk proteins, a different antibody detecting this carbohydrate epitope (CSLEX) was used on a selection of pig milk samples. The staining obtained with this antibody (data not shown) matched the staining seen with the KM93 antibody (Figure 1).
|
The FL pig milk samples all showed Leb reactivity on two major proteins of molecular masses around 100 kDa and 160 kDa. In addition, staining of a band with a very high molecular mass was seen in all samples (Figure 2a). This could correspond to a large mucin-type protein or to some noncharged glycoconjugates, for example, glycosphingolipids, present in the sample but unable to migrate into the gel. In contrast, the HLW x FL crossbreed pig samples were all negative except for one stained component (
150 kDa) in one individual (Figure 2b). The HLW pig milk samples showed no reactivity at all with the anti-Leb antibody (Figure 2c). The weak staining seen with both the sialyl Lex and the Leb antibody in all pig milk samples, including the sialyl Lex nonreactive HLW pig samples as well as the Leb nonreactive crossbreed and HLW pig samples, is consistent with nonspecific secondary antibody staining (data not shown).
|
Characterization of sialyl Lex- and Leb-related antigens on milk proteins from defined pig breeds
The occurrence of anti-Leb and anti-sialyl Lex reactivity on pig milk proteins indicates the presence of a
1,3/4-fucosyltransferase in pig mammary epithelial cells. Consequently, the expression also of additional Lewis antigens is possible. To investigate this matter, pig milk from the different breeds were tested for their reactivity with anti-Lex, -Lea, and -sialyl-Lea antibodies (data not shown). Lex expression were seen on a 150-kDa protein in milk samples from the FL and the crossbreed HLW x FL. Likewise, weak expression of sialyl-Lea could be detected on a 150-kDa protein in milk samples from these breeds, whereas the HLW individuals lacked expression of both Lex and sialyl Lex. The Lex expression in the FL and the HLW x FL crossbreeds matched the expression of sialyl Lex with strongest staining for individuals 3, 6, and 8 of the FL pigs and individuals 1, 3, 4, and 5 of the crossbreeds. No specific staining was seen with the anti-Lea antibody for either pig breed.
Inhibition of H. pylori adhesion to Leb and sialyl Lex neoglycoproteins by porcine milk
Milk samples from the various pig strains and individuals were tested with regard to their ability to inhibit the binding of iodine-labelled sialyl-diLex-HSA or Leb-HSA to the sialyl Lex- and Leb-binding H. pylori strains J99, CCUG17875DM (sialyl Lex) and CCUG17875/Leb. The inhibition of H. pylori J99 binding to sialyl-diLex-HSA conjugates by milk from FL, HLW x FL crossbreeds, and HLW pigs is shown in Figure 3a. All of the milk samples from the FL pigs had an inhibitory effect, and the milk from 8/10 FL pigs inhibited binding more than 70% compared to controls at a dilution of x500. Among the crossbreeds, the milk from 3/6 pigs had an inhibitory effect exceeding 70%. The inhibitory effect of the milk from HLW pigs was less than 40% in 8/10 individuals at a dilution of x500.
|
The sialyl Lex-specific strain CCUG17875DM was also tested for binding to sialyl-diLex-HSA at different milk dilutions. As for the J99 strain, pig milk expressing sialyl Lex had a good inhibitory capacity on H. pylori CCUG17875DM binding to the sialyl-di-Lex-conjugate (data not shown). Milk from the FL breed showed an inhibition of more than 90% for 8/10 individuals at a milk dilution of x200 and milk from the crossbreed had an inhibitory effect exceeding 50% at the same dilution. In contrast, the inhibitory effect of the milk from HLW pigs was marginal at a dilution of x200, whereas at lower dilutions (x25) inhibitions approaching 75% were seen for some pigs.
Inhibition of H. pylori J99 binding to Leb conjugates by milk obtained from the different pig strains was in general weaker. At a dilution of x50, the milk from 6/10 FL pigs inhibited Leb-conjugate binding by at least 80% compared to the controls (Figure 4a). One of six crossbreed pigs inhibited binding by 70% at a milk dilution of x50, whereas only one of the HLW pig milk samples had an inhibitory capacity of above 50% at this dilution.
|
A second H. pylori strain was tested also for binding to Leb-HSA, namely the Leb-specific strain CCUG17875/Leb (data not shown). At a dilution of x200, the milk from 4/10 FL pigs inhibited Leb-conjugate binding by at least 50%. Of the crossbreeds, one of six inhibited binding by 50% at a milk dilution of x100, whereas none of the HLW pig milk samples had this inhibitory capacity.
The expression levels in individual pig milk samples of sialyl Lex and Leb epitopes correlated very well to their inhibitory effect on H. pylori binding to sialyl-diLex and Leb neoglycoproteins, respectively (shown for strain J99 only, Figures 3b and 4b), with a correlation coefficient of 0.76 for the sialyl Lex epitope at a milk dilution of x500 and 0.75 for the Leb epitope at a milk dilution of x50.
The effect of pig milk on H. pylori colonization in mice
Pig milk was tested with regard to its ability to inhibit H. pylori colonization of FUTIII transgenic FVB/N mice. Animals were colonized with the H. pylori J99 strain and subsequently fed milk from sialyl Lex and Leb-expressing (FL) and sialyl Lex and Leb-nonexpressing (HLW) pigs. Compared to water, porcine milk from both strains reduced the level of H. pylori colonization in the stomachs of Leb-expressing mice (Figure 5). Milk from FL individuals had an inhibitory effect on H. pylori colonization in mice that was significantly stronger (P < 0.05) than that of milk from Leb- and sialyl Lex- nonexpressing HLW pigs (Figure 5). The mean value of lactobacillus colonies in mice treated with milk from FL or HLW pig individuals were 7.8E+04 and 3.63E+04, respectively (difference not significant), whereas the mean value for mice treated with water was 1.51E+05.
|
| Discussion |
|---|
|
|
|---|
In the human stomach, H. pylori adhere to mucous-producing surface epithelial cells derived from the pit cell lineage (Falk et al., 1993
The specialized binding pattern of H. pylori might explain its extraordinary capability to uphold infection in its host, as well as in a population, for decades. The more severe outcomes of H. pylori infection, for example, adenocarcinoma, usually develop first after a long period of chronic infection. These facts make it especially important to find alternative treatments for H. pylori infection as compared to other pathogens, considering the risks of treating whole populations with antibiotics when only a smaller, unknown group of individuals will develop the more severe diseases associated with infection. For reasons discussed below, we suggest that milk expressing the carbohydrate epitopes known to mediate binding of H. pylori has the potential to provide an alternative treatment of H. pylori infection.
Our results show that the H. pylori-binding epitopes sialyl Lex and Leb are expressed on several different milk proteins in a breed- and individual-specific manner. Also, we show that the inhibitory capacity of individual pig milk samples on H. pylori binding to Leb-HSA and sialyl Lex-HSA correlates to the expression of Leb and sialyl Lex on pig milk proteins of the different individuals. Proteincarbohydrate interactions are generally known to be of low affinity because of the weak chemical forces involved in binding. Natures way to enhance this affinity is the use of multivalency, that is, the simultaneous binding of multiple ligands on one biological entity to multiple receptors on another (Mammen et al., 1998
; Lee and Lee, 2000
). The protein backbone provides the mechanism needed for a multivalent presentation of the carbohydrate epitopes to their corresponding receptors. Therefore, protein-bound carbohydrate epitopes have an advantage over free oligosaccharides in inhibiting proteincarbohydrate interactions. Thus, the existence of the Leb and sialyl Lex carbohydrate epitopes on pig milk proteins is likely to mediate the major part of the H. pylori inhibitory capacity of the Leb- and sialyl Lex-expressing pig milk in this mouse model.
Milk proteins are mainly produced by the mammary epithelial cells and subsequently secreted from their apical surface by exocytosis (Burgoyne et al., 1998
). Milk lipids originate from the endoplasmic reticulum (ER) and are secreted enveloped by cellular membranes (Mather et al., 1998
). In humans, the milk fat globule (MFG) proteins are comprised of the mucins MUC-1 and MUC-X, lactadherin and butyrophilin. These proteins have been implicated to play a role in the protection of the infant against a number of pathogens (Peterson et al., 1998
). In particular, bovine MFG membranes were shown to inhibit sialic-acid dependent haemagglutination of H. pylori with an activity comparable to human gastrointestinal mucins (Hirmo et al., 1998
). Although the protein constitution of pig milk has not been explored in detail, it is likely to contain the same particular proteins found in milk from other animals (e.g., cow, goat). In fact, the profile of pig milk-glycosylated proteins strongly resembled the profile seen for cow colostrums (Gustafsson et al., 2005
) known to contain abundant glycosylated proteins.
H. pylori binding to gastric tissue sections has been shown to colocalize with expression of MUC5AC (Van de Bovenkamp et al., 2003
), a mucin expressed and secreted by gastric epithelial cells. Furthermore, the binding of H. pylori was closely associated with the expression of Leb on the same subset of cells. Also, purified Leb-expressing human MUC5AC has been shown to support binding of H. pylori, a binding that could be inhibited by Leb-HSA (Linden et al., 2002
). This implies that the natural ligand for H. pylori in the human stomach is a Leb-expressing mucin. Although man is the main host, H. pylori can also naturally colonize rhesus monkeys. A recent study showed that MUC5AC from this species express both Leb and sialyl Lex and that its binding of H. pylori was dependent on the expression of these carbohydrate epitopes (Linden et al., 2004
).
In pig milk, Leb and sialyl Lex carbohydrate epitopes were seen on several proteins with a molecular weight of above 100 kDa. These proteins may be of the mucin type. Thus, pig milk may contain glycoconjugates similar to the ones utilized by H. pylori upon infection of its host. This, in conjunction with the high expression of glycosylated proteins including several expressing Leb and sialyl Lex, probably contributes to the high inhibitory capacity of pig milk on H. pylori binding.
Similar to humans (Sakamoto et al., 1989
),
1,3/4-fucosyltransferase FVB/N transgenic mice express the Leb antigen on gastric pit and surface mucous cells (Falk et al., 1995
). H. pylori colonization of such mice results in epithelial attachment of the bacterium, active gastritis, and a mucosa-associated lymphoid infiltrate (Guruge et al., 1998
). Accordingly, H. pylori infection in the Leb-expressing FVB/N mouse exhibits some similarities to the pathological features of H. pylori infections in man. In contrast to humans, transgenic FVB/N mice were shown to express sialyl Lex also in noninflamed gastric pit and surface epithelium (Mahdavi et al., 2002
). Consequently, both receptor epitopes (Leb and sialyl Lex) recognized by the H. pylori J99 strain used in our study, are present in this mouse model. Leb and sialyl Lex containing pig milk is likely to competitively block H. pylori attachment to mouse gastric epithelium and thereby prevent colonization.
The carbohydrate structures expressed on milk proteins are produced and processed in the ER and the Golgi of mammary gland epithelial cells. Although the pathway for synthesis of the complex oligosaccharides found in milk is not fully understood, it has been suggested that the synthesis starts with the addition of an N-acetylglucosamine (GlcNAc) to lactose by the ß3-N-acetyl-glucosaminyltransferase (iGnT) usually acting on glycoproteins, and that the synthesis then continues in the same way as for protein-bound oligosaccharides (Kobata, 2003
). Hence, complex oligosaccharides present on milk glycoconjugates are likely to be expressed also in the oligosaccharide fraction of milk. This implies that the Leb and sialyl Lex structures found on pig milk proteins are likely to be present also as free oligosaccharides. The H. pylori binding specificity for free oligosaccharides and glycoconjugates expressing the same terminal carbohydrate epitope has been shown to differ (Boren et al., 1993
), with a broader low affinity (see Discussion above) receptor specificity for free oligosaccharides. Even though they bind with lower affinity, free Leb and sialyl Lex oligosaccharides may contribute to the inhibitory capacity of pig milk on H. pylori colonization.
The expression of Lex and sialyl-Lea on one milk protein from the FL and the HLW x FL breeds further support the presence of one (or several)
1,3/4-fucosyltransferase(s) capable of utilizing type 1 and type 2 chains for the production of Lewis antigens on protein-bound glycans in the mammary epithelial cells of these pig breeds. H. pylori has been shown to bind to a number of different epitopes (Karlsson, 2000
), and it may be that these Lewis antigens to some extent contribute to the H. pylori inhibitory capacity seen for milk from the FL and the HLW x FL breeds. In particular, the J99 strain has been shown to recognize sialyl-Lea (Mahdavi et al., 2002
). However, the only binding epitopes for H. pylori so far where the receptors have been identified are the Leb and the sialyl Lex epitopes as mediated by the adhesins BabA and SabA, respectively (Ilver et al., 1998
; Mahdavi, J. et al. 2002). Consequently, the role of Lewis antigens other than Leb and sialyl Lex for the inhibitory capacity of pig milk on H. pylori binding can only be speculated upon.
In conclusion, we have shown that pig milk has the capacity to inhibit H. pylori binding in vitro and H. pylori colonization in vivo. This inhibitory effect is likely to be explained by (1) the multivalent expression of the carbohydrate epitopes Leb and sialyl Lex on high molecular-weight pig milk proteins, supporting a presentation of these epitopes to H. pylori that mimics the natural ligands in its habitat, the human stomach and (2) the expression of the same epitopes on several different pig milk proteins, most likely increasing the likelihood of some of them being recognized by the H. pylori adhesins BabA and SabA. As a consequence, pig milk or milk from other animals either naturally, or transgenically, expressing the H. pylori-binding epitopes Leb and sialyl Lex might have a therapeutic effect on H. pylori infection. The use of such a therapeutic need not be limited to patients with already established H. pylori-associated diseases but could be used also in a preventive manner already at an earlier stage of infection.
| Materials and methods |
|---|
|
|
|---|
Chemicals and antibodies
Bovine serum albumin (BSA) neoglycoproteins carrying Leb or sialyl Lex carbohydrate epitopes were purchased from Dextra (Reading, UK). Sialyl di-Lex-HSA and Leb-HSA were purchased from Isosep AB (Tullinge, Sweden). BSA and HRP-conjugated goat anti-mouse IgG [F(ab)'2] antibody were obtained from Sigma Chemical (St. Louis, MO). IsoVitalex was obtained from BBL Microbiology Systems (Cockeysville, MD). Mouse anti-Leb (IgM, clone T218) antibody recognizing Fuc
1, 2Galß1,3(Fuc
1,4)GlcNAc (Sakamoto et al., 1986
2,3Galß1,4(Fuc
1,3)GlcNAc (Dohi et al., 1993
2,3Galß1,4(Fuc
1,3)GlcNAc (Fukushima et al., 1984
Milk samples
Pig milk samples were collected from HLW, FL, and a crossbreed of HLW x FL. All samples were collected from animals that were in good health condition with no signs of clinical or subclinical mastitis.
Bacterial strains and culture
H. pylori strains J99 (Israel et al., 2001
) (adhesion assay), CCUG 17875DM (Mahdavi et al., 2002
), CCUG17875/Leb (Mahdavi et al., 2002
) and CCUG17874 (Ilver et al., 1998
) were grown on Brucella agar supplemented with 10% bovine blood and 1% IsoVitalex for two days in 10% CO2, 5% O2 at 37°C. H. pylori strain J99 (in vivo study) was grown on chocolage agar (CA) plates (Colombia agar, 8.5% horse blood, 10% horse serum) for 24 h at 37°C in a microaerophilic atmosphere (BBL GasPak Plus, Becton Dickinson and Company, Sparks, MD).
Determination of the total protein concentration in milk samples
Milk samples were frozen immediately upon collection and stored at 20°C until further processed. The protein concentration in individual milk samples was determined using the microtiter plate protocol of the BCA (bicinchoninic acid) Protein Assay Reagent (Pierce, Rockford, IL) according to the manufacturers instructions. Samples were run in triplicate.
One-dimensional SDSPAGE
Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDSPAGE) was run using 412% BisTris discontinuous polyacrylamide gels (NuPAGE; Invitrogen, Carlsbad, CA) using a MES-buffer and nonreducing conditions. Before electrophoresis, individual milk samples were adjusted to a concentration of 3 mg/mL and, to avoid streaking, mixed with EDTA to a final concentration of 10 mM. A total protein amount of 11 µg was loaded per well. Separated proteins were visualized by a kit detecting glycosylated proteins by virtue of periodate oxidation of carbohydrate residues followed by conjugation to a fluorochrome emitting a bright green-fluorescent signal. Subsequently, the Ruby stain, which detects all proteins (Molecular Probes, Leiden, the Netherlands), was used.
Western blotting
Separated proteins were electrophoretically blotted onto nitrocellulose membranes (Invitrogen) using a Mini Trans-Blot electrophoretic transfer cell (Bio-Rad, Hercules, CA). Membranes were blocked overnight in phosphate-buffered saline with 0.2% Tween-20 (PBS-T) and 3% BSA, and subsequently washed with PBS-T. The membranes were incubated with primary and secondary antibodies diluted in blocking buffer for 1 h. Membranes were washed with PBS-T in between and after antibody incubations. Bound secondary reagents were detected using the ECL western blotting reagents (Amersham Biosciences, Uppsala, Sweden) followed by exposure of the membrane on Hyperfilm ECL (Amersham Biosciences).
H. pylori inhibiting milk titers versus pig milk Leb and sialyl Lex expression
The expression of Leb and sialyl Lex in individual pig milks was calculated from the total optical density using the Quantity One software (Bio-Rad, Hercules, CA). All films were exposed for 5 s and the background subtracted using a rolling disk value of 50. Bands were selected manually and the sum of all specific bands (Figures 1 and 2) in each lane was calculated. The milk titer value, that is the milk dilution that resulted in a 50% reduction of Leb- or sialyl-di-Lex-HSA binding to H. pylori was plotted against the sum of all bands of the lane optical density for that sample.
H. pylori adhesion assay
Milk samples were centrifuged for 1 h at 4°C at 39,000 g and subsequently cooled for removal of the top milk fat layer. The remaining skim milk part was used as sample and diluted in PBS-T with 1% BSA (blocking buffer). As a control, blocking buffer without milk sample was used. Two nanograms (sialyl diLex-HSA) or 0.2 ng (Leb-HSA) of 125I-labelled glycoconjugates (Ilver et al., 1998
) were used per mL reaction solution. Bacterial strains were diluted in blocking buffer to a final OD of 0.2 for J99 and CCUG17875DM used in the sialyl-diLex assay and 0.001 for J99 and CCUG17875/Leb used in the Leb assay. Diluted milk was mixed with conjugate and bacteria and incubated for 2 h (sialyl-diLex assay) or 17 h (Leb assay) in room temperature, centrifuged 13 min at 20,000 g, and supernatant sucked off and transferred to new tubes. The activity of the pellet (bound) as well as the supernatant (free) HSA-glycoconjugates were measured in a
-counter.
H. pylori colonization model in mice
Six- to eight-weeks-old male transgenic FVB/N mice expressing fucosylated blood group antigens (Falk et al., 1995
) were used for the experiment. Three groups of seven animals were colonized with a low passage J99 H. pylori strain. The J99 was grown on CA plates for 24 h at 37°C in a microaerophilic atmosphere. The mice were inoculated orally by gavage with 108 colony forming units (CFU)/mL of the H. pylori strain J99, two times a week for 2 weeks. They were housed in separate cages in a 12-h lightdark cycle and were fed a standard pellet diet. Two weeks after the last oral inoculation of H. pylori J99, the treatment with pig milk from FL (Leb/sLex +) or HLW (Leb/sLex ) pigs started. Four milliliters of milk were given per mouse to drink at will each day for a period of 9 days. Each mouse consumed all the milk during the day. At night, the mice had free access to water. The control group received only water. After treatment, the mice were sacrificed, and their stomachs were opened along the longer curvature using sterile instruments where after they were rinsed in sterile phosphate-buffered saline. The stomachs were homogenized and smeared on CA plates supplemented with 10% horse serum and 10 mg/mL vancomycin, 2500 IU/L polymyxin B and 5 mg/mL trimetoprim before they were incubated in a microaerophilic atmosphere at 37°C for 5 days. H. pylori J99 was identified as small translucent colonies containing gram-negative curved rods and by polymerase chain reaction (PCR) (35 cycles of 94°C for 30s, 50°C for 60s, and 72°C for 60s, extension for 15 min at 72°C) amplifying J99 BabA by specific primers (5'-3' A10 forward: GCGTAGGCTATCAAATCGGT and A19 reverse: GAAGAGGT- GCTTTCTTGACCATTAGCGTTACCCCGCATGCGT). The number of H. pylori J99 was estimated by colony count. The total amount of bacteria and lactobacilli was investigated by culturing the homogenized stomachs on blood agar plates and rogosa plates pH 5.5 (Merck, Darmstadt, Germany) incubated for 48 h at 37°C in an anaerobic atmosphere. The animal study was approved by the local animal ethics committee.
Statistics
To correlate the expression levels of sialyl Lex and Leb to the inhibitory effect on H. pylori binding to sialyl-diLex-HSA and Leb-HSA neoglycoproteins, respectively, in individual pig milk samples, a Product-Moment and Partial Correlations was used (Statistica, StatSoft Tulsa). To assess the significance of the difference between groups in the number of colonies (CFU) in mouse stomachs treated with sialyl Lex and Leb-expressing (FL) porcine milk, sialyl Lex and Leb-nonexpressing (HLW) porcine milk and water (control), the KruskalWallis test and Dunns Multiple Comparison Test was used. The analyses were made using the GraphPad PRISM software (version 4, GraphPad software, San Diego, CA). Extreme values were excluded.
| Acknowledgments |
|---|
|
|
|---|
This work was supported by the Swedish Research Council, the National Research Fund of Hungary (OTKA T035209) and the Swedish Cancer Society (Project no. 4101-B0003XAB). J.H. held until December 2003 a position within the program "Glycoconjugates in Biological Systems" financed by the Swedish Foundation for Strategic Research. We thank Dr. Mats Remberger for advice on statistics.
| Abbreviations |
|---|
BSA, bovine serum albumin; CA, chocolage agar; FL, Finnish Landrace; H type 1, Fuc
12Galß13GlcNAc; HLW, Hungarian Large White; HLW x FL, Hungarian Large White x Finnish Landrace; HSA, human serum albumin; Lewis b, Fuc
1-2Galß1-3[Fuc
1-4]GlcNAc; sialyl Lewis x, NeuAc
2,3Galß14[Fuc
13]GlcNAc| References |
|---|
|
|
|---|
Andersson, B., Porras, O., Andersson, B., Porras, O., Hanson, L.A., Lagergard, T., and Svanborg-Eden, C. (1986) Inhibition of attachment of Streptococcus pneumoniae and Haemophilus influenzae by human milk and receptor oligosaccharides. J. Infect. Dis., 153, 232237.[Web of Science][Medline]
Aspholm-Hurtig, M., Dailide, G., Lahmann, M., Kalia, A., Ilver, D., Roche, N., Vikstrom, S., Sjostrom, R., Linden, S., Backstrom, A., and others. (2004) Functional adaptation of BabA, the H. pylori ABO blood group antigen binding adhesin. Science, 305, 519522.
Blaser, M.J. (1996) The bacteria behind ulcers. Sci. Am., 274, 104107.[Web of Science][Medline]
Boren, T., Falk, P., Roth, K.A., Larson, G., and Normark, S. (1993) Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science, 262, 18921895.
Burgoyne, R.D. and Duncan, J.S. (1998) Secretion of milk proteins. J. Mammary Gland Biol. Neoplasia, 3, 275286.[CrossRef][Web of Science][Medline]
Clyne, M. and Drumm, B. (1997) Adherence of Helicobacter pylori to the gastric mucosa. Can. J. Gastroenterol., 11, 243248.[Web of Science][Medline]
Crespo, A. and Suh, B. (2001) Helicobacter pylori infection: epidemiology, pathophysiology, and therapy. Arch. Pharm. Res., 24, 485498.[Web of Science][Medline]
Dohi, T., Nemoto, T., Ohta, S., Shitara, K., Hanai, N., Nudelman, E., Hakomori, S., and Oshima, M. (1993) Different binding properties of three monoclonal antibodies to sialyl Le(x) glycolipids in a gastric cancer cell line and normal stomach tissue. Anticancer Res., 13, 12771282.[Web of Science][Medline]
Falk, P., Roth, K.A., Boren, T., Westblom, T.U., Gordon, J.I., and Normark, S. (1993) An in vitro adherence assay reveals that Helicobacter pylori exhibits cell lineage-specific tropism in the human gastric epithelium. Proc. Natl. Acad. Sci. U. S. A., 90, 20352039.
Falk, P.G., Bry, L., Holgersson, J., and Gordon, J.I. (1995) Expression of a human alpha-1,3/4-fucosyltransferase in the pit cell lineage of FVB/N mouse stomach results in production of Leb-containing glycoconjugates: a potential transgenic mouse model for studying Helicobacter pylori infection. Proc. Natl. Acad. Sci. U. S. A., 92, 15151519.
Fukushima, K., Hirota, M., Terasaki, P.I., Wakisaka, A., Togashi, H., Chia, D., Suyama, N., Fukushi, Y., Nudelman, E., and Hakomori, S. (1984) Characterization of sialosylated Lewisx as a new tumor-associated antigen. Cancer Res., 44, 52795285.
Guruge, J.L., Falk, P.G., Lorenz, R.G., Dans, M., Wirth, H.P., Blaser, M.J., Berg, D.E., and Gordon, J.I. (1998) Epithelial attachment alters the outcome of Helicobacter pylori infection. Proc. Natl. Acad. Sci. U. S. A., 95, 39253930.
Gustafsson, A., Kacskovics, I., and others. (2005) Carbohydrate phenotyping of human and animal milk glycoproteins. Glycoconj. J., 22, 109118.[CrossRef][Web of Science][Medline]
Hamosh, M. (1998) Protective function of proteins and lipids in human milk. Biol. Neonate, 74, 163176.[CrossRef][Web of Science][Medline]
Herrera-Insua, I., Gomez, H.F., Diaz-Gonzalez, V.A., Chaturvedi, P., Newburg, D.S., and Cleary, T.G. (2001) Human milk lipids bind Shiga toxin. Adv. Exp. Med. Biol., 501, 333339.[Web of Science][Medline]
Hirmo, S., Kelm, S., Iwersen, M., Hotta, K., Goso, Y., Ishihara, K., Suguri, T., Morita, M., Wadstrom, T., and Schauer, R. (1998) Inhibition of Helicobacter pylori sialic acid-specific haemagglutination by human gastrointestinal mucins and milk glycoproteins. FEMS Immunol. Med. Microbiol., 20, 275281.[CrossRef][Web of Science][Medline]
Holmgren, J., Svennerholm, A.M., and Lindblad, M. (1983) Receptor-like glycocompounds in human milk that inhibit classical and El Tor Vibrio cholerae cell adherence (hemagglutination). Infect. Immun., 39, 147154.
Ilver, D., Arnqvist, A., Ogren, J., Frick, I.M., Kersulyte, D., Incecik, E.T., Berg, D.E., Covacci, A., Engstrand, L., and Boren, T. (1998) Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science, 279, 373377.
Israel, D.A., Salama, N., Krishna, U., Rieger, U.M., Atherton, J.C., Falkowi, S., and Peek, R.M. Jr. (2001) Helicobacter pylori genetic diversity within the gastric niche of a single human host. Proc. Natl. Acad. Sci. U. S. A., 98, 1462514630.
Kamisago, S., Iwamori, M., Tai, T., Mitamura, K., Yazaki, Y., and Sugano, K. (1996) Role of sulfatides in adhesion of Helicobacter pylori to gastric cancer cells. Infect. Immun., 64, 624628.[Abstract]
Kanoh, A., Ota, M., Narimatsu, H., and Irimura, T. (2003) Expression levels of FUT6 gene transfected into human colon carcinoma cells switch two sialyl-Lewis X-related carbohydrate antigens with distinct properties in cell adhesion. Biochem. Biophys. Res. Commun., 303, 896901.[CrossRef][Web of Science][Medline]
Karlsson, K.A. (2000) The human gastric colonizer Helicobacter pylori: a challenge for host-parasite glycobiology. Glycobiology, 10, 761771.
Kobata, A. (2003) Possible application of milk oligosaccharides for drug development. Chang Gung Med. J., 26, 621636.[Medline]
Kunz, C., Rudloff, S., Baier, W., Klein, N., and Strobel, S. (2000) Oligosaccharides in human milk: structural, functional, and metabolic aspects. Annu. Rev. Nutr., 20, 699722.[CrossRef][Web of Science][Medline]
Lee, R.T. and Lee, Y.C. (2000) Affinity enhancement by multivalent lectincarbohydrate interaction. Glycoconj. J., 17, 543551.[CrossRef][Web of Science][Medline]
Linden, S., Nordman, H., Hedenbro, J., Hurtig, M., Boren, T., and Carlstedt, I. (2002) Strain- and blood group-dependent binding of Helicobacter pylori to human gastric MUC5AC glycoforms. Gastroenterology, 123, 19231930.[CrossRef][Web of Science][Medline]
Linden, S., Boren, T., Dubois, A., and Carlstedt, I. (2004) Rhesus monkey gastric mucins: oligomeric structure, glycoforms and Helicobacter pylori binding. Biochem. J., 379, 765775.[CrossRef][Web of Science][Medline]
Mahdavi, J., Sonden, B., Hurtig, M., Olfat, F.O., Forsberg, L., Roche, N., Angstrom, J., Larsson, T., Teneberg, S., Karlsson, K.A., and others. (2002) Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science, 297, 573578.
Mammen, M., Choi, S., and Whitesides, G. (1998) Polyvalent interactions in biological systems: implications for design and use of multivalent ligands and inhibitors. Angew. Chem. Int. Ed., 37, 27542794.[CrossRef]
Mather, I.H. and Keenan, T.W. (1998) Origin and secretion of milk lipids. J. Mammary Gland Biol. Neoplasia, 3, 259273.[CrossRef][Web of Science][Medline]
Megraud, F. (2001) Resistance of Helicobacter pylori to antibiotics and its impact on treatment options. Drug Resist. Updat., 4, 178186.[CrossRef][Web of Science][Medline]
Meurer, L.N. and Bower, D.J. (2002) Management of Helicobacter pylori infection. Am. Fam. Physician, 65, 13271336.[Web of Science][Medline]
Miller-Podraza, H., Milh, M.A., Teneberg, S., and Karlsson, K.A. (1997) Binding of Helicobacter pylori to sialic acid-containing glycolipids of various origins separated on thin-layer chromatograms. Infect. Immun., 65, 24802482.[Abstract]
Mitsuoka, C., Kawakami-Kimura, N., Kasugai-Sawada, M., Hiraiwa, N., Toda, K., Ishida, H., Kiso, M., Hasegawa, A., and Kannagi, R. (1997) Sulfated sialyl Lewis X, the putative L-selectin ligand, detected on endothelial cells of high endothelial venules by a distinct set of anti-sialyl Lewis X antibodies. Biochem. Biophys. Res. Commun., 230, 546551.[CrossRef][Web of Science][Medline]
Mysore, J.V., Wigginton, T., Simon, P.M., Zopf, D., Heman-Ackah, L.M., and Dubois, A. (1999) Treatment of Helicobacter pylori infection in rhesus monkeys using a novel antiadhesion compound. Gastroenterology, 117, 13161325.[CrossRef][Web of Science][Medline]
Newburg, D.S. (1999) Human milk glycoconjugates that inhibit pathogens. Curr. Med. Chem., 6, 117127.[Web of Science][Medline]
Newburg, D.S. and Neubauer, S.H. (1995) Carbohydrates in milks: analysis, quantities, and significance. In Handbook of Milk Composition, Chapter 4. Academic Press, San Diego, CA.
Peterson, J.A., Patton, S., and Hamosh, M. (1998) Glycoproteins of the human milk fat globule in the protection of the breast-fed infant against infections. Biol. Neonate, 74, 143162.[CrossRef][Web of Science][Medline]
Richter, J.E. (2001) H pylori: the bug is not all bad. Gut, 49, 319320.
Roche, N., Larsson, T., Angstrom, J., and Teneberg, S. (2001) Helicobacter pylori-binding gangliosides of human gastric adenocarcinoma. Glycobiology, 11, 935944.
Ruiz-Palacios, G.M., Cervantes, L.E., Ramos, P., Chavez-Munguia, B., and Newburg, D.S. (2003) Campylobacter jejuni binds intestinal H(O) antigen (Fuc alpha, 1, 2Gal beta 1, 4GlcNAc), and fucosyloligosaccharidesa of human milk inhibit its binding and infection. J. Biol. Chem., 278, 1411214120.
Sakamoto, J., Furukawa, K., Cordon-Cardo, C., Yin, B.W., Rettig, W.J., Oettgen, H.F., Old, L.J., and Lloyd, K.O. (1986) Expression of Lewisa, Lewisb, X, and Y blood group antigens in human colonic tumors and normal tissue and in human tumor-derived cell lines. Cancer Res., 46, 15531561.
Sakamoto, S., Watanabe, T., Tokumaru, T., Takagi, H., Nakazato, H., and Lloyd, K.O. (1989) Expression of Lewisa, Lewisb, Lewisx, Lewisy, siayl-Lewisa, and sialyl-Lewisx blood group antigens in human gastric carcinoma and in normal gastric tissue. Cancer Res., 49, 745752.
Schwertmann, A., Schroten, H., Hacker, J., and Kunz, C. (1999) S-fimbriae from Escherichia coli bind to soluble glycoproteins from human milk. J. Pediatr. Gastroenterol. Nutr., 28, 257263.[CrossRef][Web of Science][Medline]
Stromqvist, M., Falk, P., Bergstrom, S., Hansson, L., Lonnerdal, B., Normark, S., and Hernell, O. (1995) Human milk kappa-casein and inhibition of Helicobacter pylori adhesion to human gastric mucosa. J. Pediatr. Gastroenterol. Nutr., 21, 288296.[Web of Science][Medline]
Syder, A.J., Guruge, J.L., Li, Q., Hu, Y., Oleksiewicz, C.M., Lorenz, R.G., Karam, S.M., Falk, P.G., and Gordon, J.I. (1999) Helicobacter pylori attaches to NeuAc alpha 2,3Gal beta 1,4 glycoconjugates produced in the stomach of transgenic mice lacking parietal cells. Mol. Cell, 3, 263274.[CrossRef][Web of Science][Medline]
Van de Bovenkamp, J.H., Mahdavi, J., Korteland-Van Male, A.M., Buller, H.A., Einerhand, A.W., Boren, T., and Dekker, J. (2003) The MUC5AC glycoprotein is the primary receptor for Helicobacter pylori in the human stomach. Helicobacter, 8, 521532.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. Kobayashi, H. Lee, J. Nakayama, and M. Fukuda Roles of gastric mucin-type O-glycans in the pathogenesis of Helicobacter pylori infection Glycobiology, May 1, 2009; 19(5): 453 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haesebrouck, F. Pasmans, B. Flahou, K. Chiers, M. Baele, T. Meyns, A. Decostere, and R. Ducatelle Gastric Helicobacters in Domestic Animals and Nonhuman Primates and Their Significance for Human Health Clin. Microbiol. Rev., April 1, 2009; 22(2): 202 - 223. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. D. Winn, M. Gormley, A. C. Paquet, K. Kjaer-Sorensen, A. Kramer, K. K. Rumer, R. Haimov-Kochman, R.-F. Yeh, M. T. Overgaard, A. Varki, et al. Severe Preeclampsia-Related Changes in Gene Expression at the Maternal-Fetal Interface Include Sialic Acid-Binding Immunoglobulin-Like Lectin-6 and Pappalysin-2 Endocrinology, January 1, 2009; 150(1): 452 - 462. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Sugahara, T. Hirata, T. Tanaka, S. Ogino, M. Takeda, H. Terasawa, I. Shimada, J.-i. Tamura, G. B. ten Dam, T. H. van Kuppevelt, et al. Chondroitin Sulfate E Fragments Enhance CD44 Cleavage and CD44-Dependent Motility in Tumor Cells Cancer Res., September 1, 2008; 68(17): 7191 - 7199. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Attrill, A. Imamura, R. S. Sharma, M. Kiso, P. R. Crocker, and D. M. F. van Aalten Siglec-7 Undergoes a Major Conformational Change When Complexed with the {alpha}(2,8)-Disialylganglioside GT1b J. Biol. Chem., October 27, 2006; 281(43): 32774 - 32783. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









