Glycobiology Advance Access originally published online on December 1, 2004
Glycobiology 2005 15(4):361-367; doi:10.1093/glycob/cwi019
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology vol. 15 no. 4 © Oxford University Press 2004; all rights reserved.
The N-X-S/T consensus sequence is required but not sufficient for bacterial N-linked protein glycosylation
Institute of Microbiology, Department of Biology, Swiss Federal Institute of Technology Zurich, ETH Hönggerberg, CH-8093 Zürich, Switzerland
1 Present address: Department of Biochemistry and Cell Biology, State University of New York at Stony Brook, Stony Brook, NY 11794-5215
2 To whom correspondence should be addressed; e-mail: aebi{at}micro.biol.ethz.ch
Received on August 23, 2004; revised on November 16, 2004; accepted on November 28, 2004
| Abstract |
|---|
|
|
|---|
In the Gram-negative bacterium Campylobacter jejuni there is a pgl (protein glycosylation) locusdependent general N-glycosylation system of proteins. One of the proteins encoded by pgl locus, PglB, a homolog of the eukaryotic oligosaccharyltransferase component Stt3p, is proposed to function as an oligosaccharyltransferase in this prokaryotic system. The sequence requirements of the acceptor polypeptide for N-glycosylation were analyzed by reverse genetics using the reconstituted glycosylation of the model protein AcrA in Escherichia coli. As in eukaryotes, the N-X-S/T sequon is an essential but not a sufficient determinant for N-linked protein glycosylation. This conclusion was supported by the analysis of a novel C. jejuni glycoprotein, HisJ. Export of the polypeptide to the periplasm was required for glycosylation. Our data support the hypothesis that eukaryotic and bacterial N-linked protein glycosylation are homologous processes.
Key words: AcrA / Campylobacter jejuni / glycoproteins / N-glycosylation
| Introduction |
|---|
|
|
|---|
N-linked protein glycosylation is the most frequent protein modification in eukaryotic cells. It occurs in the lumen of the endoplasmic reticulum (ER) through a complex pathway that is conserved in most of the eukaryotes (Helenius and Aebi, 2004
N-linked protein glycosylation, for a long time considered specific for eukaryotes and archaea, was recently detected in the Gram-negative bacterium Campylobacter jejuni. The N-glycosylation machinery of C. jejuni is encoded by the pgl locus (Szymanski et al., 2003
; Wacker et al., 2002
; Young et al., 2002
). Based on the sequence analysis of pgl encoded polypeptides, it was concluded that bacterial and eukaryotic N-glycosylation represent homologous processes (Wacker et al., 2002
). We proposed that in the bacterial N-glycosylation, an oligosaccharide is assembled on a lipid carrier at the cytoplasmic side of the plasma membrane, translocated into the periplasm, and transferred to selected asparagine residues of polypeptide chains. As in eukaryotes, the glycosylation sites would be characterized by the N-X-S/T sequon (Gavel and Von Heijne, 1990
), where X can be any amino acid except proline (Bause, 1983
; Bause and Legler, 1981
; Gavel and Von Heijne, 1990
; Imperiali et al., 1992
). Limited structural data of C. jejuni glycoproteins support this hypothesis (Wacker et al., 2002
). Bacterial N-linked protein glycosylation is dependent on the PglB protein, a transmembrane protein with significant sequence similarity to the eukaryotic Stt3p protein family. In particular, PglB contains the highly conserved sequence motif WWDYG in the C-terminal part essential for enzymatic activity in vivo (Wacker et al., 2002
; Yan and Lennarz, 2002
). For that reason it was suggested that the PglB protein is the bacterial OST (Wacker et al., 2002
). Importantly, the oligosaccharide structure transferred in the C. jejuni system differs significantly from the oligosaccharide used in eukaryotic cells (Wacker et al., 2002
; Young et al., 2002
).
In this article, we aimed at testing experimentally two of the predictions based on the hypothesis that bacterial and eukaryotic N-linked protein glycosylation are homologous processes. (1) N-X-S/T is the acceptor sequence of bacterial N-linked glycosylation, and (2) N-linked protein glycosylation occurs in the periplasm. For the experimental setup, we took advantage of the finding that protein glycosylation can be functionally transferred from C. jejuni to Escherichia coli by expressing the C. jejuni pgl locus and glycosylatable proteins in this host (Wacker et al., 2002
).
| Results |
|---|
|
|
|---|
Analysis of point mutations in the N-X-S/T sequon
Two out of five N-X-S/T sequons serve as glycan acceptor in AcrA.
AcrA, the best characterized C. jejuni glycoprotein, contains five potential N-glycosylation sites that follow the canonical N-X-S/T sequence. We have shown previously that one of these sites, 123-N-R-S-125, was glycosylated by the C. jejuni glycosylation system (Wacker et al., 2002
Expression of C. jejuni AcrA in E. coli yielded unglycosylated AcrA (Figure 1, lane 1), whereas coexpression of AcrA with the C. jejuni pgl locus revealed glycosylated AcrA, visualized by the R12 serum (Figure 1, lane 2), demonstrating the specificity of the R12 serum. The two glycosylation specific bands represent monoglycosylated (g1AcrA) and diglycosylated (g2AcrA) AcrA protein. The majority of the AcrA protein remains unglycosylated, as shown with the serum raised against AcrA (Figure 1, lane 2), indicating partial glycosylation under the conditions used.
|
As expected, the N to L replacement at position 123, the previously identified glycosylation site, resulted in only monoglycosylated AcrA (Figure 1, lane 4). In contrast, the N to L mutations at position 117 and 147, respectively, did not alter AcrA glycosylation (Figure 1, lanes 3 and 5). On the contrary, the N273-274L double replacement NN to LL resulted in monoglycosylated AcrA, as did the N273L mutation (Figure 1, lanes 6 and 7), whereas the N274L mutation did not affect glycosylation (Figure 1, lane 8). We concluded that also the second glycosylation site of AcrA was found among the putative glycosylation sites (position 273N-N-S275) as deduced from the eukaryotic glycosylation system.
Serine or threonine can serve as hydroxyl amino acid in the acceptor sequence, proline as the X residue prevents glycosylation.
The asparagine residue of the N-X-S/T sequence is directly modified by the glycosylation machinery. In the eukaryotic glycosylation system, the hydroxyl amino acid serine or threonine within the consensus sequence is an essential component of the acceptor sequence (Bause and Legler, 1981
; Gavel and Von Heijne, 1990
; Imperiali et al., 1992
). To assess whether the bacterial N-glycosylation system imposes the same sequence requirements, we replaced the serine residue of the 123-N-R-S-125 sequon by an alanine or a threonine residue. As visualized in Figure 2, lane 4, the S to A mutation inactivated the glycosylation site, only monoglycosylated AcrA was detected. In contrast, the replacement of the serine with a threonine residue did not alter the glycosylation state of AcrA protein (Figure 2, lane 5). As was the case for the eukaryotic glycosylation sites (Bause, 1983
), a proline separating the acceptor asparagines from the hydroxyl amino acid serine inactivated the acceptor sequence (Figure 2, lane 6).
|
We concluded that the N-glycosylation site requirements of the bacterial glycosylation system were the same as for the eukaryotic system. Importantly, of the five potential glycosylation sites within the AcrA sequence, only two were utilized, indicating that the N-X-S/T sequon was necessary but not sufficient to act as an acceptor sequence in the bacterial system.
The N-X-S/T sequon is required but not sufficient for glycosylation of the HisJ protein
Identification of HisJ as a glycoprotein.
To support this conclusion, we identified an additional C. jejuni protein that reacted with the R12 antiserum. This protein appears as a band of 32 kDa on SDSPAGE of wild-type membrane extracts that are probed with the R12 serum (Figure 3, lane 1). This band was no longer observed when a pglB mutant strain of C. jejuni was analyzed the same way (Figure 3, lane 2). This putative glycoprotein was purified by affinity chromatography using an soybean agglutininlectin column (Linton et al., 2002
) and tryptic fragments were analyzed by mass spectrometry (MS). Comparison with the deduced proteome of C. jejuni identified the glycoprotein as the HisJ protein, a component of the histidine uptake system located in the periplasm (Garvis et al., 1996
, 1997
; Pawelec et al., 1998
, 2000
) and encoded by the Cj0734c gene. Site-directed deletion of the Cj0734c gene and complementation by a plasmid-borne hisJ copy verified that the 32-kDa protein was encoded by the hisJ (Cj0734c) locus (Figure 3, lanes 3 and 4). The primary amino acid sequence of HisJ suggested an N-terminal lipid anchor of the mature protein (Sankaran et al., 1995
), supported by strong membrane association of the HisJ protein during purification (data not shown).
|
One out of two N-X-S/T sequons serve as an acceptor for glycosylation.
Two potential N-linked glycosylation sites (29-N-A-S-31 and 127-N-D-S-129) were identified in the primary HisJ coding sequence. To confirm that HisJ was indeed a glycoprotein, the C. jejuni HisJ protein containing a C-terminal His6-tag was expressed in E. coli in the presence and absence of the C. jejuni pgl locus. The R12 serum recognized HisJ in its nonglycosylated form (Figure 4, lane 2). Co-expression of the pgl glycosylation locus in HisJ-expressing E. coli cells yielded an additional, slower-moving protein in SDSPAGE (Figure 4, lane 1) that was absent when the locus encoded the mutant, inactive form of PglB (Figure 4, lane 5; Wacker et al., 2002
). These data suggested a single oligosaccharide chain attached to the HisJ protein. Indeed, we found that the mutation N29L within the first potential N-glycosylation site resulted in a disappearance of the glycosylated HisJ, whereas the N127L mutation within the second glycosylation sequon did not affect glycosylation (Figure 4, lanes 3 and 4).
|
N-glycosylation occurs in the periplasm
Both AcrA and HisJ protein are periplasmic proteins with a specific signal sequence containing the information for the attachment of the protein to the membrane via an N-terminal lipid anchor (Sankaran et al., 1995
). To assess whether periplasmic location and lipid anchor were required for glycosylation, mutant forms of the AcrA protein were expressed in glycosylation-competent E. coli cells. First, the endogenous AcrA signal sequence was replaced by that of PelB from Erwinia carotovora (Lei et al., 1987
). This resulted in a secreted but soluble periplasmic protein that did not contain the lipid anchor. Importantly, this exchange of the signal sequence did not alter glycosylation of AcrA in E. coli (Figure 5, lane 2). However, deletion of the signal sequence, resulting in cytoplasmic expression of the protein, did completely abolish glycosylation (Figure 5, lane 3). The proposed localization of the different forms of AcrA was confirmed by subcellular fractionation (Figure 6). AcrA with its endogenous signal sequence was mainly localized in the membrane fraction, whereas the AcrA with the PelB signal sequence was in the periplasmic fraction, and both these forms were glycosylated. AcrA lacking a signal sequence was mainly found in the cytosolic but also in the other fractions. This was most likely due to the formation of cytoplasmic inclusion bodies and suebsequent copurification with periplasmic and membrane fractions. SurA, a periplasmic protein, and OmpF, a membrane protein, served as controls for proper fractionation. We concluded that periplasmic location of the protein was required for N-linked protein glycosylation, but attachment of the protein to the membrane by a lipid anchor was not necessary for this post-translational modification.
|
|
| Discussion |
|---|
|
|
|---|
We analyzed the requirements for the polypeptide substrate in the bacterial N-linked protein glycosylation system. As an experimental system, we used E. coli cells transformed with the C. jejuni pgl locus. In these glycosylation competent cells, two different periplasmic C. jejuni proteins (AcrA and HisJ) were expressed. Both of these substrates were modified in a PglB-dependent manner. Site-directed mutagenesis of putative N-X-S/T glycosylation sites revealed that utilization of a glycosylation site was impaired by exchanging the asparagine acceptor residue with a leucine residue, by exchanging the serine residue with alanine, or by placing a proline as the X residue in between the two functionally important sites. Importantly, exchanging the serine residue of one glycosylation site by threonine did not affect utilization of this site. These findings follow the peptide substrate requirements for eukaryotic N-glycosylation with the acceptor sequence N-X-S/T, where X can be any amino acid except proline. As in eukaryotic systems, where about 60% of the sequons in secretory proteins are glycosylated (Petrescu et al., 2004
Interestingly, a recent study of sequence requirements in the archaeal N-glycosylation system revealed two distinct N-glycosylation processes, one of them independent of the hydroxyl amino acid residue (Zeitler et al., 1998
).
In eukaryotes, N-linked protein glycosylation occurs in the lumen of the ER. Our present findings with signal sequences directing translocation of the polypeptide into the periplasm suggest that N-linked protein glycosylation occurs in the periplasm, the functionally equivalent compartment to the ER lumen of eukaryotes.
In summary, we have shown that with respect to localization and peptide acceptor sequence, eukaryotic and bacterial N-glycosylation are homologous processes. Similar conclusions were obtained by analyzing the requirements for the oligosaccharide substrate and the role of the putative PglB OST in this process (Feldman et al., unpublished data). The bacterial N-glycosylation process is therefore an ideal experimental system to address the molecular mechanism of N-linked protein glycosylation, a ubiquitous protein modification.
| Materials and methods |
|---|
|
|
|---|
Bacterial strains and plasmids
C. jejuni 81176 (Black et al., 1988
was the host for cloning experiments and E. coli BL21(DE3) the host for high-level expression of AcrA, HisJ, and proteins encoded by pgl locus. E. coli DH5
(RK212.1) was used as a donor in conjugation experiments (Figurski and Helinski, 1979
|
Purification of C. jejuni glycoproteins and identification by MS
C. jejuni glycoproteins were purified as described elsewhere (Wacker et al., 2002
). The purified glycoproteins were separated by 12% SDSPAGE and stained with GELCODE blue stain reagent (Pierce Biotechnology, Rockford, IL). The protein of
32 kDa was cut from the gel using a scalpel and reduced with 10 mM dithiothreitol; the free cysteine thiols were alkylated with 50 mM iodoacetamide and the protein was trypsin-digested (sequencing grade, Promega, Madison, WI). The peptide fragments were analyzed by matrix-assisted laser desorption/ionization MS and the protein identified by mass fingerprinting and database searching.
Mutagenesis of hisJ in C. jejuni
Mutagenesis of hisJ was carried out by replacing most of the coding sequence with a kanamycin resistance cassette. The following primer pairs were used: 5' GGGAGTACTCTA-GGAACGGCTTGAGTATC 3' and 5' TATCGATCGCCAACTAA-AGCAACTAGAGC 3' (for amplification of 5' fragment), 5' GGATTAATGCAAAAACTGATGGATTTTATG 3' and 5' GGATTAATGAAGCAGGTGATAAAATCGC 3' (for amplification of 3' fragment). The restriction sites are underlined. The 778-bp 3' fragment was amplified by polymerase chain reaction (PCR) using C. jejuni 81176 genomic DNA as template, cut with VspI, and cloned into pILL600 cleaved with the same enzyme, located downstream of the Kmr cassette (Labigne-Roussel et al., 1988
). Next, the 776-bp 5' fragment was amplified by PCR using C. jejuni 81176 genomic DNA as template; the fragment was cut with ScaI and PvuI and cloned into the resulting plasmid cleaved with the same enzymes. These restriction sites are located upstream of the Kmr cassette. The resulting plasmid pILL600 (hisJ) containing aphA inserted in the same transcriptional orientation as hisJ was used to transform C. jejuni 81176 by natural transformation (Guerry et al., 1994
) and mutants were selected on MH agar containing kanamycin. The mutants were characterized by PCR to confirm that the incoming plasmid DNA had integrated by a double crossover event and in the same transcriptional orientation as the deleted gene, minimizing the risk of polar effects.
Complementation of hisJ mutant in trans
HisJ including promoter and transcription terminator was amplified by PCR with the following primers using C. jejuni 81176 genomic DNA as template: 5' CAATCCCCTCTGCAGGGTTTGC 3' and 5' CGAGCGTGCGGCCGCTAAATTTAGTGG 3'. The restriction sites are underscored. The 1.75-kb PCR product was cut with PstI and NotI and cloned into the chloramphenicol-resistant Campylobacter shuttle plasmid pRY111 cut with the same enzymes. The resulting plasmid pRY111(hisJ) was mobilized from E. coli DH5
containing pRK211.1 into C. jejuni hisJ mutant cells (Guerry et al., 1994
). Transconjugants were selected on MH agar containing kanamycin and chloramphenicol.
Expression of AcrA and HisJ in E. coli
AcrA and hisJ were amplified by PCR using C. jejuni 81176 genomic DNA as template with the following primers: 5' GGAATTCCATATGAAATTATTTCAAAAAAATACTATTTTA-GC 3' and 5' CCGCTCGAGTTGTGCTCCAATTTCTTTAACTTCGCTACC 3' (acrA), 5' GGAATTCCATATGAGCAAAGAAGAAGCACCAAAAATAC 3' and 5' CCGCTCGA-GTTGTGCTCCAATTTCTTTAACTTCGCTACC 3' (acrA, no signal sequence), 5' GAGCT-CCGTCGACAAGCTATGAAAAAAATATTAAGCATTGCTCTAGTT 3'and 5' TGCTCG-AGTGCGGCCGCAAGCTTGTCGTTCTAATTCATATTTT-TTAATTAAAG 3' (hisJ). The restriction sites are underscored. The PCR products were cut with NdeI and XhoI or SalI and NotI and cloned into pET24b cut with the same enzymes. Under the control of the T7 promoter, this leads to the expression of membrane-attached AcrA (pET24 [AcrA]), soluble cytoplasmic AcrA (pET24 [AcrA-cyt]) and membrane-attached HisJ (pET24 [HisJ]), all of them with a His6 tag at the C-terminus. To express AcrA as a soluble protein in the periplasm, the nucleotides encoding for the pelB leader sequence were amplified using pET22b as template and the following primers: 5' GGAATTCCATATGCATGGCCATCGCCGGCTG-GG 3' and 5' CTTCCGGGCGCTATCATGCCATACCGCGAAAGG 3'. The restriction site is underscored. The PCR product was cut with NdeI and cloned into the plasmid expressing AcrA in the cytoplasm cut with the same enzyme, resulting in pET24 (AcrA-per). Correct orientation of the pelB leader sequence was verified by PCR.
Introduction of point mutations in AcrA and HisJ
Introduction of point mutations in AcrA and HisJ was performed using the QuikChange mutagenesis kit (Statagene, La Jolla, CA), pET24b (AcrA) and pET24 (HisJ) as template and the primers noted in Table II.
|
SDSPAGE and detection
Expression of AcrA and HisJ was induced by addition of 1 mM ispropylthiogalactoside. Membrane proteins from BL21 (DE3) expressing AcrA and the proteins encoded by the pgl cluster were prepared as described (Wacker et al., 2002
). Whole-cell extracts from BL21 (DE3) expressing HisJ and the proteins encoded by the pgl cluster were pelleted by trichloracetic acid. The protein expression was analyzed by 10% and 12% SDSPAGE, respectively, and detection by western blot using antiserum raised against whole cell extracts of C. jejuni (R12) and antiserum raised against recombinant AcrA produced in E. coli.
Preparation of subcellular fractions
AcrA and proteins encoded by the pgl locus were expressed in E. coli BL21 cells. Cells were pelleted in the mid-log phase and incubated in lysis buffer (1 mg/ml lysozyme, 20% w/v sucrose, 30 mM Tris-HCl [pH 8.5], 1 mM ethylenediamine tetra-acetic acid [pH 8.0]) for 30 min at 4°C. The spheroblasts were pelleted at 14,000 x g for 2 min at 4°C. The supernatant contains the periplasmic fraction. The pellet was resuspended in 0.1 M Tris-HCl, pH 8.5. Spheroblasts were broken by freeze and thaw method with alternating liquid nitrogen and 37°C incubation cycles. Cell debris was pelleted at 5000 x g for 5 min and membranes at 250,000 x g for 30 min at 4°C. The supernatant contains the cytoplasmic proteins.
| Acknowledgements |
|---|
This work was supported by the Swiss National Science Foundation (grant 3100-057082/2 to M.A.), the Gebert-Rüf Foundation, and the ETH Zürich.
| Abbreviations |
|---|
ER, endoplasmic reticulum; MS, mass spectrometry; OST, oligosaccharyltransferase; PCR, polymerase chain reaction; SDSPAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis
| References |
|---|
|
|
|---|
Bause, E. (1983) Structural requirements of N-glycosylation of proteins. Studies with proline peptides as conformational probes. Biochem. J., 209, 331336.[Web of Science][Medline]
Bause, E. and Legler, G. (1981) The role of the hydroxy amino acid in the triplet sequence Asn-Xaa-Thr(Ser) for the N-glycosylation step during glycoprotein biosynthesis. Biochem. J., 195, 639644.[Web of Science][Medline]
Black, R.E., Levine, M.M., Clements, M.L., Hughes, T.P., and Blaser, M.J. (1988) Experimental Campylobacter jejuni infection in humans. J. Infect. Dis., 157, 472479.[Web of Science][Medline]
Figurski, D.H. and Helinski, D.R. (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl Acad. Sci. USA, 76, 16481652.
Garvis, S.G., Puzon, G.J. and Konkel, M.E. (1996) Molecular characterization of a Campylobacter jejuni 29-kilodalton periplasmic binding protein. Infect. Immun., 64, 35373543.[Abstract]
Garvis, S.G., Puzon, G.J. and Konkel, M.E. (1997) Cloning, sequencing, and expression of a Campylobacter jejuni periplasmic binding protein (P29) involved in histidine transport. Adv. Exp. Med. Biol., 412, 263264.[Web of Science][Medline]
Gavel, Y. and Von Heijne, G. (1990) Sequence differences between glycosylated and non-glycosylated Asn-X-Thr/Ser acceptor sites: implications for protein engineering. Protein Eng., 3, 433442.
Guerry, P., Yao, R., Alm, R.A., Burr, D.H., and Trust, T.J. (1994) Systems of experimental genetics for Campylobacter species. Methods Enzymol., 235, 474481.[Web of Science][Medline]
Helenius, A. and Aebi, M. (2004) Roles of N-linked glycans in the endoplasmic reticulum. Annu. Rev. Biochem., 73, 10191049.[CrossRef][Web of Science][Medline]
Imperiali, B., Shannon, K.L., Unno, M., and Rickert, K.W. (1992) A mechanistic proposal for asparagine-linked glycosylation. J. Am. Chem. Soc., 114, 79447945.
Kelleher, D.J., Karaoglu, D., Mandon, E.C., and Gilmore, R. (2003) Oligosaccharyltransferase isoforms that contain different catalytic STT3 subunits have distinct enzymatic properties. Mol. Cell, 12, 101111.[CrossRef][Web of Science][Medline]
Knauer, R. and Lehle, L. (1999) The oligosaccharyltransferase complex from yeast. Biochim. Biophys. Acta, 1426, 259273.[Medline]
Kornfeld, R. and Kornfeld, S. (1985) Assembly of asparagine-linked oligosaccharides. Annu. Rev. Biochem., 54, 631664.[CrossRef][Web of Science][Medline]
Labigne-Roussel, A., Courcoux, P., and Tompkins, L. (1988) Gene disruption and replacement as a feasible approach for mutagenesis of Campylobacter jejuni. J. Bacteriol., 170, 17041708.
Lei, S.P., Lin, H.C., Wang, S.S., Callaway, J., and Wilcox, G. (1987) Characterization of the Erwinia carotovora pelB gene and its product pectate lyase. J. Bacteriol., 169, 43794383.
Linton, D., Allan, E., Karlyshev, A.V., Cronshaw, A.D., and Wren, B.W. (2002) Identification of N-acetylgalactosamine-containing glycoproteins PEB3 and CgpA in Campylobacter jejuni. Mol. Microbiol., 43, 497508.[CrossRef][Web of Science][Medline]
Nilsson, I., Kelleher, D.J., Miao, Y., Shao, Y., Kreibich, G., Gilmore, R., von Heijne, G., and Johnson, A.E. (2003) Photocross-linking of nascent chains to the STT3 subunit of the oligosaccharyltransferase complex. J. Cell Biol., 161, 715725.
Pawelec, D., Jakubowska-Mroz, J., and Jagusztyn-Krynicka, E.K. (1998) Campylobacter jejuni 72Dz/92 cjaC gene coding 28 kDa immunopositive protein, a homologue of the solute-binding components of the ABC transport system. Lett. Appl. Microbiol., 26, 6976.[CrossRef][Web of Science][Medline]
Pawelec, D.P., Korsak, D., Wyszynska, A.K., Rozynek, E., Popowski, J., and Jagusztyn-Krynicka, E.K. (2000) Genetic diversity of the Campylobacter genes coding immunodominant proteins. FEMS Microbiol. Lett., 185, 4349.[CrossRef][Web of Science][Medline]
Petrescu, A.J., Milac, A.L., Petrescu, S.M., Dwek, R.A., and Wormald, M.R. (2004) Statistical analysis of the protein environment of N-glycosylation sites: implications for occupancy, structure, and folding. Glycobiology, 14, 103114.
Sankaran, K., Gupta, S.D., and Wu, H.C. (1995) Modification of bacterial lipoproteins. Methods Enzymol., 250, 683697.[Web of Science][Medline]
Szymanski, C.M., Logan, S.M., Linton, D., and Wren, B.W. (2003) Campylobactera tale of two protein glycosylation systems. Trends Microbiol., 11, 233238.[Web of Science][Medline]
Wacker, M., Linton, D., Hitchen, P.G., Nita-Lazar, M., Haslam, S.M., North, S.J., Panico, M., Morris, H.R., Dell, A., Wren, B.W., and Aebi, M. (2002) N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science, 298, 17901793.
Yan, Q. and Lennarz, W.J. (2002) Studies on the function of oligosaccharyl transferase subunits: a glycosylatable photoprobe binds to the luminal domain of Ost1p. Proc. Natl Acad. Sci. USA, 99, 1599415999.
Yao, R., Alm, R.A., Trust, T.J., and Guerry, P. (1993) Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene, 130, 127130.[CrossRef][Web of Science][Medline]
Young, N.M., Brisson, J.R., Kelly, J., Watson, D.C., Tessier, L., Lanthier, P.H., Jarrell, H.C., Cadotte, N., St Michael, F., Aberg, E., and Szymanski, C.M. (2002) Structure of the N-linked glycan present on multiple glycoproteins in the Gram-negative bacterium, Campylobacter jejuni. J. Biol. Chem., 277, 4253042539.
Zeitler, R., Hochmuth, E., Deutzmann, R., and Sumper, M. (1998) Exchange of Ser-4 for Val, Leu or Asn in the sequon Asn-Ala-Ser does not prevent N-glycosylation of the cell surface glycoprotein from Halobacterium halobium. Glycobiology, 8, 11571164.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. M. Davis, T. Kakuda, and V. J. DiRita A Campylobacter jejuni znuA Orthologue Is Essential for Growth in Low-Zinc Environments and Chick Colonization J. Bacteriol., March 1, 2009; 191(5): 1631 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sterba, M. Vancova, N. Rudenko, M. Golovchenko, T.-L. Tremblay, J. F. Kelly, C. R. MacKenzie, S. M. Logan, and L. Grubhoffer Flagellin and Outer Surface Proteins from Borrelia burgdorferi Are Not Glycosylated J. Bacteriol., April 1, 2008; 190(7): 2619 - 2623. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kohda, M. Yamada, M. Igura, J. Kamishikiryo, and K. Maenaka New oligosaccharyltransferase assay method Glycobiology, November 1, 2007; 17(11): 1175 - 1182. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kakuda and V. J. DiRita Cj1496c Encodes a Campylobacter jejuni Glycoprotein That Influences Invasion of Human Epithelial Cells and Colonization of the Chick Gastrointestinal Tract. Infect. Immun., August 1, 2006; 74(8): 4715 - 4723. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Verma, M. Schirm, S. K. Arora, P. Thibault, S. M. Logan, and R. Ramphal Glycosylation of b-Type Flagellin of Pseudomonas aeruginosa: Structural and Genetic Basis. J. Bacteriol., June 1, 2006; 188(12): 4395 - 4403. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Weerapana and B. Imperiali Asparagine-linked protein glycosylation: from eukaryotic to prokaryotic systems Glycobiology, June 1, 2006; 16(6): 91R - 101R. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kelly, H. Jarrell, L. Millar, L. Tessier, L. M. Fiori, P. C. Lau, B. Allan, and C. M. Szymanski Biosynthesis of the N-Linked Glycan in Campylobacter jejuni and Addition onto Protein through Block Transfer. J. Bacteriol., April 1, 2006; 188(7): 2427 - 2434. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Kelleher and R. Gilmore An evolving view of the eukaryotic oligosaccharyltransferase Glycobiology, April 1, 2006; 16(4): 47R - 62R. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Glover, E. Weerapana, and B. Imperiali In vitro assembly of the undecaprenylpyrophosphate-linked heptasaccharide for prokaryotic N-linked glycosylation PNAS, October 4, 2005; 102(40): 14255 - 14259. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









