Skip Navigation


Glycobiology Advance Access originally published online on December 1, 2004
Glycobiology 2005 15(4):361-367; doi:10.1093/glycob/cwi019
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Correction to PDF
Right arrow A correction has been published
Right arrow All Versions of this Article:
15/4/361    most recent
cwi019v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Nita-Lazar, M.
Right arrow Articles by Aebi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nita-Lazar, M.
Right arrow Articles by Aebi, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology vol. 15 no. 4 © Oxford University Press 2004; all rights reserved.

The N-X-S/T consensus sequence is required but not sufficient for bacterial N-linked protein glycosylation

Mihai Nita-Lazar1, Michael Wacker, Belinda Schegg, Saba Amber and Markus Aebi2

Institute of Microbiology, Department of Biology, Swiss Federal Institute of Technology Zurich, ETH Hönggerberg, CH-8093 Zürich, Switzerland
1 Present address: Department of Biochemistry and Cell Biology, State University of New York at Stony Brook, Stony Brook, NY 11794-5215


2 To whom correspondence should be addressed; e-mail: aebi{at}micro.biol.ethz.ch

Received on August 23, 2004; revised on November 16, 2004; accepted on November 28, 2004


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
In the Gram-negative bacterium Campylobacter jejuni there is a pgl (protein glycosylation) locus–dependent general N-glycosylation system of proteins. One of the proteins encoded by pgl locus, PglB, a homolog of the eukaryotic oligosaccharyltransferase component Stt3p, is proposed to function as an oligosaccharyltransferase in this prokaryotic system. The sequence requirements of the acceptor polypeptide for N-glycosylation were analyzed by reverse genetics using the reconstituted glycosylation of the model protein AcrA in Escherichia coli. As in eukaryotes, the N-X-S/T sequon is an essential but not a sufficient determinant for N-linked protein glycosylation. This conclusion was supported by the analysis of a novel C. jejuni glycoprotein, HisJ. Export of the polypeptide to the periplasm was required for glycosylation. Our data support the hypothesis that eukaryotic and bacterial N-linked protein glycosylation are homologous processes.

Key words: AcrA / Campylobacter jejuni / glycoproteins / N-glycosylation


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
N-linked protein glycosylation is the most frequent protein modification in eukaryotic cells. It occurs in the lumen of the endoplasmic reticulum (ER) through a complex pathway that is conserved in most of the eukaryotes (Helenius and Aebi, 2004Go; Kornfeld and Kornfeld, 1985Go). This pathway can be divided into two distinct processes: (1) the assembly of the lipid-linked oligosaccharide at the membrane of the ER, and (2) the transfer of the preassembled oligosaccharide (Glc3- Man9GlcNAc2) from the lipid anchor dolichyl pyrophosphate to nascent polypeptides with the consensus sequence N-X-S/T (Helenius and Aebi, 2004Go). The transfer of the oligosaccharide to protein is catalyzed by the oligosaccharyltransferase (OST), a protein complex that is composed of multiple subunits. In the best studied yeast enzyme, eight different components, all transmembrane proteins, have been identified (Knauer and Lehle, 1999Go). Stt3p is the most highly conserved protein in this complex. Genetic and biochemical studies in both yeast and mammalian cells suggest that this protein plays a central role in the enzymatic activity of OST (Kelleher et al., 2003Go; Nilsson et al., 2003Go; Yan and Lennarz, 2002Go).

N-linked protein glycosylation, for a long time considered specific for eukaryotes and archaea, was recently detected in the Gram-negative bacterium Campylobacter jejuni. The N-glycosylation machinery of C. jejuni is encoded by the pgl locus (Szymanski et al., 2003Go; Wacker et al., 2002Go; Young et al., 2002Go). Based on the sequence analysis of pgl encoded polypeptides, it was concluded that bacterial and eukaryotic N-glycosylation represent homologous processes (Wacker et al., 2002Go). We proposed that in the bacterial N-glycosylation, an oligosaccharide is assembled on a lipid carrier at the cytoplasmic side of the plasma membrane, translocated into the periplasm, and transferred to selected asparagine residues of polypeptide chains. As in eukaryotes, the glycosylation sites would be characterized by the N-X-S/T sequon (Gavel and Von Heijne, 1990Go), where X can be any amino acid except proline (Bause, 1983Go; Bause and Legler, 1981Go; Gavel and Von Heijne, 1990Go; Imperiali et al., 1992Go). Limited structural data of C. jejuni glycoproteins support this hypothesis (Wacker et al., 2002Go). Bacterial N-linked protein glycosylation is dependent on the PglB protein, a transmembrane protein with significant sequence similarity to the eukaryotic Stt3p protein family. In particular, PglB contains the highly conserved sequence motif WWDYG in the C-terminal part essential for enzymatic activity in vivo (Wacker et al., 2002Go; Yan and Lennarz, 2002Go). For that reason it was suggested that the PglB protein is the bacterial OST (Wacker et al., 2002Go). Importantly, the oligosaccharide structure transferred in the C. jejuni system differs significantly from the oligosaccharide used in eukaryotic cells (Wacker et al., 2002Go; Young et al., 2002Go).

In this article, we aimed at testing experimentally two of the predictions based on the hypothesis that bacterial and eukaryotic N-linked protein glycosylation are homologous processes. (1) N-X-S/T is the acceptor sequence of bacterial N-linked glycosylation, and (2) N-linked protein glycosylation occurs in the periplasm. For the experimental setup, we took advantage of the finding that protein glycosylation can be functionally transferred from C. jejuni to Escherichia coli by expressing the C. jejuni pgl locus and glycosylatable proteins in this host (Wacker et al., 2002Go).


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Analysis of point mutations in the N-X-S/T sequon
Two out of five N-X-S/T sequons serve as glycan acceptor in AcrA.
AcrA, the best characterized C. jejuni glycoprotein, contains five potential N-glycosylation sites that follow the canonical N-X-S/T sequence. We have shown previously that one of these sites, 123-N-R-S-125, was glycosylated by the C. jejuni glycosylation system (Wacker et al., 2002Go). We speculated that in addition to this glycosylation site, one other site of AcrA protein was glycosylated, leading to the diglycosylated form. The other potential glycosylation sites are located at positions 117-N-A-S-119, 147-N-N-S-149, and 273-N-N-S-T-276. The latter sequence represents two potential glycosylation sites with overlapping consensus sequences. To test our hypothesis that the second glycosylation site of AcrA also conforms the N-X-S/T rule, mutant forms of the AcrA protein containing N to L replacements at each of the putative glycosylation sites were generated and coexpressed with the pgl locus in E. coli. To detect AcrA glycosylation, membrane protein extracts of different E. coli strains were separated on sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to membranes, and probed with the R12 serum. This serum, raised against whole C. jejuni cells, recognizes the glycosylated C. jejuni AcrA protein but that does not react with the nonglycosylated protein (Wacker et al., 2002Go). It is therefore an ideal tool to detect glycosylated AcrA when expressed in E. coli. In addition a serum raised against recombinant C. jejuni AcrA protein was used. This serum reacts with AcrA protein irrespective of its glycosylation status.

Expression of C. jejuni AcrA in E. coli yielded unglycosylated AcrA (Figure 1, lane 1), whereas coexpression of AcrA with the C. jejuni pgl locus revealed glycosylated AcrA, visualized by the R12 serum (Figure 1, lane 2), demonstrating the specificity of the R12 serum. The two glycosylation specific bands represent monoglycosylated (g1AcrA) and diglycosylated (g2AcrA) AcrA protein. The majority of the AcrA protein remains unglycosylated, as shown with the serum raised against AcrA (Figure 1, lane 2), indicating partial glycosylation under the conditions used.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Analysis of membrane proteins of E. coli BL21(DE3) overexpressing AcrA or AcrA with replacement of the asparagine residues of the five putative consensus sequences for N-linked glycosylation. Membrane proteins were separated by SDS–PAGE and, after transfer to nitrocellulose, immunodetected with the C. jejuni antiserum R12 (top) or with the antiserum raised against recombinant AcrA produced in E. coli (bottom). The presence of the AcrA-expressing plasmid and the pgl locus containg plasmid is indicated above the lanes. Extracts of cells expressing the proteins encoded by the pgl locus (lanes 2–8) and the AcrA protein in its wild-type (lanes 1 and 2) or mutant forms (lanes 3–8) were analyzed. The following amino acid exchanges were studied: N117L (lane 3), N123L (lane 4), N147L (lane 5), N273–274L (lane 6), N273L (lane 7), N274L (lane 8). The migrating positions of nonglycosylated AcrA (AcrA), monoglycosylated AcrA (g1AcrA), and diglycosylated AcrA (g2AcrA) are indicated. The position of an AcrA degradation product is marked with an asterisk.

 

As expected, the N to L replacement at position 123, the previously identified glycosylation site, resulted in only monoglycosylated AcrA (Figure 1, lane 4). In contrast, the N to L mutations at position 117 and 147, respectively, did not alter AcrA glycosylation (Figure 1, lanes 3 and 5). On the contrary, the N273-274L double replacement NN to LL resulted in monoglycosylated AcrA, as did the N273L mutation (Figure 1, lanes 6 and 7), whereas the N274L mutation did not affect glycosylation (Figure 1, lane 8). We concluded that also the second glycosylation site of AcrA was found among the putative glycosylation sites (position 273N-N-S275) as deduced from the eukaryotic glycosylation system.

Serine or threonine can serve as hydroxyl amino acid in the acceptor sequence, proline as the X residue prevents glycosylation.
The asparagine residue of the N-X-S/T sequence is directly modified by the glycosylation machinery. In the eukaryotic glycosylation system, the hydroxyl amino acid serine or threonine within the consensus sequence is an essential component of the acceptor sequence (Bause and Legler, 1981Go; Gavel and Von Heijne, 1990Go; Imperiali et al., 1992Go). To assess whether the bacterial N-glycosylation system imposes the same sequence requirements, we replaced the serine residue of the 123-N-R-S-125 sequon by an alanine or a threonine residue. As visualized in Figure 2, lane 4, the S to A mutation inactivated the glycosylation site, only monoglycosylated AcrA was detected. In contrast, the replacement of the serine with a threonine residue did not alter the glycosylation state of AcrA protein (Figure 2, lane 5). As was the case for the eukaryotic glycosylation sites (Bause, 1983Go), a proline separating the acceptor asparagines from the hydroxyl amino acid serine inactivated the acceptor sequence (Figure 2, lane 6).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of membrane proteins of E. coli BL21(DE3) overexpressing AcrA or AcrA with amino acid replacements in the 123NRS125 acceptor sequence. Membrane proteins were separated by SDS–PAGE and, after transfer to nitrocellulose, immunodetected with the C. jejuni antiserum R12 (top) or with the antiserum raised against recombinant AcrA produced in E. coli (bottom). The presence of the AcrA-expressing plasmid and the pgl locus containg plasmid is indicated above the lanes. Extracts of cells expressing the proteins encoded by the pgl locus (lanes 2–6) and the AcrA protein in its wild-type (lanes 1 and 2) or mutant forms (lanes 3–6) were analyzed. The following amino acid exchanges were studied: N123L (lane 3), S125A (lane 4), S125T (lane 5), R124P (lane 6). The migrating positions of nonglycosylated AcrA (AcrA), monoglycosylated AcrA (g1AcrA), and diglycosylated AcrA (g2AcrA) are indicated. The position of an AcrA degradation product is marked with an asterisk.

 

We concluded that the N-glycosylation site requirements of the bacterial glycosylation system were the same as for the eukaryotic system. Importantly, of the five potential glycosylation sites within the AcrA sequence, only two were utilized, indicating that the N-X-S/T sequon was necessary but not sufficient to act as an acceptor sequence in the bacterial system.

The N-X-S/T sequon is required but not sufficient for glycosylation of the HisJ protein
Identification of HisJ as a glycoprotein.
To support this conclusion, we identified an additional C. jejuni protein that reacted with the R12 antiserum. This protein appears as a band of 32 kDa on SDS–PAGE of wild-type membrane extracts that are probed with the R12 serum (Figure 3, lane 1). This band was no longer observed when a pglB mutant strain of C. jejuni was analyzed the same way (Figure 3, lane 2). This putative glycoprotein was purified by affinity chromatography using an soybean agglutinin–lectin column (Linton et al., 2002Go) and tryptic fragments were analyzed by mass spectrometry (MS). Comparison with the deduced proteome of C. jejuni identified the glycoprotein as the HisJ protein, a component of the histidine uptake system located in the periplasm (Garvis et al., 1996Go, 1997Go; Pawelec et al., 1998Go, 2000Go) and encoded by the Cj0734c gene. Site-directed deletion of the Cj0734c gene and complementation by a plasmid-borne hisJ copy verified that the 32-kDa protein was encoded by the hisJ (Cj0734c) locus (Figure 3, lanes 3 and 4). The primary amino acid sequence of HisJ suggested an N-terminal lipid anchor of the mature protein (Sankaran et al., 1995Go), supported by strong membrane association of the HisJ protein during purification (data not shown).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. Analysis of C. jejuni membrane proteins of wild type (WT), pglB and hisJ mutants, and complementation in trans. Membrane proteins were separated by SDS–PAGE and, after transfer to nitrocellulose, immunodetected with C. jejuni antiserum R12. Lane 1, WT; lane 2, pglB mutant; lane 3, hisJ mutant; lane 4, hisJ mutant containing expressing HisJ in trans. Molecular weight markers are indicated on the left. The arrow indicates the position of the HisJ glycoprotein (gHisJ) absent in the mutant strains but present when complemented in trans by introduction of the specific plasmids.

 

One out of two N-X-S/T sequons serve as an acceptor for glycosylation.
Two potential N-linked glycosylation sites (29-N-A-S-31 and 127-N-D-S-129) were identified in the primary HisJ coding sequence. To confirm that HisJ was indeed a glycoprotein, the C. jejuni HisJ protein containing a C-terminal His6-tag was expressed in E. coli in the presence and absence of the C. jejuni pgl locus. The R12 serum recognized HisJ in its nonglycosylated form (Figure 4, lane 2). Co-expression of the pgl glycosylation locus in HisJ-expressing E. coli cells yielded an additional, slower-moving protein in SDS–PAGE (Figure 4, lane 1) that was absent when the locus encoded the mutant, inactive form of PglB (Figure 4, lane 5; Wacker et al., 2002Go). These data suggested a single oligosaccharide chain attached to the HisJ protein. Indeed, we found that the mutation N29L within the first potential N-glycosylation site resulted in a disappearance of the glycosylated HisJ, whereas the N127L mutation within the second glycosylation sequon did not affect glycosylation (Figure 4, lanes 3 and 4).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4. Analysis of whole-cell extracts of E. coli BL21(DE3) overexpressing HisJ or HisJ with replacement of the Asn residues of the two putative consensus sequences for N-linked glycosylation. Whole-cell extracts were precipitated by trichloracetic acid and separated by SDS–PAGE and, after transfer to nitrocellulose, immunodetected with the C. jejuni antiserum R12. Lanes 1, 3, and 4, cells expressing the proteins encoded by the pgl cluster and HisJ (lane 1) or HisJ with amino acid exchanges: N29L (lane 3), N127L (lane 4). Lane 5, cells expressing the proteins encoded by the pgl cluster, where PglB contains amino acid substitutions (W458A and Y459A) in the highly conserved domain, and HisJ. The migrating position of unglycosylated HisJ (HisJ) and glycosylated His J (gHisJ) is indicated.

 

N-glycosylation occurs in the periplasm
Both AcrA and HisJ protein are periplasmic proteins with a specific signal sequence containing the information for the attachment of the protein to the membrane via an N-terminal lipid anchor (Sankaran et al., 1995Go). To assess whether periplasmic location and lipid anchor were required for glycosylation, mutant forms of the AcrA protein were expressed in glycosylation-competent E. coli cells. First, the endogenous AcrA signal sequence was replaced by that of PelB from Erwinia carotovora (Lei et al., 1987Go). This resulted in a secreted but soluble periplasmic protein that did not contain the lipid anchor. Importantly, this exchange of the signal sequence did not alter glycosylation of AcrA in E. coli (Figure 5, lane 2). However, deletion of the signal sequence, resulting in cytoplasmic expression of the protein, did completely abolish glycosylation (Figure 5, lane 3). The proposed localization of the different forms of AcrA was confirmed by subcellular fractionation (Figure 6). AcrA with its endogenous signal sequence was mainly localized in the membrane fraction, whereas the AcrA with the PelB signal sequence was in the periplasmic fraction, and both these forms were glycosylated. AcrA lacking a signal sequence was mainly found in the cytosolic but also in the other fractions. This was most likely due to the formation of cytoplasmic inclusion bodies and suebsequent copurification with periplasmic and membrane fractions. SurA, a periplasmic protein, and OmpF, a membrane protein, served as controls for proper fractionation. We concluded that periplasmic location of the protein was required for N-linked protein glycosylation, but attachment of the protein to the membrane by a lipid anchor was not necessary for this post-translational modification.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 5. Analysis of whole-cell extracts of E. coli BL21(DE3) overexpressing membrane-attached (lane 1), periplasmic soluble (lane 2), and cytosolic (lane 3) forms of AcrA protein. All cells coexpress the pgl locus. Proteins were separated by SDS–PAGE and, after transfer to nitrocellulose, immunodetected with the C. jejuni antiserum R12 (top) or with the antiserum raised against recombinant AcrA produced in E. coli (bottom).

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6. Intracellular localization of the three forms of AcrA. Subcelluar fractions of E. coli BL21(DE3) overexpressing membrane-attached (lanes 1, 4, and 7), periplasmic soluble (lanes 2, 5, and 8) and cytosolic (lanes 3, 6, and 9) forms of AcrA protein in the presence of the pgl locus were separated by SDS–PAGE and, after transfer to nitrocellulose, immunodetected with the C. jejuni antiserum R12, with the antiserum raised against recombinant AcrA produced in E. coli and with an antiserum raised against OmpF and SurA from E. coli. Lanes 1–3 represent the membrane fraction (MF), lanes 4–6 the periplasmic fraction (PF), and lanes 7–9 the cytoplasmic fraction (CF). Constitutive proteins of E. coli, SurA, a periplasmic protein, and OmpF, a membrane protein, were used as controls for the fractionation.

 


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
We analyzed the requirements for the polypeptide substrate in the bacterial N-linked protein glycosylation system. As an experimental system, we used E. coli cells transformed with the C. jejuni pgl locus. In these glycosylation competent cells, two different periplasmic C. jejuni proteins (AcrA and HisJ) were expressed. Both of these substrates were modified in a PglB-dependent manner. Site-directed mutagenesis of putative N-X-S/T glycosylation sites revealed that utilization of a glycosylation site was impaired by exchanging the asparagine acceptor residue with a leucine residue, by exchanging the serine residue with alanine, or by placing a proline as the X residue in between the two functionally important sites. Importantly, exchanging the serine residue of one glycosylation site by threonine did not affect utilization of this site. These findings follow the peptide substrate requirements for eukaryotic N-glycosylation with the acceptor sequence N-X-S/T, where X can be any amino acid except proline. As in eukaryotic systems, where about 60% of the sequons in secretory proteins are glycosylated (Petrescu et al., 2004Go), the N-X-S/T sequon was necessary but not sufficient to define an N-glycosylation acceptor sequence. Three out of five and one out of two potential glycosylation sites were not utilized in the proteins we analyzed. This selected utilization was not an artifact due to the heterologous E. coli test system but was also observed in C. jejuni (see Figure 3 for HisJ; Wacker et al., 2002Go, for AcrA).

Interestingly, a recent study of sequence requirements in the archaeal N-glycosylation system revealed two distinct N-glycosylation processes, one of them independent of the hydroxyl amino acid residue (Zeitler et al., 1998Go).

In eukaryotes, N-linked protein glycosylation occurs in the lumen of the ER. Our present findings with signal sequences directing translocation of the polypeptide into the periplasm suggest that N-linked protein glycosylation occurs in the periplasm, the functionally equivalent compartment to the ER lumen of eukaryotes.

In summary, we have shown that with respect to localization and peptide acceptor sequence, eukaryotic and bacterial N-glycosylation are homologous processes. Similar conclusions were obtained by analyzing the requirements for the oligosaccharide substrate and the role of the putative PglB OST in this process (Feldman et al., unpublished data). The bacterial N-glycosylation process is therefore an ideal experimental system to address the molecular mechanism of N-linked protein glycosylation, a ubiquitous protein modification.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Bacterial strains and plasmids
C. jejuni 81–176 (Black et al., 1988Go) was routinely grown on Mueller Hinton agar (Difco, Sparks, MD) under microaerophilic conditions (10% CO2, 5% O2, and 85% N2) at 42°C. E. coli strains were grown on Luria Bertani agar at 37°C. Antibiotics kanamycin (Km), 50 µg/ml; chloramphenicol, 10 µg/ml; and ampicillin, 100 µg/ml were added to the media for selection. E. coli DH5{alpha} was the host for cloning experiments and E. coli BL21(DE3) the host for high-level expression of AcrA, HisJ, and proteins encoded by pgl locus. E. coli DH5{alpha}(RK212.1) was used as a donor in conjugation experiments (Figurski and Helinski, 1979Go). Plasmids pACYC184 (New England Biolabs, Beverly, MA), pET22b, pET24b (Novagen, Madison, WI), and pRY111 (Yao et al., 1993Go) were used as cloning vectors. A full list of plasmids used in this work is given in Table I.


View this table:
[in this window]
[in a new window]
 
Table I. Plasmids used in these studies

 

Purification of C. jejuni glycoproteins and identification by MS
C. jejuni glycoproteins were purified as described elsewhere (Wacker et al., 2002Go). The purified glycoproteins were separated by 12% SDS–PAGE and stained with GELCODE blue stain reagent (Pierce Biotechnology, Rockford, IL). The protein of ~ 32 kDa was cut from the gel using a scalpel and reduced with 10 mM dithiothreitol; the free cysteine thiols were alkylated with 50 mM iodoacetamide and the protein was trypsin-digested (sequencing grade, Promega, Madison, WI). The peptide fragments were analyzed by matrix-assisted laser desorption/ionization MS and the protein identified by mass fingerprinting and database searching.

Mutagenesis of hisJ in C. jejuni
Mutagenesis of hisJ was carried out by replacing most of the coding sequence with a kanamycin resistance cassette. The following primer pairs were used: 5' GGGAGTACTCTA-GGAACGGCTTGAGTATC 3' and 5' TATCGATCGCCAACTAA-AGCAACTAGAGC 3' (for amplification of 5' fragment), 5' GGATTAATGCAAAAACTGATGGATTTTATG 3' and 5' GGATTAATGAAGCAGGTGATAAAATCGC 3' (for amplification of 3' fragment). The restriction sites are underlined. The 778-bp 3' fragment was amplified by polymerase chain reaction (PCR) using C. jejuni 81–176 genomic DNA as template, cut with VspI, and cloned into pILL600 cleaved with the same enzyme, located downstream of the Kmr cassette (Labigne-Roussel et al., 1988Go). Next, the 776-bp 5' fragment was amplified by PCR using C. jejuni 81–176 genomic DNA as template; the fragment was cut with ScaI and PvuI and cloned into the resulting plasmid cleaved with the same enzymes. These restriction sites are located upstream of the Kmr cassette. The resulting plasmid pILL600 (hisJ) containing aphA inserted in the same transcriptional orientation as hisJ was used to transform C. jejuni 81–176 by natural transformation (Guerry et al., 1994Go) and mutants were selected on MH agar containing kanamycin. The mutants were characterized by PCR to confirm that the incoming plasmid DNA had integrated by a double crossover event and in the same transcriptional orientation as the deleted gene, minimizing the risk of polar effects.

Complementation of hisJ mutant in trans
HisJ including promoter and transcription terminator was amplified by PCR with the following primers using C. jejuni 81–176 genomic DNA as template: 5' CAATCCCCTCTGCAGGGTTTGC 3' and 5' CGAGCGTGCGGCCGCTAAATTTAGTGG 3'. The restriction sites are underscored. The 1.75-kb PCR product was cut with PstI and NotI and cloned into the chloramphenicol-resistant Campylobacter shuttle plasmid pRY111 cut with the same enzymes. The resulting plasmid pRY111(hisJ) was mobilized from E. coli DH5{alpha} containing pRK211.1 into C. jejuni hisJ mutant cells (Guerry et al., 1994Go). Transconjugants were selected on MH agar containing kanamycin and chloramphenicol.

Expression of AcrA and HisJ in E. coli
AcrA and hisJ were amplified by PCR using C. jejuni 81–176 genomic DNA as template with the following primers: 5' GGAATTCCATATGAAATTATTTCAAAAAAATACTATTTTA-GC 3' and 5' CCGCTCGAGTTGTGCTCCAATTTCTTTAACTTCGCTACC 3' (acrA), 5' GGAATTCCATATGAGCAAAGAAGAAGCACCAAAAATAC 3' and 5' CCGCTCGA-GTTGTGCTCCAATTTCTTTAACTTCGCTACC 3' (acrA, no signal sequence), 5' GAGCT-CCGTCGACAAGCTATGAAAAAAATATTAAGCATTGCTCTAGTT 3'and 5' TGCTCG-AGTGCGGCCGCAAGCTTGTCGTTCTAATTCATATTTT-TTAATTAAAG 3' (hisJ). The restriction sites are underscored. The PCR products were cut with NdeI and XhoI or SalI and NotI and cloned into pET24b cut with the same enzymes. Under the control of the T7 promoter, this leads to the expression of membrane-attached AcrA (pET24 [AcrA]), soluble cytoplasmic AcrA (pET24 [AcrA-cyt]) and membrane-attached HisJ (pET24 [HisJ]), all of them with a His6 tag at the C-terminus. To express AcrA as a soluble protein in the periplasm, the nucleotides encoding for the pelB leader sequence were amplified using pET22b as template and the following primers: 5' GGAATTCCATATGCATGGCCATCGCCGGCTG-GG 3' and 5' CTTCCGGGCGCTATCATGCCATACCGCGAAAGG 3'. The restriction site is underscored. The PCR product was cut with NdeI and cloned into the plasmid expressing AcrA in the cytoplasm cut with the same enzyme, resulting in pET24 (AcrA-per). Correct orientation of the pelB leader sequence was verified by PCR.

Introduction of point mutations in AcrA and HisJ
Introduction of point mutations in AcrA and HisJ was performed using the QuikChange mutagenesis kit (Statagene, La Jolla, CA), pET24b (AcrA) and pET24 (HisJ) as template and the primers noted in Table II.


View this table:
[in this window]
[in a new window]
 
Table II. Primers used in PCR for site-directed mutagenesis

 

SDS–PAGE and detection
Expression of AcrA and HisJ was induced by addition of 1 mM ispropylthiogalactoside. Membrane proteins from BL21 (DE3) expressing AcrA and the proteins encoded by the pgl cluster were prepared as described (Wacker et al., 2002Go). Whole-cell extracts from BL21 (DE3) expressing HisJ and the proteins encoded by the pgl cluster were pelleted by trichloracetic acid. The protein expression was analyzed by 10% and 12% SDS–PAGE, respectively, and detection by western blot using antiserum raised against whole cell extracts of C. jejuni (R12) and antiserum raised against recombinant AcrA produced in E. coli.

Preparation of subcellular fractions
AcrA and proteins encoded by the pgl locus were expressed in E. coli BL21 cells. Cells were pelleted in the mid-log phase and incubated in lysis buffer (1 mg/ml lysozyme, 20% w/v sucrose, 30 mM Tris-HCl [pH 8.5], 1 mM ethylenediamine tetra-acetic acid [pH 8.0]) for 30 min at 4°C. The spheroblasts were pelleted at 14,000 x g for 2 min at 4°C. The supernatant contains the periplasmic fraction. The pellet was resuspended in 0.1 M Tris-HCl, pH 8.5. Spheroblasts were broken by freeze and thaw method with alternating liquid nitrogen and 37°C incubation cycles. Cell debris was pelleted at 5000 x g for 5 min and membranes at 250,000 x g for 30 min at 4°C. The supernatant contains the cytoplasmic proteins.


    Acknowledgements
 
This work was supported by the Swiss National Science Foundation (grant 3100-057082/2 to M.A.), the Gebert-Rüf Foundation, and the ETH Zürich.


    Abbreviations
 
ER, endoplasmic reticulum; MS, mass spectrometry; OST, oligosaccharyltransferase; PCR, polymerase chain reaction; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Bause, E. (1983) Structural requirements of N-glycosylation of proteins. Studies with proline peptides as conformational probes. Biochem. J., 209, 331–336.[Web of Science][Medline]

Bause, E. and Legler, G. (1981) The role of the hydroxy amino acid in the triplet sequence Asn-Xaa-Thr(Ser) for the N-glycosylation step during glycoprotein biosynthesis. Biochem. J., 195, 639–644.[Web of Science][Medline]

Black, R.E., Levine, M.M., Clements, M.L., Hughes, T.P., and Blaser, M.J. (1988) Experimental Campylobacter jejuni infection in humans. J. Infect. Dis., 157, 472–479.[Web of Science][Medline]

Figurski, D.H. and Helinski, D.R. (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl Acad. Sci. USA, 76, 1648–1652.[Abstract/Free Full Text]

Garvis, S.G., Puzon, G.J. and Konkel, M.E. (1996) Molecular characterization of a Campylobacter jejuni 29-kilodalton periplasmic binding protein. Infect. Immun., 64, 3537–3543.[Abstract/Free Full Text]

Garvis, S.G., Puzon, G.J. and Konkel, M.E. (1997) Cloning, sequencing, and expression of a Campylobacter jejuni periplasmic binding protein (P29) involved in histidine transport. Adv. Exp. Med. Biol., 412, 263–264.[Web of Science][Medline]

Gavel, Y. and Von Heijne, G. (1990) Sequence differences between glycosylated and non-glycosylated Asn-X-Thr/Ser acceptor sites: implications for protein engineering. Protein Eng., 3, 433–442.[Abstract/Free Full Text]

Guerry, P., Yao, R., Alm, R.A., Burr, D.H., and Trust, T.J. (1994) Systems of experimental genetics for Campylobacter species. Methods Enzymol., 235, 474–481.[Web of Science][Medline]

Helenius, A. and Aebi, M. (2004) Roles of N-linked glycans in the endoplasmic reticulum. Annu. Rev. Biochem., 73, 1019–1049.[CrossRef][Web of Science][Medline]

Imperiali, B., Shannon, K.L., Unno, M., and Rickert, K.W. (1992) A mechanistic proposal for asparagine-linked glycosylation. J. Am. Chem. Soc., 114, 7944–7945.[CrossRef]

Kelleher, D.J., Karaoglu, D., Mandon, E.C., and Gilmore, R. (2003) Oligosaccharyltransferase isoforms that contain different catalytic STT3 subunits have distinct enzymatic properties. Mol. Cell, 12, 101–111.[CrossRef][Web of Science][Medline]

Knauer, R. and Lehle, L. (1999) The oligosaccharyltransferase complex from yeast. Biochim. Biophys. Acta, 1426, 259–273.[Medline]

Kornfeld, R. and Kornfeld, S. (1985) Assembly of asparagine-linked oligosaccharides. Annu. Rev. Biochem., 54, 631–664.[CrossRef][Web of Science][Medline]

Labigne-Roussel, A., Courcoux, P., and Tompkins, L. (1988) Gene disruption and replacement as a feasible approach for mutagenesis of Campylobacter jejuni. J. Bacteriol., 170, 1704–1708.[Abstract/Free Full Text]

Lei, S.P., Lin, H.C., Wang, S.S., Callaway, J., and Wilcox, G. (1987) Characterization of the Erwinia carotovora pelB gene and its product pectate lyase. J. Bacteriol., 169, 4379–4383.[Abstract/Free Full Text]

Linton, D., Allan, E., Karlyshev, A.V., Cronshaw, A.D., and Wren, B.W. (2002) Identification of N-acetylgalactosamine-containing glycoproteins PEB3 and CgpA in Campylobacter jejuni. Mol. Microbiol., 43, 497–508.[CrossRef][Web of Science][Medline]

Nilsson, I., Kelleher, D.J., Miao, Y., Shao, Y., Kreibich, G., Gilmore, R., von Heijne, G., and Johnson, A.E. (2003) Photocross-linking of nascent chains to the STT3 subunit of the oligosaccharyltransferase complex. J. Cell Biol., 161, 715–725.[Abstract/Free Full Text]

Pawelec, D., Jakubowska-Mroz, J., and Jagusztyn-Krynicka, E.K. (1998) Campylobacter jejuni 72Dz/92 cjaC gene coding 28 kDa immunopositive protein, a homologue of the solute-binding components of the ABC transport system. Lett. Appl. Microbiol., 26, 69–76.[CrossRef][Web of Science][Medline]

Pawelec, D.P., Korsak, D., Wyszynska, A.K., Rozynek, E., Popowski, J., and Jagusztyn-Krynicka, E.K. (2000) Genetic diversity of the Campylobacter genes coding immunodominant proteins. FEMS Microbiol. Lett., 185, 43–49.[CrossRef][Web of Science][Medline]

Petrescu, A.J., Milac, A.L., Petrescu, S.M., Dwek, R.A., and Wormald, M.R. (2004) Statistical analysis of the protein environment of N-glycosylation sites: implications for occupancy, structure, and folding. Glycobiology, 14, 103–114.[Abstract/Free Full Text]

Sankaran, K., Gupta, S.D., and Wu, H.C. (1995) Modification of bacterial lipoproteins. Methods Enzymol., 250, 683–697.[Web of Science][Medline]

Szymanski, C.M., Logan, S.M., Linton, D., and Wren, B.W. (2003) Campylobacter—a tale of two protein glycosylation systems. Trends Microbiol., 11, 233–238.[Web of Science][Medline]

Wacker, M., Linton, D., Hitchen, P.G., Nita-Lazar, M., Haslam, S.M., North, S.J., Panico, M., Morris, H.R., Dell, A., Wren, B.W., and Aebi, M. (2002) N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science, 298, 1790–1793.[Abstract/Free Full Text]

Yan, Q. and Lennarz, W.J. (2002) Studies on the function of oligosaccharyl transferase subunits: a glycosylatable photoprobe binds to the luminal domain of Ost1p. Proc. Natl Acad. Sci. USA, 99, 15994–15999.[Abstract/Free Full Text]

Yao, R., Alm, R.A., Trust, T.J., and Guerry, P. (1993) Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene, 130, 127–130.[CrossRef][Web of Science][Medline]

Young, N.M., Brisson, J.R., Kelly, J., Watson, D.C., Tessier, L., Lanthier, P.H., Jarrell, H.C., Cadotte, N., St Michael, F., Aberg, E., and Szymanski, C.M. (2002) Structure of the N-linked glycan present on multiple glycoproteins in the Gram-negative bacterium, Campylobacter jejuni. J. Biol. Chem., 277, 42530–42539.[Abstract/Free Full Text]

Zeitler, R., Hochmuth, E., Deutzmann, R., and Sumper, M. (1998) Exchange of Ser-4 for Val, Leu or Asn in the sequon Asn-Ala-Ser does not prevent N-glycosylation of the cell surface glycoprotein from Halobacterium halobium. Glycobiology, 8, 1157–1164.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
L. M. Davis, T. Kakuda, and V. J. DiRita
A Campylobacter jejuni znuA Orthologue Is Essential for Growth in Low-Zinc Environments and Chick Colonization
J. Bacteriol., March 1, 2009; 191(5): 1631 - 1640.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. Sterba, M. Vancova, N. Rudenko, M. Golovchenko, T.-L. Tremblay, J. F. Kelly, C. R. MacKenzie, S. M. Logan, and L. Grubhoffer
Flagellin and Outer Surface Proteins from Borrelia burgdorferi Are Not Glycosylated
J. Bacteriol., April 1, 2008; 190(7): 2619 - 2623.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
D. Kohda, M. Yamada, M. Igura, J. Kamishikiryo, and K. Maenaka
New oligosaccharyltransferase assay method
Glycobiology, November 1, 2007; 17(11): 1175 - 1182.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Kakuda and V. J. DiRita
Cj1496c Encodes a Campylobacter jejuni Glycoprotein That Influences Invasion of Human Epithelial Cells and Colonization of the Chick Gastrointestinal Tract
Infect. Immun., August 1, 2006; 74(8): 4715 - 4723.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. Verma, M. Schirm, S. K. Arora, P. Thibault, S. M. Logan, and R. Ramphal
Glycosylation of b-Type Flagellin of Pseudomonas aeruginosa: Structural and Genetic Basis.
J. Bacteriol., June 1, 2006; 188(12): 4395 - 4403.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
E. Weerapana and B. Imperiali
Asparagine-linked protein glycosylation: from eukaryotic to prokaryotic systems
Glycobiology, June 1, 2006; 16(6): 91R - 101R.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. Kelly, H. Jarrell, L. Millar, L. Tessier, L. M. Fiori, P. C. Lau, B. Allan, and C. M. Szymanski
Biosynthesis of the N-Linked Glycan in Campylobacter jejuni and Addition onto Protein through Block Transfer.
J. Bacteriol., April 1, 2006; 188(7): 2427 - 2434.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
D. J. Kelleher and R. Gilmore
An evolving view of the eukaryotic oligosaccharyltransferase
Glycobiology, April 1, 2006; 16(4): 47R - 62R.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. J. Glover, E. Weerapana, and B. Imperiali
In vitro assembly of the undecaprenylpyrophosphate-linked heptasaccharide for prokaryotic N-linked glycosylation
PNAS, October 4, 2005; 102(40): 14255 - 14259.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Correction to PDF
Right arrow A correction has been published
Right arrow All Versions of this Article:
15/4/361    most recent
cwi019v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Nita-Lazar, M.
Right arrow Articles by Aebi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nita-Lazar, M.
Right arrow Articles by Aebi, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?