Glycobiology Advance Access originally published online on November 24, 2004
Glycobiology 2005 15(4):335-346; doi:10.1093/glycob/cwi017
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology vol. 15 no. 4 © Oxford University Press 2004; all rights reserved.
Functional analysis of Drosophila ß1,4-N-acetlygalactosaminyltransferases
Howard Hughes Medical Institute, Waksman Institute, and Department of Molecular Biology and Biochemistry, Rutgers The State University of New Jersey, Piscataway NJ 08854
1 To whom correspondence should be addressed; e-mail: irvine{at}waksman.rutgers.edu
Received on July 26, 2004; revised on October 26, 2004; accepted on November 18, 2004
| Abstract |
|---|
|
|
|---|
Members of the mammalian ß1,4-galactosyltransferase family are among the best studied glycosyltransferases, but the requirements for all members of this family within an animal have not previously been determined. Here, we describe analysis of two Drosophila genes, ß4GalNAcTA (CG8536) and ß4GalNAcTB (CG14517), that are homologous to mammalian ß1,4-galactosyltransferases. Like their mammalian homologs, these glycosyltransferases use N-acetylglucosamine as an acceptor substrate. However, they transfer N-acetylgalactosamine rather than galactose. This activity, together with amino acid sequence similarity, places them among a group of recently identified invertebrate ß1,4-N-acetylgalactosaminyltransferases. To investigate the biological functions of these genes, null mutations were generated by imprecise excision of a transposable element (ß4GalNAcTA) or by gene-targeted homologous recombination (ß4GalNAcTB). Flies mutant for ß4GalNAcTA are viable and fertile but display behavioral phenotypes suggestive of essential roles for GalNAc-ß1,4-GlcNAc containing glycoconjugates in neuronal and/or muscular function. ß4GalNAcTB mutants are viable and display no evident morphological or behavioral phenotypes. Flies doubly mutant for both genes display only the behavioral phenotypes associated with mutation of ß4GalNAcTA. Thus Drosophila homologs of the mammalian ß4GalT family are essential for neuromuscular physiology or development but are not otherwise required for viability, fertility, or external morphology.
Key words: ß1,4-galactosyltransferase / behavior / development / CG8531 / Notch
| Introduction |
|---|
|
|
|---|
Whole genome sequencing of Drosophila has revealed many predicted proteins with sequence similarity to mammalian glycosyltransferases (Adams et al., 2000
Seven ß1,4-galactosyltransferases have been identified in mammals (Amado et al., 1999
; Furukawa and Sato, 1999
; Lo et al., 1998
). These enzymes all share highly homologous sequence motifs within their catalytic domains and use UDP-Gal as their sugar donor. Six members of the family, ß4GalT-1 to ß4GalT-6 (ß4GalTs), catalyze the transfer of Gal to acceptor substrates with a terminal N-acetylglucosamine (GlcNAc), to generate Galß1,4-GlcNAc (LacNAc) (Amado et al., 1999
; Guo et al., 2001
). The seventh member, ß4GalT-7, is the furthest diverged based on sequence similarity and has a distinct enzymatic activity, because it uses xylose rather than GlcNAc as an acceptor. ß4GalT-7 participates in the synthesis of the glycosaminoglycan core linker on proteoglycans (Okajima et al., 1999
; Quentin et al., 1990
), and structural and functional homologs of ß4GalT-7 have been identified in both Drosophila and Caenorhabditis elegans (Bulik et al., 2000
; Herman et al., 1999
; Nakamura et al., 2002; Takemae et al., 2003
; Vadaie et al., 2002
).
The LacNAc structure generated by ß4GalTs is a common feature of mammalian glycoproteins and glycolipids (Amado et al., 1999
; Varki et al., 1999
). Studies in cultured mammalian cells identified a role for this linkage in the modulation of Notch signaling by the N-acetylglucosaminyltransferase Fringe (Chen et al., 2001
). Terminal LacNAc moieties have been implicated in antibody function (Axford, 1999
) and clearance of serum glycoproteins (Tozawa et al., 2001
). LacNAc is also a major substrate for sialyltransferases (Varki et al., 1999
), and thus is essential for the generation of a diverse array of sialylated glycans. Although these observations suggest a range of potential functions for ß4GalTs, a comprehensive understanding of their requirements has remained elusive due to the potential for redundancy among the six mammalian family members. To date, only ß4GalT-1 has been analyzed genetically (Asano et al., 1997
; Lu et al., 1997
). Gene-targeted mutations in ß4GalT-1 are viable and do not exhibit the defects in Notch signaling observed in mammalian Lunatic fringe mutants (Evrard et al., 1998
; Zhang and Gridley, 1998
). They do exhibit some degree of neonatal lethality, have proliferation and differentiation defects in epithelial cells, and have reduced male fertility. However, the effect on male fertility is thought to reflect a role for a cell surface isoform of ß4GalT-1 as a lectin-like receptor, rather its action as glycosyltransferase (Nixon et al., 2001
; Rodeheffer and Shur, 2004
).
Two genes encoding proteins with sequence similarity to mammalian ß4GalTs are encoded by the Drosophila and C. elegans genomes. The enzymatic activity of only one of these has been reported previously, the C. elegans enzyme encoded by Y73E7A.7 (Ce ß4GalNAcT). By contrast to the ß1,4GalT activity of mammalian enzymes, this C. elegans enzyme transfers GalNAc to GlcNAc in a ß1,4 linkage, to create GalNAcß1,4-GlcNAc (LacdiNAc) (Kawar et al., 2002
). A ß4GalT homolog from a lepidopteran, the cabbage looper Trichoplusia ni, has also been characterized recently. This enzyme also efficiently transfers GalNAc to GlcNAc acceptors in a ß1,4 linkage, and has only very low galactosyltransferase activity (Vadaie and Jarvis, 2004
). Low levels of ß4GalT activity have been reported in lepidopteran cell lines (Palomares et al., 2003
; Van Die et al., 1996
), but it is not known if the LacNAc linkage is actually present in insects. However, LacdiNAc has been identified on invertebrate glycoconjugates (Koles et al., 2004
; Kubelka et al., 1995
; Seppo et al., 2000
; Van Die et al., 1997
). These observations raise the possibility that LacdiNAc could subsume requirements for LacNAc that are conserved between invertebrates and vertebrates. Two glycosyltransferases that are predicted to act prior to the synthesis of a LacdiNAc linkage in Drosophila glycolipids (Seppo et al., 2000
) are encoded by egghead (egh) and brainiac (brn) (Schwientek et al., 2002
; Wandall et al., 2003
), mutation of which results in maternal effect neurogenic phenotypes and embryonic lethality (Goode et al., 1996a
,b
). Mutations in C. elegans homologs of egh and brn (bre-3 and bre-5), as well as Ce ß4GalNAcT (bre-4), have also been identified (Griffitts et al., 2001
, 2003
). No developmental defects have been described in these mutants, but they appear to act together to make a glycoconjugate that acts as the receptor for Crystal toxin (Griffitts et al., 2003
).
We report the characterization of the two Drosophila homologs of the mammalian ß4GalTs. Like invertebrate homologs in C. elegans and T. ni, these enzymes function as N-acetylgalactosaminyltransferases. Mutation of one homolog results in behavioral phenotypes in adult flies, thus identifying an essential role for LacdiNAc-containing glycoconjugates in Drosophila neuronal development or physiology. However, mutation of the second Drosophila family member does not result in any discernible phenotypes. This lack of morphological or developmental phenotypes is not due to functional redundancy between the homologs, as doubly mutant flies exhibit only the adult behavioral phenotypes of the first mutant. The limited requirements for this gene family in Drosophila should facilitate future efforts to characterize the influence of LacdiNAc glycoconjugates in neuromuscular function.
| Results |
|---|
|
|
|---|
CG8536 and CG14517 encode Drosophila homologs of the mammalian ß4GalT family
Sequence similarity searches identify only three predicted Drosophila proteins with any similarity (Blastp E values < 1) to mammalian ß4GalTs. One of these is closely related to mammalian ß4GalT-7 and has already been demonstrated to act as a functional homolog (Nakamura et al., 2002; Takemae et al., 2003
|
The structural basis for conservation of motifs among ß4GalTs is now well understood, based on crystal structures of bovine ß4GalT-1 (Gastinel et al., 1999
; Ramakrishnan et al., 2002
). Notably, site-specific mutagenesis has identified a tyrosine or phenylalanine residue that lies in the donor binding pocket and is critical for recognition of the Gal moiety of UDP-Gal. Mutagenesis of this to isoleucine switches the donor substrate preference of ß4GalT-1 to UDP-GalNAc, whereas mutagenesis to leucine results in an enzyme that uses UDP-Gal or UDP-GalNAc with equal efficiency (Ramakrishnan and Qasba, 2002
). Interestingly, isoleucine is encoded at this position in CG8536 and in other biochemically characterized invertebrate GalNAcTs, and leucine is encoded at this position in CG14517 (Figure 1A).
Biochemical characterization of CG8536 and CG14517 proteins
To characterize the enzymatic activity of the proteins encoded by CG8536 and CG14517, full-length cDNAs were cloned into vectors for expression in cultured Drosophila S2 cells. To facilitate visualization and purification, sequences encoding V5 epitope and hexahistidine tags were included at the 3' end. Analysis of cells transiently transfected with a CG8536 expression vector by western blotting revealed that a protein with a mobility of ~ 51 kDa, slightly larger than the calculated mobility of 49 kDa, was detected in the cell lysate (Figure 2A). A slightly smaller band (~ 47 kDa) was detected in the culture media, indicating that CG8536 can be cleaved and secreted from cells (Figure 2A). Hydropathy analysis of CG8536 protein (not shown) predicts the presence of an amino-terminal type II transmembrane domain or signal sequence. Although most glycosyltransferases that include amino-terminal type II transmembrane domains are resident Golgi proteins, there are also by now a number of examples in which a proteolytic cleavage can occur near the transmembrane domain, allowing a soluble, catalytically active enzyme to be secreted (Varki et al., 1999
). This appears to be the case for CG8536, but glycosylation is nonetheless expected to be restricted to the Golgi by the limited availability of nucleotide sugar donors.
|
Because CG8536 protein was found in significant quantities in the medium of transfected cells, conditioned medium was used as a source of enzyme for biochemical characterization. Because conditioned medium from S2 cells has a high endogenous galactosyltransferase activity on GlcNAc acceptors (not shown), epitope-tagged CG8536 was purified from conditioned media using anti-V5 beads (Figure 3D). CG8536 protein-coated beads were then used as an enzyme source in assays with a simple ß-linked GlcNAc acceptor substrate, pNP-ß-D-GlcNAc, which is an effective substrate for previously characterized mammalian ß4GalTs and invertebrate ß4GalNAcTs. Robust glycosyltransferase activity was detected using UDP-GalNAc as a donor (Figure 3B). A low signal was detected using UDP-Gal as a donor, however, it was not significantly different from that detected in control experiments using beads loaded with green fluorescent protein (GFP), or without a pNP-ß-D-GlcNAc acceptor, indicating that CG8536 has little or no Gal transferase activity (Figure 3A). No activity was detected with a UDP-GlcNAc donor (Figure 3C). Thus, like the recently described T. ni ß4GalNAcT (Vadaie and Jarvis, 2004
), to which CG8536 is closely related, CG8536 protein acts as a GalNAc transferase. Based on this activity and the sequence similarity, we will henceforth refer to CG8536 protein as ß4GalNAcTA.
|
Analysis of cells transiently transfected with a CG14517 expression vector by western blotting revealed that a protein of the expected mobility, ~ 38 kDa, was detected in the cell lysate (Figure 2B). A band of similar mobility was detected in conditioned medium, but it appears to be secreted less efficiently than ß4GalNAcTA (not shown). Using the same assays as for ß4GalNAcTA, a low level of GalNAc transferase activity could be detected using anti-V5 beads loaded with CG14517 protein from conditioned medium (Figure 3F). Attempts to detect more substantial activity of CG14517 using protein isolated from cell lysates, protein efficiently secreted into the medium with a BiP signal peptide, or protein without a C-terminal V5 tag all proved negative, and no activity could be detected in assays using UDP-Gal or UDP-GlcNAc donors, nor with pNP-xylose, pNP-galactose, or pNP-glucose acceptors (Figure 3E, G, and data not shown). Our inability to detect more substantial levels of glycosyltransferase activity associated with CG14517 likely results from a requirement for an additional factor (Hans Bakker personal communication), which might be limiting in S2 cells. This GalNAcT activity, together with the sequence similarity to members of the ß4GalT/ß4GalNAcT family, suggest that CG14517 protein is a ß4GalNAcT, and we henceforth refer to it as ß4GalNAcTB.
ß4GalNAcTA and ß4GalNAcTB are broadly expressed
To assess the potential for ß4GalNAcTA and ß4GalNAcTB to contribute to the development of different tissues, their expression was analyzed by in situ hybridization to mRNA. Both genes are expressed ubiquitously, although at relatively low levels, throughout embryonic and larval development, as well as in adult tissues (Figure 4). Their expression is first detected in very early embryos, prior to the onset of zygotic transcription, implying that maternally expressed transcripts are deposited into the egg (Figure 4A, I). Consistent with this, expression is detected in the nurse cells during oogenesis (Figure 4M, S). In addition to low-level ubiquitous expression, ß4GalNAcTA is strongly expressed in the garland cells during embryonic stages, beginning around stage 12 (Figures 4BD). The garland cells are thought to function as nephrocytes, taking up waste materials from the hemolymph by endocytosis, and are known for their high levels of exocytosis and endocytosis (Kosaka and Ikeda, 1983
; Wigglesworth, 1972
).
|
Generation of null mutations in ß4GalNAcTA
To identify biological functions for Drosophila ß4GalNAcTs, genetic studies were initiated. A P transposable element insertion in the 5' untranslated region of ß4GalNAcTA, EP2551, was identified by the Berkeley Drosophila Genome Project (Rorth et al., 1998
; BDGP unpublished data). Thus we took advantage of the fact that mobilization of P elements often results in deletion of flanking DNA (imprecise excisions). Subsequent to introduction of transposase, flies were first screened for excision of the P insertion by loss of the white+ marker gene, and then screened for imprecise excisions by Southern blotting using a ß4GalNAcTA cDNA as a probe. Five candidate mutants were identified and then further analyzed by polymerase chain reaction (PCR) and DNA sequencing. Two lines, ß4GalNAcTA4.1 and ß4GalNAcTA7.1 have deletions that lie exclusively within the ß4GalNAcTA transcription unit (Figure 5). The deletions in ß4GalNAcTA4.1 and ß4GalNAcTA7.1 are 610 and 568 bases, respectively (see supplementary material), and are predicted to delete the first 143 and 129 amino acids, respectively, of ß4GalNAcTA. However, the first in-frame ATG that could then serve as a translation start site in either deletion mutant encodes amino acid 208 (Figure 1A). Such a truncated protein would lack the conserved PFRXR motif (Figure 1A), which makes critical contacts with substrates (Gastinel et al., 1999
), and hence would be expected to behave as a null allele. Another line, Df(2R)ß4GalNAcTA[20.1] is a 4.4-kb deletion that removes the entire ß4GalNAcTA transcription unit as well as the neighboring gene, CG8531, and hence constitutes a true null allele for both genes (Figure 5, S1). The two remaining imprecise excision lines were determined to be larger deletions that removed additional genes on either side of ß4GalNAcTA and were not analyzed further.
|
ß4GalNAcTA mutants display adult behavioral phenotypes
Animals homozygous for each of the three deletion alleles of ß4GalNAcTA, as well as transheterozygous combinations between alleles, were examined for mutant phenotypes. In all cases adult flies with normal external morphology could be recovered. Most allelic combinations are also both male and female fertile. Df(2R)ß4GalNAcTA[20.1] homozygous males are sterile. However, because this sterility is not observed in homozygous or transheterozygous combinations of other alleles, it most likely results from the deletion of the adjacent gene, CG8531 (Figure 5A). This gene is expressed in testis (Andrews et al., 2000
), and encodes a protein with a DNAJ domain, suggesting that it might function as a chaperone (Walsh et al., 2004
).
Although mutant flies are viable and appear morphologically normal, they are sluggish and uncoordinated and exhibit occasional tremors. The adult flies are also short-lived, but this might result simply from their tendency to become immobilized in the fly media. To further characterize this adult phenotype, ß4GalNAcTA mutants were examined in simple behavioral assays (Figure 6) (Richards et al.,1996). A test of locomotion examines the ability of flies to climb up the sides of a vial. Drosophila are negatively geotropic, and if tapped to the bottom of an empty vial, wild-type flies will rapidly climb up to the top. However, mutant flies are significantly more sluggish (p < 0.05 using Student unpaired t-test) and often fail to climb at all (Figure 6A). In a test of coordination, a mechanical shock was administered to a fly in an empty vial, which sometimes results in the fly being knocked onto its back. The number of falls and the time taken for a fly to right itself were analyzed. Mutant flies are knocked on their backs as often as wild type (Figure 6B) but take significantly longer to right themselves after a fall (p < 0.05 using Student unpaired t-test) (Figure 6C).
|
To confirm that these behavioral phenotypes are due specifically to mutation of ß4GalNAcTA, a construct that includes the wild-type ß4GalNAcTA genomic region was cloned into a P element vector and transformed into Drosophila (Figure 5). This genomic construct rescues the behavioral phenotypes of ß4GalNAcTA mutants, as assayed both by visual inspection and by the locomotion and coordination assays (Figure 6). Thus the behavioral deficits can be ascribed specifically to mutation of ß4GalNAcTA, and by inference, to the absence of one or more glycoconjugates that it synthesizes.
Generation of null mutations in ß4GalNAcTB
Because no P element insertions near ß4GalNAcTB have been isolated, we instead employed gene-targeted homologous recombination to create a mutation in this gene (Gong and Golic, 2003
). An ends-out targeting construct was designed that would create a null allele by deleting 200 bp in the middle of the transcription unit, removing the FGGVSA and (W/F)GWGGEDDD motifs, and inserting a copy of the white+ gene in their place (Figures 1, 7). These motifs play essential roles in interactions with substrates and catalysis (Gastinel et al., 1999
; Ramakrishnan et al., 2002
), and hence the resulting mutations could not encode functional enzymes. Nine independent insertions of the targeting donor construct to the third chromosome were recovered. Eight of these were identified as correctly targeted events to ß4GalNAcTB by PCR and Southern blot analysis (Figure 7 and data not shown).
|
Each of the eight gene-targeted alleles of ß4GalNAcTB was tested for mutant phenotypes. In all cases, homozygous mutant adult flies could be recovered that are fertile, appear morphologically normal, and do not display evident behavioral phenotypes.
Drosophila homologs of mammalian ß4GalTs are dispensable for development
Because ß4GalNAcTA and ß4GalNAcTB encode structurally related proteins that can both catalyze the formation of a GalNAc-GlcNAc linkage and are expressed in largely overlapping patterns, we considered the possibility that they might be functionally redundant. Flies stocks mutant for both genes were generated by crossing two different ßGalNacTA alleles, ßGalNacTA4.1 and ßGalNacTA20.1 to two independent isolates of flies with gene-targeted mutations in ß4GalNAcTB (ß4GalNAcTBGT). Animals homozygous for mutations in both genes could be readily identified using standard genetic markers (see Materials and methods), and in addition their identity was confirmed by PCR analysis (data not shown). Except for the male sterile phenotype associated with Df(2R)ß4GalNAcTA[20.1] males, all allelic combinations were viable, fertile, and morphologically normal. The double-mutant flies do display the behavioral phenotypes associated with ß4GalNAcTA mutants, but the severity of the phenotypes is similar to that of ß4GalNAcTA single mutants (Figure 6). These observations suggest that ß4GalNAcTA andß4GalNAcTB are not functionally redundant and indicate that this gene family is not required for the development or fertility of Drosophila.
| Discussion |
|---|
|
|
|---|
ß4GalNAcTA and ß4GalNAcTB are members of the invertebrate ß4GalNAcT family
ß4GalNAcTA and ß4GalNAcTB proteins show significant similarity to enzymes of the mammalian ß4GalT family, and include all of the motifs common to ß4GalT family members (Figure 1A). However, like two other recently described invertebrate members of this family (Kawar et al., 2002
Behavioral phenotypes of ß4GalNAcTA mutants
The behavioral phenotypes observed in ß4GalNAcTA mutants imply that one or more LacdiNAc-containing glycoconjugates synthesized by ß4GalNAcTA has an important role in Drosophila. The phenotypes suggest some deficit in neuronal or muscular physiology, although it is also possible that they result from an earlier defect during nervous system development. Clues as to the potential nature of the requirement for ß4GalNAcTA can come from comparison to other mutants that share related phenotypes. One such mutant is uncoordinated, which lacks transduction in mechanosensory neurons because of defective ciliogenesis (Baker et al., 2004
; Eberl et al., 2000
; Kernan et al., 1994
). Another mutant with similar behavioral phenotypes, including lack of motility in the climbing assay and lack of coordination in the fall assay, is purity of essence (poe), also known as pushover (Richards et al., 1996
). poe encodes a protein that binds calmodulin and contains an N-recognin type Zn-finger, which is suggestive of a role in ubiquitination. Mutations in poe cause spontaneous fusion of synaptic vesicles and increased neurotransmitter release, potentially accounting for the behavioral phenotypes (Richards et al., 1996
).
Although a role for ß4GalNAcTA in membrane vesicle dynamics remains speculative, it is worth noting that ß4GalNAcTA is highly expressed in the Garland cells, which are known for their high levels of endo- and exocytosis (Kosaka and Ikeda, 1983
; Wigglesworth, 1972
). Indeed, mutants that affect neurotransmitter release or synaptic function often have behavioral phenotypes, but in most cases behavioral phenotypes are observed in hypomorphic alleles, because null alleles are lethal (Babcock et al., 2004
; Eberl et al., 2000
; Kernan et al., 1994
; Wang et al., 2004
). Indeed, it is not clear that any of the extent poe alleles are null. By contrast, because only behavioral phenotypes are observed in ß4GalNAcTA null alleles, the contribution of its products to such processes would have to be more restricted.
Although ß4GalNAcTA transfers GalNAc rather than Gal, it is conceivable that it could share biological functions with members of the mammalian ß4GalT family, if for example, a Drosophila LacdiNAc-containing glycoconjugate has a role equivalent to a mammalian LacNAc-containing glycoconjugate. ß4GalT-1 mutant mice develop almost normally but exhibit neonatal lethality (Asano et al., 1997
; Lu et al., 1997
). Among other deficits, they appear to have impaired endocrine function (Lu et al., 1997
). A human congenital disorder of glycosylation has been identified in an individual with a mutation of ß4GalT-1 (Hansske et al., 2002
). This individual was diagnosed with mental retardation, hydrocephalus, and myopathy. The molecular basis for these mammalian phenotypes remains as unknown, and the degree of functional redundancy among members of the mammalian ß4GalT family remains uncertain. Thus once the molecular basis for the behavioral phenotypes of ß4GalNAcTA mutants is understood, it will be important to determine whether it is reflective of a conserved biological function.
Drosophila homologs of ß4GalTs are not essential for development
In mammals, members of the ß4GalT family modify a diverse array of glycans, including N-linked, O-linked, and glycolipids. However, the large number of potentially redundant family members complicates efforts to catalog the biological functions of these glycosyltransferases. Although there are significant differences between mammalian and insect glycans, there are an increasing number of examples of conserved functions, such as the roles of proteoglycans in growth factor signaling (Nybakken and Perrimon, 2002
) and the roles of O-fucose glycans in Notch signaling (Haines and Irvine, 2003
). Thus one premise of this study was that analysis of ß4GalT homologs in Drosophila might uncover essential conserved functions of this gene family. In particular, we note that studies in cultured mammalian cells identified a requirement for a ß4GalT in modulation of Notch signaling by Fringes (Chen et al., 2001
).
Sequence analysis of the mutations created in ß4GalNAcTA and ß4GalNAcTB indicates that they are nonfunctional alleles. Despite this, mutant flies are viable and morphologically normal. Because null mutations in fringe are lethal in Drosophila, and even weak alleles have obvious morphological phenotypes in adult flies (Correia et al., 2003
; Irvine and Wieschaus, 1994
), it is clear that Drosophila homologs of ß4GalTs are not required for Notch signaling, nor for other essential developmental process. Thus the functions of this gene family in Drosophila appear to be largely physiological rather than developmental. Similarly, mutations in the closest C. elegans homolog of Drosophila ß4GalNAcTA have recently been isolated as Bt toxin resistant mutants (bre-4) (Griffitts et al., 2003
); these mutants do not display obvious developmental phenotypes.
The absence of visible phenotypes is unexpected not only in terms of the previously proposed function for this gene family in Notch signaling but also in terms of requirements for Drosophila glycolipids. Synthesis of invertebrate arthroseries glycolipids requires a ß1,4GalNAc transferase (Seppo et al., 2000
), and the two enzymes that act just prior to the addition of GalNAc in glycolipid synthesis are encoded by egh and brn (Schwientek et al., 2002
; Wandall et al., 2003
). Both of these are essential genes, mutation of which results in lethality and impairment of Notch signaling during oogenesis and embryonic development(Goode et al., 1996a
,b
). ß4GalNAcTA or ß4GalNAcTB single or double mutants do not share the developmental phenotypes of egh and brn. The only other predicted Drosophila genes with any similarity to known mammalian ß4GalNAcTs are CG12913 and CG9220, both of which, based on sequence comparisons, are predicted to function specifically in chondroitin synthesis. Thus the present data suggest that either the essential functions of brn and egh do not require the further elongation of glycolipids, or that Drosophila encodes an additional ß4GalNAcT that lacks significant sequence similarity to previously characterized glycosyltransferases. Future studies of glycan structures in mutant flies should help resolve this question.
| Materials and methods |
|---|
|
|
|---|
Sequence analysis
Full-length protein sequences were aligned using ClustalW, and the phylogenetic tree was generated using GeneBee (www.genebee.msu.su/clustal). Peptide cleavage and transmembrane prediction carried out online at www.cbs.dtu.dk/services/SignalP and www.sbc.su.se/~miklos/DAS/tmdas.cgi.
DNA constructs
DNA encoding full-length ß4GalNAcTA was amplified by PCR from cDNA clone SD05469 (Rubin et al., 2000
) using primers forward 5'ATGGTACCCTGGACCATGTACCTC and reverse 5'CGTCTAGAGATTTGCGCTCGGAGTTC. Restriction enzyme sites KpnI and XbaI (underscored) were included in the PCR primers to facilitate cloning of the fragment downstream of the metallothionein promoter in pMTWB (A. Xu). In the resulting construct, pMTWB-ß4GalNAcTA:V5:His, ß4GalNAcTA is in frame with downstream hexahistidine and V5 tags present in the pMTWB vector. pMT/Bip-GFP-V5-6xHis (pMT-GFP) (Invitrogen, Carlsbad, CA), in which a V5 and hexahistidine-tagged GFP is under control of the metallothionein promoter and expressed as a secreted protein via a Bip signal sequence was used as a control. For genomic rescue, a 2.4-kb fragment containing the entire ß4GalNAcTA region, but none of the neighboring transcription units, was amplified from white genomic DNA by PCR using primers forward 5'CTGAATTCACTTCGGACTTTAGAATA and reverse 5'ATTCTAGAGCGATGAACTGTTTGAAT, and cloned into pCasper4 using EcoRI and XbaI restriction sites included on the primers, to generate pCasper4-ß4GalNAcTA. This construct was transformed into Drosophila using standard techniques, and insertions on the first and second chromosomes were obtained.
DNA encoding full-length ß4GalNAcTB was amplified by PCR from wild type (Oregon-R) genomic DNA (this gene lacks introns) using primers forward 5'ATGGTACCCTGCCAACAATGTTCG and reverse 5'GCTCTAGATCGGTACAACCAGGATG. Restriction enzyme sites were included in the PCR primers to facilitate cloning into pMTWB, generating pMTWB-ß4GalNAcTB:V5:His. In an alternative construct, a BIP signal sequence was fused to amino acid 39 of ß4GalNAcTB to improve its secretion by using an alternative forward primer, ATGGTACCTGACTACATCGAGGAATC, to generate pMTIB-Tmß4GalNAcTB:V5:His. Untagged versions of ß4GalNAcTB constructs were made by using a reverse primer including the stop codon (ATCTCGAGCGAGATACCGACTACG), to generating pMTWB-ßGalNAcTB and pMTIB-Tmß4GalNAcT. All constructs were confirmed by DNA sequencing.
Cell culture
S2 cells adapted to Drosophila serum-free media (Invitrogen) were transiently transfected using Cellfectin (Invitrogen), according to the manufacturers instructions. Cells were cultured to a density of ~ 5 x 106/ml in 12 ml serum-free Drosophila media, and then induced with 0.7 mM CuSO4. After 96 h, cells or media were collected for analysis.
Enzyme assays
Twelve milliliters conditioned media from cells transfected with pMTWB-ß4GalNAcTA:V5:His, pMTWB-ß4GalNAcTB: V5:His, or pMT-GFP (V5-tagged) was incubated with 50 µl anti-V5 agarose bead slurry (Abcam, Cambridge, UK) for 1 h at room temperature. Beads were pelletted by centrifugation at 1000 rpm for 2 min, washed 5 times over 1 h in phosphate buffered saline 0.1% Triton-X100, washed a final time in assay buffer (25 mM HEPES, pH 7.2, 10 mM MnCl2, and 0.1% Triton-X100), and then resuspended in 70 µl assay buffer. Five microliters of bead slurry (~ 1030 ng protein) was assayed with 4 mM p-nitrophenly N-acetyl-B-D-glucosaminide (pNP-GlcNAc) (Sigma, St. Louis, MO) as the acceptor, and 0.1 µCi of UDP[14C]-Gal (278 mCi/mMol, NEN Life Sciences Products, Boston, MA), UDP[3H]-GalNAc (20 Ci/mMol, American Radiolabeled Chemicals Inc.), or UDP[14C]-GlcNAc (266 mCi/mmol, Amersham Biosciences, Piscataway, NJ) as the donor, supplemented with unlabeled nucleotide sugars where needed to bring the donor concentration to 7.5 µM, in a total reaction volume of 50 µl. The reactions were incubated for 1 h at 28°C with rotary agitation, then terminated by addition of 500 µl 0.5M ethylenediamine tetra-acetic acid. Reactions were then applied to Superclean LC-18 (sigma) solid phase extraction tubes that had been equilibrated with 1 ml methanol, and washed twice with 1 ml water. Extraction tubes were washed twice with 1 ml water, and products were eluted with 1 ml 80% methanol. The elutants were added to 5 ml scintillation cocktail (Scinti Safe Econo 1, Fisher, Silver Spring, MD), and incorporated radioactivity was measured in a scintillation spectrometer. Assays were carried out in triplicate.
In situ hybridization and tissue staining
In situ hybridization to mRNA was carried out as described previously (Irvine and Wieschaus, 1994
). The template for ß4GalNAcTA was cDNA SD05469 (Rubin et al., 2000
). The template for ß4GalNAcTB was a genomic clone, pBS-CG14517 generated by PCR using 5'ATGGATCCGCGAAGATTGCGTCCG and 5'ATCTCGAGCGAGATACCGACTACG primers.
Creation of mutations in ß4GalNAcTA
Excisions of EP2551{w+} were generated by crossing to a transposase-expressing line (Sp/CyO; ry Sb
23/TM6B, Ubx). One hundred and seven male progeny from this cross, of the genotype w; EP2551{w+}/CyO ; +/ry Sb
23, were then crossed to S4 Bl/CyO females, and 38 potential excision events were identified by the loss of the w+ marker. Of these, 33 were identified by Southern blotting with ß4GalNAcTA SD005405 cDNA as a probe as precise excision events, whereas, as described in Results, 5 deleted all or part of ß4GalNAcTA. Breakpoints for the ß4GalNAcTA4.1 and ß4GalNAcTA7.1 alleles were obtained by PCR from homozygous flies using primers P2 (Figure 5) 5'GACAACCGCTGTCAGGAT and P3 5'ATTCTAGAGCGATGAACTGTTTGAAT and for Df(2R)ß4GalNAcTA[20.1], primers P1 5'GCGTGCCAGAGTTGTCAA and P3. PCR fragments were TA cloned into pGEMeasy (Promega, Madison, WI) and then sequenced.
The original EP2551 chromosome and the excision lines initially generated were viable but both male and female sterile. This phenotype could have been due to a mutation on the chromosome unrelated to the P element, or the sterility could been due to a mutation of ß4GalNAcTA (i.e., if EP2551 were a mutant allele). Two independent approaches established that the sterility was unrelated to ß4GalNAcTA. First, the P element in line EP2551 is inserted in the 5' untranslated region. Thus, if this line were mutant for ß4GalNAcTA, it would be expected to influence transcription, rather than the protein product. However, ß4GalNAcTA expression is normal in EP2551 homozygotes. Second, the EP2551 line was recombined with a viable and fertile white chromosome. Using the w+ marker on the EP element to follow the recombinants carrying EP25515, male and female fertile flies were obtained, demonstrating that the sterility was unlinked to the insertion site. Following these discoveries, the ß4GalNAcTA4.1 and Df(2R)ß4GalNAcTA[20.1] imprecise excisions were recombined over a fully fertile EP2551 chromosome to remove the unlinked sterile mutation(s) on the second chromosome.
Gene targeting of ß4GalNAcTB
Two 3-kb fragments, one including the first 186 codons and extending upstream, the other including codon 255 and extending downstream, were isolated from w1118 genomic DNA by PCR, using as primers 5'AACTGCAGACAGTCTGAACAGCATCC, 5'AAGCATGCGCCCTGAATATCGACATT and 5'ATACGCGTAATTCAGTGGCAGGAGGT, 5'AAGGTACCGACCTTCGAAATCGATCC. The fragments were cloned into pPEndsOut (Sekelsky unpublished) using PstI, SphI and MulI, KpnI restriction sites included on the primers. A white+ gene was cloned from pHS70w (Sekelsky unpublished) and inserted in opposite orientation between the two genomic fragments to generate pEndsOut-ß4GalNAcTB. Each insertion line was crossed to a source of FLPase, and the ability of the construct to excise was assayed by scoring the number of progeny with w eyes or w+/w mosaic eyes. Five of the lines yielded greater than 95% w progeny, and three of these, one on the second chromosome and two on the first were then used as donors in gene targeting crosses as described by Rong and Golic (2001)
. Flies carrying targeted events were recovered at ~ 1/5000 (donor 1), 1/20,000 (donor 2), and 0/30,000 (donor 3) gametes. Further analysis was conducted by PCR using primers (see figure) P1 5'TTATTATTCGCCAACCGGCC, P2 5'AACACTTCGAGATACCGACT, P3 5'CTCGCATATCTGGCTCTAAGAC, P4 5'AGTGCCGTGTATGACGATAACC, and by Southern blotting using ß4GalNAcTB. In total nine targeting events were isolated, eight of which were confirmed to be correctly targeted by PCR and Southern analysis.
Creation of double-mutant stocks
Double mutants were generated using GalNAcTA alleles ß4GalNAcTA4.1 or Df(2R)ß4GalNAcTA[20.1], in combination with two of the independently isolated gene-targeted alleles of ß4GalNAcTB. In each case, w; ß4GalNAcTA ; +/TM6B females were crossed to +/CyO; ß4GalNAcTBGT males. Stocks were then established by crossing together w; ß4GalNAcTA/CyO; ß4GalNAcTBGT/TM6B males and females. Double-mutant flies were identified by absence of the CyO and TM6B balancers. The presence of both mutations was further confirmed by PCR analysis of each allele as described.
Behavior assays
Behavior assays were based on those described by Richards et al. (1996)
. For motility, a single male fly 4 days posteclosion was placed in an empty vial that was marked with a line 5 cm from the bottom and allowed to rest for 15 minutes before been tapped gently to the bottom of the vial. The number of seconds taken to cross the 5 cm line was recorded with a cut-off of 2 min. Twenty-six flies of each genotype were scored. For the mechanical agitation assay, a vial containing a single fly was banged onto a rubber mat on a table five times. The number of falls onto the back and time taken for a fly to right itself after a fall was recorded. Twenty-four flies of each genotype were assayed (120 rounds of agitation in total).
| Acknowledgements |
|---|
We thank P. Stanley and R. Haltiwanger for many helpful discussions; H. Bakker and D. Jarvis for communication of unpublished data; the Bloomington stock center, Developmental Studies Hybridoma Bank, and J. Sekelsky for reagents; and R. Haltiwanger, T. Okajima, and P. Stanley for comments on the manuscript. Research in Irvines laboratory is supported by the Howard Hughes Medical Institute and by NIH grant R01-GM54594.
| Abbreviations |
|---|
GFP, green fluorescent protein; PCR, polymerase chain reaction
| References |
|---|
|
|
|---|
Adams, M.D., Celniker, S.E., Holt, R.A., Evans, C.A., Gocayne, J.D., Amanatides, P.G., Scherer, S.E., Li, P.W., Hoskins, R.A., Galle, R.F., and others. (2000) The genome sequence of Drosophila melanogaster. Science, 287, 21852195.
Amado, M., Almeida, R., Schwientek, T., and Clausen, H. (1999) Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim. Biophys. Acta, 1473, 3553.[Medline]
Andrews, J., Bouffard, G.G., Cheadle, C., Lu, J., Becker, K.G., and Oliver, B. (2000) Gene discovery using computational and microarray analysis of transcription in the Drosophila melanogaster testis. Genome Res., 10, 20302043.
Asano, M., Furukawa, K., Kido, M., Matsumoto, S., Umesaki, Y., Kochibe, N., and Iwakura, Y. (1997) Growth retardation and early death of beta-1,4-galactosyltransferase knockout mice with augmented proliferation and abnormal differentiation of epithelial cells. EMBO J., 16, 18501857.[CrossRef][Web of Science][Medline]
Axford, J.S. (1999) Glycosylation and rheumatic disease. Biochim. Biophys. Acta, 1455, 219229.[Medline]
Babcock, M., Macleod, G.T., Leither, J., and Pallanck, L. (2004) Genetic analysis of soluble N-ethylmaleimide-sensitive factor attachment protein function in Drosophila reveals positive and negative secretory roles. J. Neurosci., 24, 39643973.
Baker, J.D., Adhikarakunnathu, S., and Kernan, M.J. (2004) Mechanosensory-defective, male-sterile unc mutants identify a novel basal body protein required for ciliogenesis in Drosophila. Development, 131, 34113422.
Bulik, D.A., Wei, G., Toyoda, H., Kinoshita-Toyoda, A., Waldrip, W.R., Esko, J.D., Robbins, P.W., and Selleck, S.B. (2000) Sqv-3, -7, and -8, a set of genes affecting morphogenesis in Caenorhabditis elegans, encode enzymes required for glycosaminoglycan biosynthesis. Proc. Natl Acad. Sci. USA, 97, 1083810843.
Chen, J., Moloney, D.J., and Stanley, P. (2001) Fringe modulation of Jagged1-induced Notch signaling requires the action of beta 4galactosyltransferase-1. Proc. Natl Acad. Sci. USA, 98, 1371613721.
Correia, T., Papayannopoulos, V., Panin, V., Woronoff, P., Jiang, J., Vogt, T.F., and Irvine, K.D. (2003) Molecular genetic analysis of the glycosyltransferase Fringe in Drosophila. Proc. Natl Acad. Sci. USA, 100, 64046409.
Eberl, D.F., Hardy, R.W., and Kernan, M.J. (2000) Genetically similar transduction mechanisms for touch and hearing in Drosophila. J. Neurosci., 20, 59815988.
Evrard, Y.A., Lun, Y., Aulehla, A., Gan, L., and Johnson, R.L. (1998) lunatic fringe is an essential mediator of somite segmentation and patterning. Nature, 394, 377381.[CrossRef][Medline]
Furukawa, K. and Sato, T. (1999) Beta-1,4-galactosylation of N-glycans is a complex process. Biochim. Biophys. Acta, 1473, 5466.[Medline]
Gastinel, L.N., Cambillau, C. and Bourne, Y. (1999) Crystal structures of the bovine beta4galactosyltransferase catalytic domain and its complex with uridine diphosphogalactose. Embo J, 18, 35463557.
Gong, W.J. and Golic, K.G. (2003) Ends-out, or replacement, gene targeting in Drosophila. Proc. Natl Acad. Sci. USA, 100, 25562561.
Goode, S., Melnick, M., Chou, T.B., and Perrimon, N. (1996a) The neurogenic genes egghead and brainiac define a novel signaling pathway essential for epithelial morphogenesis during Drosophila oogenesis. Development, 122, 38633879.[Abstract]
Goode, S., Morgan, M., Liang, Y.P., and Mahowald, A.P. (1996b) Brainiac encodes a novel, putative secreted protein that cooperates with Grk TGF alpha in the genesis of the follicular epithelium. Dev. Biol., 178, 3550.[CrossRef][Web of Science][Medline]
Griffitts, J.S., Whitacre, J.L., Stevens, D.E., and Aroian, R.V. (2001) Bt toxin resistance from loss of a putative carbohydrate-modifying enzyme. Science, 293, 860864.
Griffitts, J.S., Huffman, D.L., Whitacre, J.L., Barrows, B.D., Marroquin, L.D., Muller, R., Brown, J.R., Hennet, T., Esko, J.D., and Aroian, R.V. (2003) Resistance to a bacterial toxin is mediated by removal of a conserved glycosylation pathway required for toxin-host interactions. J. Biol. Chem., 278, 4559445602.
Guo, S., Sato, T., Shirane, K., and Furukawa, K. (2001) Galactosylation of N-linked oligosaccharides by human beta-1,4-galactosyltransferases I, II, III, IV, V, and VI expressed in Sf-9 cells. Glycobiology, 11, 813820.
Haines, N. and Irvine, K.D. (2003) Glycosylation regulates Notch signalling. Nat. Rev. Mol. Cell Biol., 4, 786797.[Web of Science][Medline]
Haltiwanger, R.S. and Stanley, P. (2002) Modulation of receptor signaling by glycosylation: fringe is an O-fucose-beta1,3-N-acetylglucosaminyltransferase. Biochim. Biophys. Acta, 1573, 328335.[Medline]
Hansske, B., Thiel, C., Lubke, T., Hasilik, M., Honing, S., Peters, V., Heidemann, P.H., Hoffmann, G.F., Berger, E.G., von Figura, K., and others. (2002) Deficiency of UDP-galactose:N-acetylglucosamine beta-1,4-galactosyltransferase I causes the congenital disorder of glycosylation type IId. J. Clin. Invest., 109, 725733.[CrossRef][Web of Science][Medline]
Herman, T., Hartwieg, E., and Horvitz, H.R. (1999) Sqv mutants of Caenorhabditis elegans are defective in vulval epithelial invagination. Proc. Natl Acad. Sci. USA, 96, 968973.
Irvine, K.D. and Wieschaus, E. (1994) Fringe, a boundary-specific signaling molecule, mediates interactions between dorsal and ventral cells during Drosophila wing development. Cell, 79, 595606.[CrossRef][Web of Science][Medline]
Kawar, Z.S., Van Die, I., and Cummings, R.D. (2002) Molecular cloning and enzymatic characterization of a UDP-GalNAc:GlcNAc(beta)-R beta1,4-N-acetylgalactosaminyltransferase from Caenorhabditis elegans. J. Biol. Chem., 277, 3492434932.
Kernan, M., Cowan, D., and Zuker, C. (1994) Genetic dissection of mechanosensory transduction: mechanoreception-defective mutations of Drosophila. Neuron, 12, 11951206.[CrossRef][Web of Science][Medline]
Koles, K., Irvine, K.D., and Panin, V.M. (2004) Functional characterization of Drosophila sialyltransferase. J. Biol. Chem., 279, 43464357.
Kosaka, T. and Ikeda, K. (1983) Reversible blockage of membrane retrieval and endocytosis in the garland cell of the temperature-sensitive mutant of Drosophila melanogaster, shibirets 1. J. Cell Biol., 97, 499507.
Kubelka, V., Altmann, F., and Marz, L. (1995) The asparagine-linked carbohydrate of honeybee venom hyaluronidase. Glycoconj. J., 12, 7783.[CrossRef][Web of Science][Medline]
Lo, N.W., Shaper, J.H., Pevsner, J., and Shaper, N.L. (1998) The expanding beta 4-galactosyltransferase gene family: messages from the databanks. Glycobiology, 8, 517526.
Lu, Q., Hasty, P., and Shur, B.D. (1997) Targeted mutation in beta1,4-galactosyltransferase leads to pituitary insufficiency and neonatal lethality. Dev. Biol., 181, 257267.[CrossRef][Web of Science][Medline]
Nakamura, Y., Haines, N., Chen, J., Okajima, T., Furukawa, K., Urano, T., Stanley, P., Irvine, K.D., and Furukawa, K. (2002b) Identification of a Drosophila gene encoding xylosylprotein beta4-galactosyltransferase that is essential for the synthesis of glycosaminoglycans and for morphogenesis. J. Biol. Chem., 277, 4628046288.
Nixon, B., Lu, Q., Wassler, M.J., Foote, C.I., Ensslin, M.A., and Shur, B.D. (2001) Galactosyltransferase function during mammalian fertilization. Cells Tissues Organs, 168, 4657.[CrossRef][Web of Science][Medline]
Nybakken, K. and Perrimon, N. (2002) Heparan sulfate proteoglycan modulation of developmental signaling in Drosophila. Biochim. Biophys. Acta, 1573, 280291.[Medline]
Okajima, T., Yoshida, K., Kondo, T. and Furukawa, K. (1999) Human homolog of Caenorhabditis elegans sqv-3 gene is galactosyltransferase I involved in the biosynthesis of the glycosaminoglycan-protein linkage region of proteoglycans. J. Biol. Chem., 274, 2291522918.
Palomares, L.A., Joosten, C.E., Hughes, P.R., Granados, R.R., and Shuler, M.L. (2003) Novel insect cell line capable of complex N-glycosylation and sialylation of recombinant proteins. Biotechnol. Prog., 19, 185192.[CrossRef][Medline]
Quentin, E., Gladen, A., Roden, L., and Kresse, H. (1990) A genetic defect in the biosynthesis of dermatan sulfate proteoglycan: galactosyltransferase I deficiency in fibroblasts from a patient with a progeroid syndrome. Proc. Natl Acad. Sci. USA, 87, 13421346.
Ramakrishnan, B. and Qasba, P.K. (2002) Structure-based design of beta 1,4-galactosyltransferase I (beta 4Gal-T1) with equally efficient N-acetylgalactosaminyltransferase activity: point mutation broadens beta 4Gal-T1 donor specificity. J. Biol. Chem., 277, 2083320839.
Ramakrishnan, B., Balaji, P.V., and Qasba, P.K. (2002) Crystal structure of beta1,4-galactosyltransferase complex with UDP-Gal reveals an oligosaccharide acceptor binding site. J. Mol. Biol., 318, 491502.[CrossRef][Web of Science][Medline]
Richards, S., Hillman, T., and Stern, M. (1996) Mutations in the Drosophila pushover gene confer increased neuronal excitability and spontaneous synaptic vesicle fusion. Genetics, 142, 12151223.[Abstract]
Rodeheffer, C. and Shur, B.D. (2004) Sperm from beta1,4-galactosyltransferase I-null mice exhibit precocious capacitation. Development, 131, 491501.
Rong, Y.S. and Golic, K.G. (2001) A targeted gene knockout in Drosophila. Genetics, 157, 13071312.
Rorth, P., Szabo, K., Bailey, A., Laverty, T., Rehm, J., Rubin, G.M., Weigmann, K., Milan, M., Benes, V., Ansorge, W., and others. (1998) Systematic gain-of-function genetics in Drosophila. Development, 125, 10491057.[Abstract]
Rubin, G.M., Hong, L., Brokstein, P., Evans-Holm, M., Frise, E., Stapleton, M., and Harvey, D.A. (2000) A Drosophila complementary DNA resource. Science, 287, 22222224.
Schwientek, T., Keck, B., Levery, S.B., Jensen, M.A., Pedersen, J.W., Wandall, H.H., Stroud, M., Cohen, S.M., Amado, M., and Clausen, H. (2002) The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesis. J. Biol. Chem., 277, 3242132429.
Seppo, A., Moreland, M., Schweingruber, H., and Tiemeyer, M. (2000) Zwitterionic and acidic glycosphingolipids of the Drosophila melanogaster embryo. Eur. J. Biochem., 267, 35493558.[Web of Science][Medline]
Takemae, H., Ueda, R., Okubo, R., Nakato, H., Izumi, S., Saigo, K., and Nishihara, S. (2003) Proteoglycan UDP-galactose:beta-xylose beta 1,4-galactosyltransferase I is essential for viability in Drosophila melanogaster. J. Biol. Chem., 278, 1557115578.
Tozawa, R., Ishibashi, S., Osuga, J., Yamamoto, K., Yagyu, H., Ohashi, K., Tamura, Y., Yahagi, N., Iizuka, Y., Okazaki, H., and others. (2001) Asialoglycoprotein receptor deficiency in mice lacking the major receptor subunit. Its obligate requirement for the stable expression of oligomeric receptor. J. Biol. Chem., 276, 1262412628.
Vadaie, N. and Jarvis, D.L. (2004) Molecular cloning and functional characterization of a lepidopteran insect beta 4-N-acetylgalactosaminyltransferase with broad substrate specificity, a functional role in N-glycoprotein biosynthesis, and a potential functional role in glycolipid biosynthesis. J. Biol. Chem., 279, 3350133518.
Vadaie, N., Hulinsky, R.S., and Jarvis, D.L. (2002) Identification and characterization of a Drosophila melanogaster ortholog of human beta1,4-galactosyltransferase VII. Glycobiology, 12, 589597.
Van Die, I., van Tetering, A., Bakker, H., van den Eijnden, D.H., and Joziasse, D.H. (1996) Glycosylation in lepidopteran insect cells: identification of a beta 1Æ4-N-acetylgalactosaminyltransferase involved in the synthesis of complex-type oligosaccharide chains. Glycobiology, 6, 157164.
Van Die, I., Bakker, H., and Van den Eijnden, D.H. (1997) Identification of conserved amino acid motifs in members of the beta1Æ4-galactosyltransferase gene family. Glycobiology, 7, vviii.
Varki, A., Cummings, R., Esko, J., Freeze, H., Hart, G., and J., M. (1999) Essentials of glycobiology. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
Walsh, P., Bursac, D., Law, Y.C., Cyr, D., and Lithgow, T. (2004) The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep., 5, 567571.[CrossRef][Web of Science][Medline]
Wandall, H.H., Pedersen, J.W., Park, C., Levery, S.B., Pizette, S., Cohen, S.M., Schwientek, T., and Clausen, H. (2003) Drosophila egghead encodes a beta 1,4-mannosyltransferase predicted to form the immediate precursor glycosphingolipid substrate for brainiac. J. Biol. Chem., 278, 14111414.
Wang, P., Saraswati, S., Guan, Z., Watkins, C.J., Wurtman, R.J., and Littleton, J.T. (2004) A Drosophila temperature-sensitive seizure mutant in phosphoglycerate kinase disrupts ATP generation and alters synaptic function. J. Neurosci., 24, 45184529.
Wigglesworth, V.B. (1972) The principles of insect physiology. Chapman and Hall, London.
Zhang, N. and Gridley, T. (1998) Defects in somite formation in lunatic fringe-deficient mice. Nature, 394, 374377.[CrossRef][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Hamel, J. Fantini, and F. Schweisguth Notch ligand activity is modulated by glycosphingolipid membrane composition in Drosophila melanogaster J. Cell Biol., February 22, 2010; 188(4): 581 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. T. Hagen, L. Zhang, E Tian, and Y. Zhang Glycobiology on the fly: Developmental and mechanistic insights from Drosophila Glycobiology, February 1, 2009; 19(2): 102 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Johswich, B. Kraft, M. Wuhrer, M. Berger, A. M. Deelder, C. H. Hokke, R. Gerardy-Schahn, and H. Bakker Golgi targeting of Drosophila melanogaster {beta}4GalNAcTB requires a DHHC protein family-related protein as a pilot J. Cell Biol., January 12, 2009; 184(1): 173 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Harbison and A. Sehgal Quantitative Genetic Analysis of Sleep in Drosophila melanogaster Genetics, April 1, 2008; 178(4): 2341 - 2360. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Koles, J.-M. Lim, K. Aoki, M. Porterfield, M. Tiemeyer, L. Wells, and V. Panin Identification of N-Glycosylated Proteins from the Central Nervous System of Drosophila Melanogaster Glycobiology, December 1, 2007; 17(12): 1388 - 1403. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Xu, N. Haines, M. Dlugosz, N. A. Rana, H. Takeuchi, R. S. Haltiwanger, and K. D. Irvine In Vitro Reconstitution of the Modulation of Drosophila Notch-Ligand Binding by Fringe J. Biol. Chem., November 30, 2007; 282(48): 35153 - 35162. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Aoki, M. Perlman, J.-M. Lim, R. Cantu, L. Wells, and M. Tiemeyer Dynamic Developmental Elaboration of N-Linked Glycan Complexity in the Drosophila melanogaster Embryo J. Biol. Chem., March 23, 2007; 282(12): 9127 - 9142. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Haines and B. A. Stewart Functional Roles for {beta}1,4-N-Acetlygalactosaminyltransferase-A in Drosophila Larval Neurons and Muscles Genetics, February 1, 2007; 175(2): 671 - 679. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Leonard, D. Rendic, C. Rabouille, I. B. H. Wilson, T. Preat, and F. Altmann The Drosophila fused lobes Gene Encodes an N-Acetylglucosaminidase Involved in N-Glycan Processing J. Biol. Chem., February 24, 2006; 281(8): 4867 - 4875. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Fuller, T. Schwientek, H. H. Wandall, J. W. Pedersen, H. Clausen, and S. B. Levery Structure elucidation of neutral, di-, tri-, and tetraglycosylceramides from High Five cells: identification of a novel (non-arthro-series) glycosphingolipid pathway Glycobiology, December 1, 2005; 15(12): 1286 - 1301. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










