Glycobiology Advance Access originally published online on November 3, 2004
Glycobiology 2005 15(3):259-269; doi:10.1093/glycob/cwi011
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology vol. 15 no. 3 © Oxford University Press 2005; all rights reserved.
Suppressors of
(1,3)fucosylation identified by expression cloning in the LEC11B gain-of-function CHO mutant
Department of Cell Biology, Albert Einstein College of Medicine, 1300 Morris Park Ave., New York, NY 10461
3 To whom correspondence should be addressed; e-mail: stanley{at}aecom.yu.edu
Received on August 13, 2004; revised on October 24, 2004; accepted on October 29, 2004
| Abstract |
|---|
|
|
|---|
Factors that regulate
(1,3)fucosyltransferase activity are important to identify because FUT genes are up-regulated during inflammation, cancer progression, and tumor metastasis. FUT gene activation increases the expression of cell surface oncofetal antigens such as Lewis X, sialyl-Le X and VIM-2. The LEC11B gain-of-function glycosylation mutant displays these antigens and binds E-selectin because it expresses the Fut6B gene that is shown here to lie immediately downstream of the Fut6A gene. A retroviral strategy for expression cloning factors that suppress
(1,3)fucosylation in LEC11B cells was developed, and several cDNAs that reverted the LEC11B glycosylation phenotype were isolated. cDNAs that arose most frequently and independently encoded SLC35C2, a putative GDP-fucose transporter (also termed CGI-15 or Ovcov1); Cd63, a tetraspanin membrane protein; and Hdac5, a histone deacetylase. When transfected into LEC11B cells the SLC35C2 cDNA reduced Le X expression with no concomitant suppression of Fut6B gene transcripts. Transfection of the Cd63 cDNA induced low levels of ricin resistance and also did not suppress Fut6B gene transcripts in LEC11B. However, the Hdac5 cDNA induced ricin resistance, reduced fucosylated antigen expression, and essentially eliminated Fut6B gene transcripts. The Hdac5 cDNA isolated by expression cloning encoded the C-terminal region of hamster Hdac5. Overexpression of this partial Hdac5 cDNA or a full-length Hdac5 cDNA, suppressed Fut6B gene transcripts specifically. Thus the expression cloning strategy identified Hdac5 as a trans-acting repressor of the Chinese hamster ovary Fut6B gene and Cd63 and SLC35C2 as novel factors that suppress
(1,3)fucosylation by mechanisms unrelated to effects on Fut gene expression.
Key words:
(1,3)fucosyltransferase
/
dominant CHO mutant
/
expression cloning
/
Le X suppression
| Introduction |
|---|
|
|
|---|
The LEC11B gain-of-function Chinese hamster ovary (CHO) glycosylation mutant possesses an
(1,3)fucosyltransferase (Fuc-T) activity that is the product of the Chinese hamster Fut6B gene (Zhang et al., 1999
(1,3)Fuc-T activity in cell extracts (Campbell and Stanley, 1983
Due to de novo Fut6B gene expression and consequent
(1,3)Fuc-T activity, LEC11B cells express
(1,3)fucosylated, cell surface, oncofetal antigens, including stage-specific embryonic antigen-1 (SSEA-1 or Lewis X), sialyl-Le X (SLe X), and VIM-2 (Campbell and Stanley, 1983
; Howard et al., 1987
). LEC11 cells were used to identify SLe X as a ligand for E-selectin (Phillips et al., 1990
), one of the lectins that mediates leukocyte adhesion to vascular endothelium, initiating extravasation of leukocytes from the bloodstream (reviewed in Lowe, 2003
). Increased expression of SLe X due to increased
(1,3)Fuc-T activity has been correlated with tumor progression and metastasis in mouse models (Fukuda et al., 2000
; Fuster et al., 2003
; Saitoh et al., 1992
) and in humans (Hakomori, 2001
). SSEA-1 is found on the surface of human lung cancer cell lines, human colon carcinoma, and human epidermal carcinoma (reviewed in Feizi, 1985
). Moreover, the addition of
(1,3)fucose is the last step in the biosynthesis of SLe X (Campbell and Stanley, 1984
; Holmes et al., 1985
), so
(1,3)Fuc-Ts are crucial regulatory enzymes in the construction of selectin recognition determinants (see Lowe, 1997
).
LEC11 mutants provide models for studying the regulated expression of
(1,3)fucosylated glycans. Cloning of cDNAs that revert LEC11B should identify factors that directly or indirectly affect the generation of oncofetal antigens and selectin ligands. Transcripts of the Fut6B gene are suppressed in hybrids formed between CHO, LEC18, or LEC11A cells with LEC11B cells, whereas the expression of genes such as actin and GAPDH are not affected (Zhang et al., 1999
). Therefore, expression of the Fut6B gene in LEC11B cells most likely occurs due to an effect on transcription or RNA stability. Activation of the silent Fut6B gene may be due to a change in local chromatin structure or to relief of transcriptional repression through a negative response element, or indirectly through a corepressor or a change in RNA turnover. To isolate factors that regulate the expression of the Fut6B gene, as well as factors that inhibit
(1,3)fucosylation by alternative mechanisms, a retroviral expression cloning strategy was developed to obtain cDNAs that revert the LEC11B phenotype. Three cDNAs that suppress the generation of
(1,3)fucosylated oncofetal antigens in LEC11B cells by different mechanisms were characterized.
| Results |
|---|
|
|
|---|
The Fut6A and Fut6B hamster genes are linked
The Chinese hamster genome encodes two Fut6 genes, termed Fut6A and Fut6B (Zhang et al., 1999
1.7 kb downstream of the 3' UTR of the Fut6A gene. This intergenic region was cloned and had promoter activity in a dual luciferase assay (Zhang, 1998
|
Expression cloning of cDNAs that revert the LEC11B phenotype
Because of the expression of
(1,3)fucosylated glycans LEC11B cells are hypersensitive to the toxicity of ricin compared to parent CHO cells (Potvin and Stanley, 1991
104 per cell per generation (Table I).
|
To isolate cDNAs that revert LEC11B, the retrovirus vector pREX-IRESgreen fluorescence protein (GFP) was used, allowing stable, high-level expression of cDNA inserts and selection of transductants by sorting for GFP (Chatterton et al., 1999
Identification of cDNAs that revert LEC11B cells
To identify the cDNAs present in LEC11B revertants, retroviral inserts were amplified by PCR of genomic DNA using primers that hybridized to the upstream sequence of the 5' multiple cloning site and the IRES sequences that flanked the cDNA. PCR products were grouped according to size and those
500 bp were digested with RsaI and analyzed by agarose gel electrophoresis. Clones with PCR products of the same size and RsaI digestion pattern were sequenced. Among the cDNAs identified, SLC35C2, Cd63, and histone deacetylase 5 (Hdac5) arose frequently (11, 11, and 4 times, respectively) from independent pools and best reverted the LEC11B phenotype. Other cDNAs that were obtained more than once were integral membrane protein (AJ004912
[GenBank]
), ribosomal protein L8 (NM012053), RNA binding motif (NM009033), Tmp21-I (AJ004912
[GenBank]
), and EF-1a (M22432
[GenBank]
).
The SLC35C2 cDNA encoded a multimembrane-spanning protein homologous to human CGI-15 (AF132949
[GenBank]
) originally identified by bioinformatics methods (Lai et al., 2000
). The human gene was subsequently named OVCOV1 (Leach et al., 2001
, 2002
). A recent analysis places this gene in the SLC35 gene family that includes nucleotide-sugar transporters. SLC35C2 is most homologous to the Golgi GDP-fucose transporter termed SLC35C1 (Ishida and Kawakita, 2004
). Cd63 (NM_ 007653) is a lysosome-associated membrane glycoprotein that is also found on other cellular membranes, including the plasma membrane (Rous et al., 2002
). Cd63 is involved in cell activation (Skubitz et al., 1996
) and cytokine mediator release (Mahmudi-Azer et al., 2002
; Smith et al., 1995
). Hdac5 (NM_010412
[GenBank]
) belongs to the group 2 histone deacetylases that deacetylate nucleic acids and proteins (reviewed in Bertos et al., 2001
).
The rescued hamster SLC35C2, Cd63, and Hdac5 cDNAs were subcloned into pCR3.1 or pREX-IRES-GFP and expressed in LEC11B cells to directly test their ability to revert the LEC11B phenotype. Transfectants were plated in 2.5 ng/ml ricin and selected with G418. LEC11B cells transfected with vector alone or SLC35C2 cDNA in reverse orientation gave 38 ricin-resistant colonies per plate (n = 3). By contrast, SLC35C2 and Hdac5 cDNAs in the correct orientation gave an average of
150 colonies and Cd63 gave
60 colonies per plate (n = 3 for each). Other cDNAs that came through the selection including EF-1a, RNA binding motif protein and Tmp21-I did not revert the LEC11B phenotype consistently.
Some LEC11B SLC35C2 cDNA transfectants were
8-fold ricin-resistant compared to vector control, approaching the wild-type level of
10-fold resistant compared to LEC11B (Figure 2A). Le X antigen expression for these ricin-resistant colonies was reduced by up to 50% compared to LEC11B cells (Figure 2B). However, all the SLC35C2 transfectants expressed Fut6B gene transcripts at a similar level to LEC11B cells (Figure 2C). Therefore SLC35C2 overexpression did not suppress Fut6B gene transcripts and SLC35C2 is therefore not a candidate for the negative regulator responsible for the LEC11B phenotype (Zhang et al., 1999
). Similarly, Cd63 transductants did not consistently have reduced Fut6B gene transcripts.
|
By contrast, transductants expressing the Hdac5 cDNA suppressed Fut6B gene transcripts in LEC11B. The
2.1-kb insert from each of four Hdac5 transductants had the same RsaI digestion pattern (Figure 3A). Sequencing revealed a partial Hdac5 sequence encoding 600 amino acids that contain the Hdac activity domain in the C-terminal portion but lacking 511 amino acids of the N-terminus (Figure 3D). Northern analysis was performed using the Fut6B coding region probe P2 (see Figure 1). Clones C1, C28, and C4.1 lacked Fut6B gene transcripts, whereas clone C30 had trace amounts (Figure 3B). All clones expressed similar levels of endogenous Hdac5 transcripts of
4.4 kb compared to CHO and LEC11B cells (Figure 3C). However, only the Hdac5 transductants expressed higher-molecular-weight transcripts of
8 kb, consistent with a partial Hdac5/GFP bicistronic transcript. Northern analysis using the hamster Hdac5 cDNA as a probe and RNA from all 123 colonies isolated from the library screen revealed that only the four revertants shown in Figure 3 overexpressed Hdac5.
|
|
Hdac5 suppresses Fut6B gene expression and
(1,3)Fuc-TVI activityTo further examine the ability of the rescued Hdac5 cDNA to revert the LEC11B phenotype, the partial cDNA and a full-length Hdac5 cDNA cloned from CHO cells were subcloned into pCR3.1 and pREX-IRES-GFP. After transfection of LEC11B cells with the partial Hdac5 in pCR3.1, only 2 of 15 G418-resistant transfectants had reduced Le X expression. In a larger experiment with full-length Hdac5 in pCR3.1 LEC11B cells were also not significantly reverted. However, all LEC11B-Eco colonies selected on the basis of GFP expression from Hdac5 in pREX-IRES-GFP had reduced Le X expression. Figure 4A shows that LEC11B cells expressing the partial Hdac5 from this construct were GFP-positive and Le X-negative. Sixteen other transductants expressing the partial Hdac5 cDNA and 10 transductants expressing a full-length hamster Hdac5 cDNA gave the same results with mean fluorescence index (MFI) for anti-SSEA-1 antibody binding ranging from 4.4 to 9.7. Nontransduced LEC11B cells were GFP-negative and Le X-positive (Figure 4B), whereas nontransduced CHO cells were GFP- and Le X-negative (Figure 4C). LEC11B cells with pREX-IRES-GFP vector alone were GFP-positive and Le X-positive (Figure 4D), showing that neither the pREX-IRES-GFP vector nor the expression of GFP affected Le X expression levels.
|
Northern analysis showed that suppressed Le X expression correlated with reduced Fut6B gene transcripts in all Hdac5 transductants. Vector control had the same level of Fut6B transcripts as LEC11B cells, and transductants expressing the partial Hdac5 cDNA had undetectable Fut6B transcripts (Figure 5A). However, the levels of both GAPDH and actin transcripts were unaffected (Figure 5B and 5C) as observed previously for the trans-acting negative regulator in CHO cells (Zhang et al., 1999
|
Western analysis was performed on transductants expressing full-length Hdac5. The level of the
120-kDa endogenous CHO Hdac5 protein was
1.6-fold greater compared to vector control (Figure 6A). This increase was less than expected from the high amounts of Hdac5 transcripts present in transductants. However, a higher-molecular-weight Hdac5 species (
150 kDa) was detected at variable levels in all transductants (Figure 6A), making the increase in Hdac5
three- to five-fold. This species was not apparent in pCR3.1 Hdac5 LEC11B transfectants that only rarely reverted LEC11B. Although the amount of the
150 kDa species did not correlate directly with revertant phenotype, the overall level of Hdac5 protein was higher in retroviral transductants.
Because northern analysis revealed no differences in Hdac5 transcripts between CHO and LEC11B (Figure 3C) and endogenous Hdac5 protein levels were the same (Figure 6A), sequencing of full-length Hdac5 from two parent CHO lines (Pro5 and Gat2) and LEC11B was performed to see if LEC11B Hdac5 carries a mutation. The CHO Hdac5 sequence was found to be 97% identical to mouse Hdac5 and 95.9% identical to human HDAC5 (Figure 6B). Sequencing did not reveal a single nucleotide difference in the 3336-nucleotide coding region of both the CHO and the LEC11B Hdac5 cDNAs. Therefore, Hdac5 is not the negative regulator previously identified by somatic hybridization to be inactive in LEC11B cells (Zhang et al., 1999
). Nevertheless, it behaves as a trans-acting suppressor of CHO Fut6B gene expression.
| Discussion |
|---|
|
|
|---|
LEC11B mutants express the hamster Fut6B gene due to the loss of a negative regulatory factor that is present in parent CHO cells (Zhang et al., 1999
(1,3)FucT protein, and the stability and half-life of
(1,3)fucose residues transferred to cellular glycoproteins. In fact, only extragenic suppressors were obtained and the molecular basis of the LEC11B mutation remains unknown. The mechanisms that control the expression of
(1,3)fucose-containing glycans are complex (Kannagi, 2001
(1,3)fucosylation may be regulated. Understanding how each suppressor achieves this regulation is a challenge for the future as will be discussed.
Of the cDNAs that reverted the ricin resistance and Le X expression of LEC11B, only Hdac5 consistently suppressed Fut6B gene transcripts while not altering the levels of actin or GAPDH transcripts, as required for the predicted negative regulator (Zhang et al., 1999
). Four independent LEC11B revertants contained a cDNA encoding the C-terminal
600 amino acids of Hdac5, and these were the only clones that overexpressed Hdac5 among 123 revertants. Hdac5 is among the class II Hdacs that are homologous to yeast histone deacetylase 1 (Fischle et al., 1999
; Grozinger et al., 1999
). The opposing activities of histone acetyltransferases and histone deacetyltransferases establish the steady-state level of histone acetylation and control the accessibility of transcription factors to gene promoters. Hyperacetylation of histones is usually correlated with transcriptional activity and hypoacetylation of histones is often correlated with transcriptional repression (reviewed in Cress and Seto, 2000
). Hdacs are found in large complexes containing other transcription repressors involved in gene-specific repression. Hdac5 contains two distinct N- and C-terminal domains connected by a glutamic acid (E)-rich linker (Verdel and Khochbin, 1999
). The C-terminal domain contains the core domain for deacetylase activity. Hdac5 is associated with myocyte enhancer factor-2A (Mef2A) and represses Mef2A transcriptional activity (Lemercier et al., 2000
). It is also directly recruited by Bcl6 to form the repressor complex that controls the POZ/zinc finger (POK) transcription factors activity (Lemercier et al., 2000
). Hdac5 has been shown to interact directly with Gata1 during MEL cell differentiation (Watamoto et al., 2003
).
The partial Hdac5 cDNA recovered from expression cloning contains part of the N-terminus, the E-rich linker, and the entire C-terminal deacetylase domain (Figure 6B). There are several in-frame methionines in the N-terminal portion of the C-terminal domain. Partial or full-length Hdac5 from CHO cells introduced into LEC11B-Eco cells by the retroviral vector completely suppressed Le X expression and Fut6B gene transcripts. Based on these results, overexpression of human HDAC5 may lead to inhibition of human FUT6 gene expression in pancreatic tumors in which this gene is up-regulated and thought to aid in metastasis (Hiller et al., 2000
; Mas et al., 1998
). However, the mechanism by which Hdac5 suppresses Fut6B transcripts in CHO cells is not known. A mutation in the Hdac5 coding region was shown not to be the basis of the LEC11B mutation. In addition, reversion of LEC11B was rarely achieved with Hdac5 expressed in pCR3.1. These transfectants had increased levels of Hdac5
two-fold but did not make the
150-kDa species seen in Hdac5 retrovirus transductants. Hdac5 in the retrovirus vector always reverted LEC11B. It is possible that the larger amount of Hdac5 produced by the retrovirus is the basis of reversion. Alternatively, sense or antisense or small interfering RNAs generated from the Hdac5 retrovirus constructs may be indirectly responsible for inhibiting the transcription or degradation of Fut6B gene transcripts. The mechanisms by which Hdac5 affects gene expression are complex and may be mediated by a noncatalytic region and independently of histone deactylase activity (see Castet et al., 2004
). In fact, treatment of parent CHO cells with various concentrations of the histone deactetylase inhibitor trichostatin A did not lead to the synthesis of SLe X that would indicate relief of the suppression of the Fut6B gene (Chen and Stanley, unpublished data), indicating that histone deactylase activity may not be involved in Fut6B gene silencing.
The mechanisms by which Cd63 and SLC35C2 cDNAs revert LEC11B are distinct from Hdac5 because neither cDNA reduced the level of Fut6B gene transcripts. Cd63 is a member of the family of tetraspanin membrane proteins found in lysosomes, melanocytes, platelet dense granules, and at the cell surface (reviewed by Hemler, 2003
). The tetraspanin proteins function in forming membrane microdomains that affect the expression of membrane molecules, such as the major histocompatibility complex (reviewed in Vogt et al., 2002
). Another function for Cd63 is in enhancing the internalization of plasma membrane H,K-ATPase (Duffield et al., 2003
). Thus overexpression of Cd63 in LEC11B cells may reduce the cell surface expression of Le X and increase ricin resistance by enhancing the endocytosis of membrane glycoproteins that carry Le X. Alternatively, Cd63 may interact directly with
(1,3)Fuc-TVIB in the Golgi membrane of LEC11B to reduce its activity, or Cd63 may alter the microdomain structure of Golgi membranes and thereby indirectly reduce
(1,3)Fuc-TVI activity. The mechanism by which Cd63 reverts the LEC11B phenotype is of interest for understanding factors that regulate glycosylation in general and
(1,3)Fuc-TVI activity in particular.
The third suppressor of the LEC11B phenotype SLC35C2 was originally identified as CGI-15 by comparative proteomics (Lai et al., 2000
) and subsequently as OVCOV1 by differential cloning of genes expressed in ovarian cancer (Leach et al., 2001
, 2002
). Based on homology comparisons, human SLC35C2 protein is related to membrane spanning transporters. It has
32% amino acid identity to a vanadate resistance protein Gog5 from Saccharomyces cerevisiae (NP_013674
[GenBank]
) and a related protein from Caenorhabditis elegans (CAA94748
[GenBank]
. Vanadate resistance protein is a membrane transporter involved in drug resistance. Most interestingly, the human GDP-Fuc transporter 1 (XP_051033) sequence is 25.5% identical and 39.9% similar to the N-terminal 153 amino acids of human SLC35C2. Hydrophobicity analysis revealed a structural similarity between SLC35C2 and GDP-Fuc transporter 1 (SLC35C1) that are both predicted to contain nine transmembrane domains. Sequence comparisons place SLC35C1 and SLC35C2 in the same family of nucleotide-sugar transporters (Ishida and Kawakita, 2004
), strongly suggesting that SLC35C2 is a GDP-fucose transporter. If SLC35C2 transports GDP-Fuc it may function in a compartment other than the Golgi and thereby reduce the Golgi concentration of GDP-fucose resulting in a decrease in cell surface Le X glycans and ricin resistance in LEC11B revertants. The fact that patients with a defective Golgi GDP-Fuc transporter (SLC35C1) transfer O-fucose to Notch receptors (Sturla et al., 2003
) and do not have developmental problems as would be predicted if they could not transfer O-fucose to Notch (Okajima and Irvine, 2002
; Sasamura et al., 2003
; Shi and Stanley, 2003
), suggests that Notch receptors receive their O-fucose in a pre-Golgi or early Golgi compartment. Experiments are in progress to determine if SCL35C2 levels affect O-fucosylation of Notch receptors. In conclusion, both Cd63 and SCL35C2 reduce the expression of Le X by novel mechanisms that provide insight into factors that affect the functioning of an
(1,3)FucT and thereby the cell surface expression of Le X and SLeX oncofetal antigens and selectin ligands.
| Materials and methods |
|---|
|
|
|---|
Materials
Restriction enzymes were from Boehringer Mannheim, New England Biolabs (Beverly, MA), Promega (Madison, WI), and Invitrogen (Carlsbad, CA). T4 DNA ligase, protease inhibitor tablets, RnaseH, DnaseI, and Rnase inhibitor, shrimp alkaline phosphatase, and Expand Long Template PCR System were from Boehringer Mannheim. RNasin and Klenow fragment were from Promega. The TRIzol reagent, Superscript II reverse transcriptase, terminal deoxynucleotidyl transferase, DNA molecular weight markers, ELONGASE Enzyme mix, LipofectAMINE Reagent, Opti-MEM I Reduced Serum Medium,
medium, Dulbecco's modified Eagle medium, and synthetic oligonucleotides were from GIBCO/Invitrogen. (
-32P) dCTP (6000 Ci/mmol) were from Du PontNew England Nuclear (Boston, MA). Taq polymerase and dNTPs were from Perkin Elmer (Wellesley, MA) or Boehringer Mannheim. Hybond nylon membrane and Rapid-hyb buffer were from Amersham (Piscataway, NJ). Nonidet P-40, MOPS, bovine serum albumin (BSA), and Polybrene were from Sigma (St. Louis, MO). G418 and fetal bovine serum (FBS) were from Gemini Bio-Products (Calabas, CA). Hygromycin was from Invitrogen. Wheat germ agglutinin and ricin were from Vector Laboratories (Burlingame, CA). DNA gel extraction kit was from Qiagen (Valencia, CA). Other chemicals and reagents were usually obtained from either Sigma or Fisher Scientific (Silver Spring, MD). Monoclonal antibody anti-SSEA-1 was prepared by 40% ammonium sulfate precipitation of ascites produced by Caf1/J mice injected with the hybridoma cell line 480 obtained from Dr. Barbara Knowles. This antibody was conjugated directly to phycoerythrin by Dr. Olga Blumenfeld. Human anti-HDAC5 antibody sc-5252, anti-goat, and anti-mouse IgG were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-actin antibody was a gift of Dr. E. R Stanley. Phoenix ecotropic packaging cells (ATCC SD 3444) were a generous gift from Dr. G. Nolan (Stanford University Medical Center).
Cell lines and cell culture
Parental CHO cells Pro5 and Gat2 (Stanley et al., 1975
), LEC11B (GatLEC11.F2; Zhang et al., 1999
) and LEC18 (Pro5LEC18.21B; Raju et al., 1995
) were cultured in suspension or monolayer at 37°C in a medium containing 10% FBS. Phoenix ecotropic packaging cells (ATCC SD 3444) were cultured in Dulbecco's modified Eagle medium containing penicillin, streptomycin, glutamine (2 mM), and 10% FBS at 37°C in a 5% CO2 incubator. Transfectants expressing antibiotic resistance genes were grown in a medium containing G418 (1.0 mg/ml active weight) or hygromycin (700 µg/ml) respectively.
Mapping the CHO Fut6 Gene Locus
Southern analysis of genomic DNA from CHO and LEC11B cells digested with a variety of restriction enzymes was performed with coding region and gene specific UTR probes described previously (Zhang et al., 1999
) to map the region of the CHO genome that contains the Fut6A and Fut6B genes. Restriction mapping was confirmed by PCR of genomic DNA with the following primers: primer 1 specific for Fut6A gene coding region (5' GGACTACCAGGCCATGGAT 3'); primer 2 specifc for Fut6A 3' UTR (5' CTGACAGAATAAGGTCTCATCTGG 3'); primer 3 specific for Fut6B coding region (5' GATCCCCCAGGCCATGGAT 3'); primer 4 specific for Fut6B 3' UTR (5' AGCTTACATTTCTCAGTCACACTCC 3'); primer 5 specific for 3' UTR of Fut6A (5' GTGCTAGACACTCCCTTGATGAGC 3'); primer 6 specific for Fut6B 5' UTR (5' TTCTGCAGGCCAAGCTCTACTGC 3'); primer 7 specific for Fut6B 5' UTR (5' TCCTTGGGCTGGCAGTGTCTCG 3').
Construction of CHO cells expressing an ecotropic retrovirus receptor
LEC11B cells were transfected with pcB7-Eco (a gift from Drs. Xudong Liu and Harvey Lodish, Massachussets Institute of Technology) using LipofectAMINE and selected in a 10% FBS medium and 700 µg/ml hygromycin. Ten colonies were tested for Eco receptor expression by their ability to be infected by retrovirus produced by Phoenix packaging cells. Transfectants that expressed the most GFP were chosen for expression cloning experiments. LEC11B-Eco cells retained the LEC11B glycosylation phenotype as determined by their lectin resistance pattern and expression of cell surface Le X.
cDNA library construction
Total RNA was isolated from Pro5 LEC18 cells using TRIzol Reagent (Life Technologies, Carlsbad, CA) and poly(A)+ RNA was prepared using an Oligo-dT column (New England Biolabs). First strand cDNA was synthesized from 5 µg poly(A)+ RNA using a NotI primer-adapter and SuperScriptII reverse transcriptase. EcoRI/BstXI adapters (Invitrogen) were ligated into the EcoRI/NotI sites of pREX-IRES-GFP (a gift of Dr. Jon Chatterton, MIT). Double-stranded cDNAs were size-fractionated (>500 bp) using the SuperScript Plasmid System for cDNA Synthesis (Life Technologies) and digested with NotI before ligation into pREX-IRES-GFP. The pREX-IRES-GFP cDNA library (
10 ng) was transformed into DH 10B ElectroMax competent E. coli (Life Technologies) by electrotransformation of 1 ml bacteria in a 0.1-cm cuvette at 2.5 KV, 100 ohms, and 25 µF in a Bio-Rad gene pulser. Independent clones (9.4 x 105) were obtained. From plasmid DNA of 20 clones, the average insert size was 2.3 kb, and 2 contained empty vector. The library was checked using a Gene Checker Kit (Invitrogen) for the presence of large (>6 kb) and full-length transcripts. Five primer sets amplified part of the GAPDH gene, the 5' and 3' ends of the actin gene, and the 5' (6 kb) and 3' (2 kb) ends of the clathrin gene. All five PCR products were present at the expected size. Plasmids from the library were divided into nine subpools.
Production of retroviral supernatants
Retroviral supernatants were prepared by transfecting Phoenix cells with 10 µg pREX-GFP plasmid DNA (control) or each subpool of the library. Phoenix cells plated at 106 cells per well in 5 ml Dulbecco's modified Eagle medium 10% FBS in six-well dishes were
80% confluent after 24 h incubation at 37°C in a 5% CO2 incubator. Before transfection, the medium was replaced with 5 ml Dulbecco's modified Eagle medium 10% FBS containing 24 µM chloroquine, and incubated for 1 h at 37°C in a 5% CO2 incubator. Plasmid DNA (10 µg) was added to 1 ml HBS (137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 6 mM dextrose, 21 mM HEPES, pH 7.03) in a 75 mm polypropylene tube and mixed gently. Subsequently, 125 µl 1 M CaCl2 was added to each tube containing the DNA/HBS mixture, immediately mixed by inverting the tube several times followed by 510 min incubation at room temperature. The DNA/HBS/CaCl2 mixture was added drop-wise with gentle swirling to the chloroquine-containing medium in the 6-well dish. The plates were incubated for 68 h at 37°C in a 5% CO2 incubator. After 24 h, the medium was replaced in each well with 4 ml Dulbecco's modified Eagle medium with10% FBS. After 24 h at 32°C in a 5% CO2 incubator (48 h after transfection), the retrovirus supernatant was filtered through a 0.22-µm filter and used immediately or frozen rapidly on dry ice and stored at 80°C.
Flow cytometry analysis and fluorescence-activated cell sorting
For flow cytometry, 24 x 105 cells were pelleted and washed once with 3 ml cold phosphate buffered saline (PBS)/2% BSA. Cells were resuspended in 100 µl PBS/2 % BSA, containing 10 µg/ml anti-SSEA-1 monoclonal antibody. After 30 min on ice, cells were washed with 3 ml cold PBS/2% BSA. Phycoerythrin or fluorescein isothiocyanateconjugated secondary antibody (1 µg) was added in 100 ml PBS/2% BSA for 30 min on ice and removed by a 3-ml wash with PBS/2% BSA. Cells resuspended in PBS were subjected to flow cytometry using a Becton-Dickinson Immunocytometry System (San Jose, CA).
For cell sorting, cells transduced with the retrovirus cDNA library were resuspended in PBS at
5 x 106 cells per ml. Cells were sorted on a Becton-Dickinson Immunocytometry System at a rate of
105 cells per min, and green cells were collected in a medium 10% FBS containing penicillin and streptomycin.
Isolation and characterization of cDNAs from LEC11B revertants
Integrated retroviral cDNA inserts were isolated by PCR performed on genomic DNA using primers located within pREX-IRES-GFP vector. PS406 (5' CCACCGCCCTCAAAGTAGACG 3') was from the upstream sequence of the 5' multiple cloning site and PS407 (5' CCAACTTAATCGCCTTGCAGCA 3') was from the IRES sequence located downstream of the 3' multiple cloning site. Extend long template PCR system and ELONGASE polymerase were used. Premix 1 (20 µl) contained 0.2 mM of dNTPs, 10 pmol primers, and up to 500 ng genomic DNA template. Premix 2 (30 µl) consisted of 1 µl dimethyl sulfoxide, 2 µl ELONGASE enzyme mix, and buffer B (final concentration: 60 mM Tris-SO4 [pH 9.1], 18 mM (NH4)2SO4, with 2 mM MgSO4). Samples were treated at 94°C for 30 s, 30 cycles of 94°C for 30 s, annealed at 6065°C for 30 s, and elongated at 68°C for 1 min per kb of target. PCR products were separated on a 1.0% agarose gel, and those longer than 500 bp were recovered using a Qiagen gel extraction kit. cDNA inserts were grouped by size and were subsequently digested by RsaI. The RsaI digestion patterns were then analyzed on a 1.2% agarose gel. The inserts of the same size and the same RsaI digestion pattern were grouped together, and representatives from each group were sequenced.
The cDNA inserts recovered from the genomic DNA of RicR, GFP+, SSEA-1 colonies by PCR using PS406 and PS407 were ligated into the pCR3.1 mammalian expression vector, and clones in the correct orientation were identified by restriction digestion and by sequencing. For expression in the pREX-IRES-GFP retroviral vector, cDNAs in pCR3.1 were released by BamHI and NotI or EcoRI and cloned into the BamHI and NotI or EcoRI sites of the pREX-IRES-GFP vector. Restriction analysis was used to identify cDNAs in the correct orientation, and these were transfected into LEC11B-Eco cells or into Phoenix cells to produce retrovirus supernatant for infection of LEC11B-Eco cells. LEC11B-Eco cells expressing a candidate revertant cDNA were tested for ricin resistance, SSEA-1 antigen expression, and cgFUT6B gene expression.
Cloning and sequencing of CHO Hdac5
To clone the CHO Hdac5 coding region, reverse transcriptase PCR was performed on Pro5. Gat2 parent CHO and LEC11B total RNA (5 µg). An oligo-dT primer was used for first strand cDNA synthesis. cDNA products (2 µl) were added to an Extend Long Template PCR reaction. PCR amplifications were performed using primers designed according to the 5' and 3' UTR regions of mouse Hdac5 cDNA sequence. The forward primer was W1 (5' CCCCCTCCCGTCCCAGCCCCCAACGTCAGC 3') and the reverse primer was W5 (5' ATGAAGCCCAAAGGGATGGGGGCCAGGGTG 3'). The annealing temperature of the PCR program was 63°C, and the elongation steps were for 4 min. The 3.3-kb band was gel purified and subcloned into pCR3.1 using the TA Cloning Kit (Invitrogen) and sequenced using six primer pairs designed to span the coding region according to the mouse and human HDAC5 coding sequences. Sequencing was performed by the Sequencing Facility at Albert Einstein College of Medicine.
Transfection of plasmid DNA into CHO cells
CHO cells were seeded at 1.6 x 106 per 100 mm tissue culture dish in 10 ml of
medium 10% FBS the day before transfection. For transfection, 510 µg DNA prepared with LipofectAMINE in Opti-MEM I reduced serum medium according to the manufacturer's instructions was added to cells that had been rinsed once with Opti-MEM I medium. After 6 h at 37°C in a CO2 incubator, the DNA solution was replaced with fresh
medium 10% FBS. Stable transfectants were selected for resistance to G418 (1 mg/ml active weight) or hygromycin (700 µg/ml) added the next day. At day 4, the medium was replaced with fresh selection medium and colonies picked at 810 days.
Northern blot analysis
Total RNA preparation and northern blot analysis were performed as described previously (Chen et al., 2001
). When more than one probe was used sequentially, blots were stripped by boiling in 0.1% SDS.
Lectin resistance test
To determine lectin resistance, 2000 CHO cells in
medium 10% FBS (100 µl) were added to each well of a 96-well plate. Lectins (100 µl) in
medium 10% FBS were added at increasing concentrations. After
4 days at 37°C in the 5% CO2 incubator. when control wells were confluent, the medium was removed and the cells were fixed and stained with methylene blue in 50% methanol. The D10 value was the concentration of lectin that killed 90% of the cells.
Western blot
For western blot analysis, 50 µg of whole cell lysate were separated on a 7.510% SDSPAGE under reducing conditions and transferred to polyvinylidene fluoride transfer membrane (PolyScreen, NEN Life Science Products). After blocking in 5% nonfat dry milk, first antibody was incubated with the membrane for 1.5 h at room temperature followed by washing with Tris-buffered saline ith 0.05% NP-40 five times for 5 min. Secondary antibody conjugated to horseradish peroxidase as incubated with membrane at room temperature for 1.5 h. After washing, bound antibody was visualized by incubating the membrane for 1 min with western blot chemiluminescence reagent (Renaissance, NEN Life Science).
| Acknowledgements |
|---|
Accession number: CHO Hdac5 AY145846. This work was supported by a grant from the National Institutes of Health (RO1 CA30645 to P.S.) and by partial support from Albert Einstein Cancer Center Grant PO1 13330. The authors thank Dr. Aimin Zhang for helpful discussions and reagents and Subha Sundaram for excellent technical assistance.
| Footnotes |
|---|
1 Present address: Laboratory of Biochemistry and Molecular Biology, Rockefeller University, 1230 York Ave., New York, NY, 10021-6399
2 Present address: Department of Medicine and Center for Study of the Tumor Microenvironment, Beth Israel Deaconness Medical Center and Harvard Medical School, Boston, MA, 02215 ![]()
| Abbreviations |
|---|
BSA, bovine serum albumin; CHO, Chinese hamster ovary; FBS, fetal bovine serum; GFP, green fluorescent protein; Hdac5, histone deacetylase 5; SSEA-1, stage-specific embryonic antigen-1; MFI, mean fluorescence index; Ovcov1, ovarian cancer overexpressed 1; PBS, phosphate buffered saline; PCR, polymerase chain reaction; UTR, untranslated region
| References |
|---|
|
|
|---|
Bertos, N.R., Wang, A.H., and Yang, X.J. (2001) Class II histone deacetylases: structure, function, and regulation. Biochem. Cell Biol., 79, 243252.[CrossRef][Web of Science][Medline]
Campbell, C. and Stanley, P. (1983) Regulatory mutations in CHO cells induce expression of the mouse embryonic antigen SSEA-1. Cell, 35, 303309.[CrossRef][Web of Science][Medline]
Campbell, C. and Stanley, P. (1984) The Chinese hamster ovary glycosylation mutants LEC11 and LEC12 express two novel GDP-fucose:N-acetylglucosaminide 3-alpha-L-fucosyltransferase enzymes. J. Biol. Chem., 259, 1120811214.
Castet, A., Boulahtouf, A., Versini, G., Bonnet, S., Augereau, P., Vignon, F., Khochbin, S., Jalaguier, S., and Cavailles, V. (2004) Multiple domains of the receptor-interacting protein 140 contribute to transcription inhibition. Nucleic Acids Res., 32, 19571966.
Chatterton, J.E., Hirsch, D., Schwartz, J.J., Bickel, P.E., Rosenberg, R.D., Lodish, H.F., and Krieger, M. (1999) Expression cloning of LDLB, a gene essential for normal Golgi function and assembly of the ldlCp complex. Proc. Natl Acad. Sci. USA, 96, 915920.
Chen, W., Unligil, U.M., Rini, J.M., and Stanley, P. (2001) Independent Lec1A CHO glycosylation mutants arise from point mutations in N-acetylglucosaminyltransferase I that reduce affinity for both substrates. Molecular consequences based on the crystal structure of GlcNAc-TI. Biochemistry, 40, 87658772.[CrossRef][Medline]
Cress, W.D. and Seto, E. (2000) Histone deacetylases, transcriptional control, and cancer. J. Cell Physiol., 184, 116.[CrossRef][Web of Science][Medline]
Duffield, A., Kamsteeg, E.J., Brown, A.N., Pagel, P., and Caplan, M.J. (2003) The tetraspanin CD63 enhances the internalization of the H,K-ATPase beta-subunit. Proc. Natl Acad. Sci. USA, 100, 1556015565.
Feizi, T. (1985) Carbohydrate antigens in human cancer. Cancer Surv., 4, 245269.[Web of Science][Medline]
Fischle, W., Emiliani, S., Hendzel, M.J., Nagase, T., Nomura, N., Voelter, W., and Verdin, E. (1999) A new family of human histone deacetylases related to Saccharomyces cerevisiae HDA1p. J. Biol. Chem., 274, 1171311720.
Fukuda, M.N., Ohyama, C., Lowitz, K., Matsuo, O., Pasqualini, R., Ruoslahti, E., and Fukuda, M. (2000) A peptide mimic of E-selectin ligand inhibits sialyl Lewis X-dependent lung colonization of tumor cells. Cancer Res., 60, 450456.
Fuster, M.M., Brown, J.R., Wang, L., and Esko, J.D. (2003) A disaccharide precursor of sialyl Lewis x inhibits metastatic potential of tumor cells. Cancer Res., 63, 27752781.
Grozinger, C.M., Hassig, C.A., and Schreiber, S.L. (1999) Three proteins define a class of human histone deacetylases related to yeast Hda1p. Proc. Natl Acad. Sci. USA, 96, 48684873.
Hakomori, S. (2001) Tumor-associated carbohydrate antigens defining tumor malignancy: basis for development of anti-cancer vaccines. Adv. Exp. Med. Biol., 491, 369402.[Web of Science][Medline]
Hassig, C.A., Tong, J.K., Fleischer, T.C., Owa, T., Grable, P.G., Ayer, D.E., and Schreiber, S.L. (1998) A role for histone deacetylase activity in HDAC1-mediated transcriptional repression. Proc. Natl Acad. Sci. USA, 95, 35193524.
Hemler, M.E. (2003) Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annu. Rev. Cell Dev. Biol., 19, 397422.[CrossRef][Web of Science][Medline]
Hiller, K.M., Mayben, J.P., Bendt, K.M., Manousos, G.A., Senger, K., Cameron, H.S., and Weston, B.W. (2000) Transfection of alpha(1,3) fucosyltransferase antisense sequences impairs the proliferative and tumorigenic ability of human colon carcinoma cells. Mol. Carcinog., 27, 280288.[CrossRef][Web of Science][Medline]
Holmes, E.H., Ostrander, G.K., and Hakomori, S. (1985) Enzymatic basis for the accumulation of glycolipids with X and dimeric X determinants in human lung cancer cells (NCI-H69). J. Biol. Chem., 260, 76197627.
Howard, D.R., Fukuda, M., Fukuda, M.N., and Stanley, P. (1987) The GDP-fucose:N-acetylglucosaminide 3-alpha-L-fucosyltransferases of LEC11 and LEC12 Chinese hamster ovary mutants exhibit novel specificities for glycolipid substrates. J. Biol. Chem., 262, 1683016837.
Ishida, N., and Kawakita, M. (2004) Molecular physiology and pathology of the nucleotide sugar transporter family (SLC35). Pflugers Arch., 447, 768775.[CrossRef][Web of Science][Medline]
Kannagi, R. (2001) Transcriptional regulation of expression of carbohydrate ligands for cell adhesion molecules in the selectin family. Adv. Exp. Med. Biol., 491, 267278.[Web of Science][Medline]
Lai, C.H., Chou, C.Y., Ch'ang, L.Y., Liu, C.S., and Lin, W. (2000) Identification of novel human genes evolutionarily conserved in Caenorhabditis elegans by comparative proteomics. Genome Res., 10, 703713.
Leach, R., Duniec-Dmuchowski, Z., Tanaka, T., Ko, M.S., and Krawetz, S.A. (2001) Assignment of OVCOV1 (alias CGI-15) to human chromosome 20 band q13.1
q13.2 by fluorescent in situ hybridization. Cytogenet. Cell Genet., 94, 252253.[CrossRef][Web of Science][Medline]
Leach, R.E., Duniec-Dmuchowski, Z.M., Pesole, G., Tanaka, T.S., Ko, M.S., Armant, D.R., and Krawetz, S.A. (2002) Identification, molecular characterization, and tissue expression of OVCOV1. Mamm. Genome, 13, 619624.[CrossRef][Web of Science][Medline]
Lemercier, C., Verdel, A., Galloo, B., Curtet, S., Brocard, M.P., and Khochbin, S. (2000) mHDA1/HDAC5 histone deacetylase interacts with and represses MEF2A transcriptional activity. J. Biol. Chem., 275, 1559415599.
Lowe, J.B. (1997) Selectin ligands, leukocyte trafficking, and fucosyltransferase genes. Kidney Int., 51, 14181426.[Web of Science][Medline]
Lowe, J.B. (2003) Glycan-dependent leukocyte adhesion and recruitment in inflammation. Curr. Opin. Cell. Biol., 15, 531538.[CrossRef][Web of Science][Medline]
Mahmudi-Azer, S., Downey, G.P., and Moqbel, R. (2002) Translocation of the tetraspanin CD63 in association with human eosinophil mediator release. Blood, 99, 40394047.
Mas, E., Pasqualini, E., Caillol, N., El Battari, A., Crotte, C., Lombardo, D., and Sadoulet, M.O. (1998) Fucosyltransferase activities in human pancreatic tissue: comparative study between cancer tissues and established tumoral cell lines. Glycobiology, 8, 605613.
Okajima, T. and Irvine, K.D. (2002) Regulation of notch signaling by o-linked fucose. Cell, 111, 893904.[CrossRef][Web of Science][Medline]
Phillips, M.L., Nudelman, E., Gaeta, F.C., Perez, M., Singhal, A.K., Hakomori, S., and Paulson, J.C. (1990) ELAM-1 mediates cell adhesion by recognition of a carbohydrate ligand, sialyl-Lex. Science, 250, 11301132.
Potvin, B. and Stanley, P. (1991) Activation of two new alpha(1,3) fucosyltransferase activities in Chinese hamster ovary cells by 5-azacytidine. Cell Reg., 2, 9891000.[Web of Science][Medline]
Raju, T.S., Ray, M.K., and Stanley, P. (1995) LEC18, a dominant Chinese hamster ovary glycosylation mutant synthesizes N-linked carbohydrates with a novel core structure. J. Biol. Chem., 270, 3029430302.
Rous, B.A., Reaves, B.J., Ihrke, G., Briggs, J.A., Gray, S.R., Stephens, D.J., Banting, G., and Luzio, J.P. (2002) Role of adaptor complex AP-3 in targeting wild-type and mutated CD63 to lysosomes. Mol. Biol. Cell, 13, 10711082.
Saitoh, O., Wang, W.-C., Lotan, R., and Fukuda, M. (1992) Differential glycosylation and cell surface expression of lysosomal membrane glycoproteins in sublines of a human colon cancer exhibiting distinct metastatic potentials. J. Biol. Chem., 267, 57005711.
Sasamura, T., Sasaki, N., Miyashita, F., Nakao, S., Ishikawa, H.O., Ito, M., Kitagawa, M., Harigaya, K., Spana, E., Bilder, D., and others. (2003) Neurotic, a novel maternal neurogenic gene, encodes an O-fucosyltransferase that is essential for Notch-Delta interactions. Development, 130, 47854795.
Shi, S. and Stanley, P. (2003) Protein O-fucosyltransferase 1 is an essential component of Notch signaling pathways. Proc. Natl Acad. Sci. USA, 100, 52345239.
Skubitz, K.M., Campbell, K.D., Iida, J., and Skubitz, A.P. (1996) CD63 associates with tyrosine kinase activity and CD11/CD18, and transmits an activation signal in neutrophils. J. Immunol., 157, 36173626.[Abstract]
Smith, D.A., Monk, P.N., and Partridge, L.J. (1995) Antibodies against human CD63 activate transfected rat basophilic leukemia (RBL-2H3) cells. Mol. Immunol., 32, 13391344.[CrossRef][Web of Science][Medline]
Stanley, P., Caillibot, V., and Siminovitch, L. (1975) Selection and characterization of eight phenotypically distinct lines of lectin-resistant Chinese hamster ovary cell. Cell, 6, 121128.[CrossRef][Web of Science][Medline]
Sturla, L., Rampal, R., Haltiwanger, R.S., Fruscione, F., Etzioni, A., and Tonetti, M. (2003) Differential terminal fucosylation of N-linked glycans versus protein O-fucosylation in leukocyte adhesion deficiency type II (CDG IIc). J. Biol. Chem., 278, 2672726733.
Verdel, A. and Khochbin, S. (1999) Identification of a new family of higher eukaryotic histone deacetylases. Coordinate expression of differentiation-dependent chromatin modifiers. J. Biol. Chem., 274, 24402445.
Vogt, A.B., Spindeldreher, S., and Kropshofer, H. (2002) Clustering of MHC-peptide complexes prior to their engagement in the immunological synapse: lipid raft and tetraspan microdomains. Immunol. Rev., 189, 136151.[CrossRef][Web of Science][Medline]
Watamoto, K., Towatari, M., Ozawa, Y., Miyata, Y., Okamoto, M., Abe, A., Naoe, T., and Saito, H. (2003) Altered interaction of HDAC5 with GATA-1 during MEL cell differentiation. Oncogene, 22, 9176184.[CrossRef][Web of Science][Medline]
Zhang, A. (1998) Organization and regulation of Chinese hamster
(1,3)fucosyltransferase genes. Ph.D. thesis. Albert Einstein College of Medicine, Bronx, NY.
Zhang, A., Potvin, B., Zaiman, A., Chen, W., Kumar, R., Phillips, L., and Stanley, P. (1999) The gain-of-function Chinese hamster ovary mutant LEC11B expresses one of two Chinese hamster FUT6 genes due to the loss of a negative regulatory factor. J. Biol. Chem., 274, 1043910450.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
O. W. Liu, M. J. S. Kelly, E. D. Chow, and H. D. Madhani Parallel {beta}-Helix Proteins Required for Accurate Capsule Polysaccharide Synthesis and Virulence in the Yeast Cryptococcus neoformans Eukaryot. Cell, April 1, 2007; 6(4): 630 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Helmus, J. Denecke, S. Yakubenia, P. Robinson, K. Luhn, D. L. Watson, P. J. McGrogan, D. Vestweber, T. Marquardt, and M. K. Wild Leukocyte adhesion deficiency II patients with a dual defect of the GDP-fucose transporter Blood, May 15, 2006; 107(10): 3959 - 3966. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







