Glycobiology Advance Access originally published online on September 29, 2004
Glycobiology 2005 15(2):193-201; doi:10.1093/glycob/cwh159
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology vol. 15 no. 2 © Oxford University Press 2005; all rights reserved.
Molecular cloning of two Arabidopsis UDP-galactose transporters by complementation of a deficient Chinese hamster ovary cell line
3 Plant Research International, Wageningen University and Research Centre, P.O.Box 16, 6700AA, Wageningen, The Netherlands; 4 Zelluläre Chemie, Medizinische Hochschule Hannover, Carl-Neuberg-Strasse 1, 30625 Hannover, Germany; and 5 Institute of Food Safety (RIKILT), Wageningen University and Research Centre, P.O. Box 230, 6700AE Wageningen, The Netherlands
2 To whom correspondence should be addressed; e-mail: bakker.hans{at}mh-hannover.de
Received on July 16, 2004; revised on September 21, 2004; accepted on September 23, 2004
| Abstract |
|---|
|
|
|---|
Nucleotide-sugar transporters (NSTs) form a family of structurally related transmembrane proteins that transport nucleotide-sugars from the cytoplasm to the endoplasmic reticulum and Golgi lumen. In these organelles, activated sugars are substrates for various glycosyltransferases involved in oligo- and polysaccharide biosynthesis. The Arabidopsis thaliana genome contains more than 40 members of this transporter gene family, of which only a few are functionally characterized. In this study, two Arabidopsis UDP-galactose transporter cDNAs (UDP-GalT1 and UDP-GalT2) are isolated by expression cloning using a Chinese hamster ovary cell line (CHO-Lec8) deficient in UDP-galactose transport. The isolated genes show only 21% identity to each other and very limited sequence identity with human and yeast UDP-galactose transporters and other NSTs. Despite this low overall identity, the two proteins clearly belong to the same gene family. Besides complementing Lec8 cells, the two NSTs are shown to transport exclusively UDP-galactose by an in vitro NST assay. The most homologous proteins with known function are plant transporters that locate in the inner chloroplast membrane and transport triose-phosphate, phosphoenolpyruvate, glucose-6-phosphate, and xylulose 5-phosphate. Also, the latter proteins are members of the same family, which therefore has been named the NST/triose-phosphate transporter family.
Key words: cell wall / expression cloning / Golgi / membrane / nucleotide-sugar transporter
| Introduction |
|---|
|
|
|---|
Many glycosyltransferases involved in oligo- and polysaccharide biosynthesis in the endoplasmic reticulum (ER) and Golgi use nucleotide-activated sugar donors as substrates. Most nucleotide-sugars are synthesized in the cytoplasm or, in the case of CMPsialic acid, in the cell nucleus (Münster et al., 1998
By database searches, a large number of NST-TPT family members can be identified in all eukaryotes. For example, 16 genes can be found in the complete genome of Caenorhabditis elegans (Gerardy-Schahn and Eckhardt, 2004
) and more than 40 in the Arabidopsis genome. The level of sequence identity between members in the NST family is not an indication of the transporter specificity. Mammalian UDP-GlcNAc transporters, for example, show a higher identity with mammalian UDP-Gal and CMPsialic acid transporters than with the yeast UDP-GlcNAc transporter. On the other hand, the human and C. elegans GDP-Fuc transporter are relatively well conserved (Lühn et al., 2001
). The same is true for GDP-Man transporters; the Arabidopsis transporter could be identified using the yeast GDP-Man transporter sequence (Baldwin et al., 2001
). A second Arabidopsis NST has been cloned based on homology to UDP-Gal-transporter-related 1 (Ishida et al., 1996
), a human NST family member without known function. This transporter has been shown to transport UDP-Glc and UDP-Gal (Norambuena et al. 2002
). Except for NSTs that transport GDP-activated sugars, prediction of activity seems to be impossible for the many potential Arabidopsis NSTs. Therefore we used expression cloning in Chinese hamster ovary (CHO) cells of the genetic complementation group Lec8 to isolate Arabidopsis cDNAs that encode UDP-Gal transport activities. Two cDNA clones that are able to complement the genetic defect in Lec8 cells and transport UDP-Gal in an in vitro transport assay are described in this study.
| Results |
|---|
|
|
|---|
Expression cloning of Arabidopsis UDP-Gal transporters
CHO Lec8 cells (Deutscher and Hirschberg, 1986
|
An Arabidopsis cDNA library was constructed in the mammalian expression vector pABE (Bakker et al., 1999
|
Based on the isolated cDNA, polymerase chain reaction (PCR) primers were designed and used to screen all 24 pools of the original cDNA library. Surprisingly only 8 out of the 17 pools that were positive in the complementation experiments allowed the amplification of a specific PCR product. The sibling selection procedure was then repeated with one of the remaining positive pools (no. 16) and led to the isolation of a second cDNA clone (UDP-GalT2). Again, PCR primers were deduced from UDP-GalT2 and used to screen the remaining complementing pools, which all were found to be positive. Control transfections of the cloned cDNAs into CHO Lec2 cells deficient in CMPsialic acid transport, did not restore the wild-type phenotype. These data exclude that the isolated clones are general NSTs, or factors, which, due to overexpression, interfere with the integrity of the compartment membranes.
UDP-GalT1 and UDP-GalT2 are selective UDP-Gal transporters
To confirm the nature and transport specificity of the obtained genes an in vitro transport assay was carried out. The cDNA clones were expressed in the yeast Saccharomyces cerevisiae. Golgi vesicles isolated from nontransformed S. cerevisiae cells are known to exhibit a high transport activity for GDP-Man and lower activities for UDP-Glc, UDP-GlcNAc, and GDP-Fuc. Transport of other nucleotide-sugars is absent. S. cerevisiae is therefore a low background eukaryotic expression system to assay most NST activities (Berninsone et al., 1997
).
Golgi-enriched vesicles from UDP-GalT1, UDP-GalT2, and empty vector transformed yeast cells were isolated and in vitro tested for transport activity with a panel of commercially available radiolabeled nucleotide-sugars (Figure 3), with the exception GDP-Man, because the background of GDP-Man transport is too high in yeast. As expected, vesicles isolated from mock-transformed cells demonstrate specific transport for UDP-Glc, GDP-Fuc, and UDP-GlcNAc. Vesicles expressing UDP-GalT1 or UDP-GalT2 show a specific increase in UDP-Gal transport (
a factor of 10 compared to empty vector transformed yeast), and no significant change was observed with the other nucleotide sugars. These data clearly identify the cloned cDNAs as UDP-Gal transporters. Moreover, it demonstrates that the plant transporters are more restricted in substrate use than the human UDP-Gal transporter, shown to be equally active with UDP-GalNAc (Segawa et al., 2002
).
|
Homology of the UDP-GalTs to other members of the NST-TPT family
Predicted translation products of the newly isolated cDNAs mutually have only 20.8% sequence identity, and with the human UDP-Gal transporter the degree of identity is reduced to 13.4 and 12.7% for UDP-GalT1 and 2, respectively. The closest related proteins of known function are the inner chloroplast membrane transporters TPT, PPT, GPT, and XPT (Eicks et al., 2002
In Figure 4, an alignment of UDP-GalT1 and 2 with a selection of other transporters is shown. The human UDP-Gal transporter has been included to compare transporters with similar specificity and the human CMPsialic acid transporter, for which the membrane topology has been determined experimentally (Eckhardt et al., 1999
), to support the annotation of transmembrane domains. A member of the TPT family (PPT) and the Arabidopsis GDP-Man and human GDP-Fuc transporters were included in the alignment because they are closest to the cloned UDP-Gal transporters. The Arabidopsis UDP-Glc/Gal and yeast UDP-GlcNAc transporters are members of a separate subfamily within the NST-TPT family and thus were selected as most distant members of the family. Despite the low overall identity at the amino acid level, predicted transmembrane helices of UDP-GalT1 and 2 align very well with those of other transporters (Figure 4). When TMDs are predicted using the sequences in a multiple alignment, 10 helices are predicted for all family members shown in Figure 4 at similar places as determined for the CMPsialic acid transporter (Eckhardt et al., 1999
). In addition an alignment of the complete NST-TPT family identified five amino acid positions within transmembrane helices 5, 6, and 10 that are highly conserved in the sequences. The alignment does not, however, allow the deduction of UDP-Gal transporterspecific amino acid residues.
|
In a phylogenetic tree (Figure 5) composed of all Arabidopsis proteins predicted from the genome sequence that could be assigned to the NST-TPT family, UDP-GalT1 and 2 form a branch with the TPT family. To limit the number of proteins in the phylogenetic tree, other plant sequences were not included, and from other species only members with a known function were selected. Although the exact tree might look different depending on the included sequences, the overall organization is always similar, showing UDP-GalT1 and 2 in association with the chloroplast transporters (TPT family). These plant branches in combination are connected to a branch containing transporters from many different species including the GDP-Man and GDP-Fuc transporters and the multisubstrate UDP-sugar transporters, Dm-frc (Goto et al., 2001
|
Expression levels of UDP-GalT1, UDP-GalT2, and other NSTs
Microarray data (Figure 6) from the Nottingham Arabidopsis Stock Centre show that both UDP-GalTs have quite invariable expression levels in different tissues and treatments used in various experiments. The same counts for the GDP-Man transporter, whereas the dual UDP-Glc/Gal transporter shows a much higher variation in expression level. The latter is, for example, relatively abundant in suspension culture. The exception is the expression in pollen. Although UDP-GalT2 shows relatively low expression in pollen, the expression of UDP-GalT1 is only low in mature pollen (5 and 6 in Figure 6) and actually relatively high in developing pollen (14 in Figure 6). Remarkable is that GDP-ManT and UDP-Glc/GalT show the exact opposite. UDP-Glc/GalT even shows the highest expression level in mature pollen.
|
| Discussion |
|---|
|
|
|---|
Based on sequence information, it would not have been possible to identify UDP-Gal transporters among the numerous Arabidopsis members of the NST-TPT family. By the presented expression cloning strategy in the CHO cell mutant Lec8, two UDP-Gal transporters have been identified. Because each positive subpool of the silique cDNA library was found to contain one or both of the cloned UDP-Gal transporters in a PCR-based assay, it can be concluded that there were no other highly expressed UDP-Gal transporters present in this library. Nevertheless, this does not exclude that other members of the Arabidopsis NST-TPT family encode for UDP-Gal transporters. The UDP-Glc/GalT cloned by Norambuena et al. (2002)
Initially NSTs were thought to be specific for one substrate. However, human (Muraoka et al., 2001
), C. elegans (Berninsone et al., 2001
), and Drosophila (Goto et al., 2002; Selva et al., 2002) NSTs that transport various UDP-activated sugars have been cloned. Although the three multisubstrate NSTs can be considered orthologs, they differ in the kind and number of UDP-activated sugars that are transported. Moreover, the human UDP-Gal transporter, long thought to be monospecific, has been shown to transport UDP-GalNAc (Segawa et al., 2002
) in an in vitro transport assay after heterologous expression in yeast. Hence, there are probably monospecific and multispecific transporters. In addition, as shown here, within one species, different transporters that can use identical activated sugars can be found. We have shown that in contrast to the UDP-Gal and UDP-Glc transporting Arabidopsis NST cloned by Norambuena et al. (2002)
, UDP-GalT1 and 2 are monospecific transporters. However, there are several other nucleotide-sugars that are not commercially available in radioactive form, such as UDP-galacturonic acid or UDP-arabinose, and therefore can not be assayed in vitro.
Previously sequence identity has been observed between GDP-Man transporters and the chloroplast GPT, TPT, and PPT (Ma et al., 1997
). The identification of two Arabidopsis UDP-Gal transporters with higher identity to the chloroplast transporters than to any other protein with known function indicates that these chloroplast transporters are clearly members of the same gene family. In Figure 4, a selection of relevant members of the NST-TPT family is aligned with the cloned Arabidopsis UDP-Gal transporters. Remarkably, no motif specific for UDP-Gal can be identified in this alignment, neither in a domain involved in substrate recognition in other transporters (Gao et al., 2001
; Knappe et al., 2003
) nor any other region. The alignment again shows that except for GDP-sugar transporters, primary sequence homology has low predictive value for the transport specificity. In a phylogenetic tree sequences generally align according to the phylogeny of species rather than according to function (Berninsone and Hirschberg, 2000
). One of the exceptions is the relatively high identity between the yeast and mammalian UDP-Gal transporters. However this cannot be extended to plants. There are numerous plant members of the NST-TPT family with higher identity to the mammalian/yeast UDP-Gal transporters than to the two cloned Arabidopsis NSTs. This suggests that the Arabidopsis UDP-Gal transporters have a different evolutionary origin within the NST-TPT family than the mammalian/yeast UDP-Gal transporters.
Due to the large number of putative NSTs, it is not surprising to find more than one UDP-Gal transporter, and more redundancy is expected in this family. Most known members of this family that are localized in the ER-Golgi system are NSTs. One exception is the 3'-phosphate 5'-phosphosulfate (PAPS) transporter (Kamiyama et al., 2003
; Luders et al., 2003
). Thus, on the other hand, it is very well possible that beside nucleotide-sugars and PAPS other compounds, like sugar-phosphates, are transported in the ER or Golgi by members of the NST-TPT family.
In Figure 5, all Arabidopsis members of the NST-TPT family that could be identified in the genome database are organized in a phylogenetic tree. Many homologs can of course be found in other plants, but yeast and animal proteins with and without known function are spread over the phylogenetic tree, also in the branch containing UDP-GalT1 and 2 (not shown). The fact that animal and plant sequences are mixed in all major branches of the tree suggests that all have a long evolutionary history. The purine-transporter-like and the nodulin-protein-like family are two other eukaryotic gene families within the drug/metabolite transporter superfamily (Jack et al., 2001
) that are close to the NST-TPT family. The purine transporter (Gillissen et al., 2000
) is localized to the cell surface membrane, whereas Medicago truncatula nodulin protein 21, a protein induced during nodulation (Gamas et al., 1996
) and after which the nodulin-like family is named, has an unknown cellular localization. Both probably share the 10 TMD topology with the NST-TPT family, and the conserved amino acids indicated in Figure 4 are also found in these families. The nodulin-like family forms the evolutionary link between bacterial and eukaryotic members, including the NST-TPT family, of the drug/metabolite transporter superfamily (Jack et al., 2001
). It is likely that the conserved amino acids are involved in structural properties of the proteins because glycine residues are thought to play a greater role in maintaining the structure of a protein than in binding of substrates (Betts and Russell, 2003
).
Experimentally, the transmembrane topology of the CMPsialic acid transporter has been determined (Eckhardt et al., 1999
). A model with 10 domains and both N- and C-terminus at the cytoplasmic side of the Golgi membrane has been proposed. In many other members of the NST-TPT family 10 TMDs are predicted by prediction programs (Tusnady and Simon, 1998
, 2001
) (www.enzim.hu/hmmtop), but in others not all 10 are predicted. Due to the conservation within the NST-TPT family, it is most probable that the 10 TMD topology is a characteristic of most if not all members of the NST-TPT family.
| Materials and methods |
|---|
|
|
|---|
Materials
The CHO cell line CHOP8, a Lec8 cell line stable transformed with the polyoma virus large T antigen (Cummings et al., 1993
S. cerevisiae strain YPH500 (MAT
ura3-52 lys2-801 ade2-101 trp1-
63 his3-
200 leu2-
1) was used for all yeast expression experiments. The copper-inducible yeast expression vector pYEX-BESN, modified from clontech as described in Segawa et al. (2002)
was a generous gift of Dr. Masao Kawakita (Tokyo Metropolitan Institute of Medical Science). Radioactive nucleotide-sugars UDP-[1-3H]Glc, UDP-[1-3H]Gal, UDP-[6-3H]GlcNAc, UDP-[1-3H]GalNAc, GDP-[2-3H]Fuc, CMP-[9-3H]NeuAc, UDP-[14C (U)]GlcA, and UDP-[14C (U)]Xyl were purchased from NEM Life Science Products (Boston, MA). Zymolyase 100T was obtained from ICN Biomedicals (OH).
Construction of epitope-tagged transporters for yeast expression
For yeast expression the following sequences: GGATCC(BamHI)ACC-UDP-GalT1-GGATCC(BamHI)TACCCTTATGACGTCCCCGATTACGCCTGAGCGGCCGC(NotI) and GGATCT(BamHI/BglII)ACC-UDP-GalT2-TCTAGA(XbaI)TACCCTTATGACGTCCCCGATTACGCCTGAGCGGCCGC(NotI), containing the full open reading frames, including the start codon but without stop, followed by a sequence encoding the C-terminal HA-tag (YPYDVPDYA), were introduced into the BamHI-NotI site of pYEX-BESN.
Transient transfection of CHO cells
CHOP8 cells were grown in
-MEM with 2% fetal calf serum, 8% newborn serum, and penicillin/streptomycin (all from Life Technologies, Grand Island, NY). Cells were plated in six-well (9.6-cm2) plates; on day 2 the confluent cell layer was transfected using a DEAE-Dextran (Pharmacia, Uppsala, Sweden) transfection method (Bakker et al., 1997
; Kluxen and Lubbert, 1993
). For each well 2 µg plasmid DNA of a cDNA library pool and 1 µg of the plasmid containing the glucuronyltransferase cDNA was used. Medium was replaced on day 3. On day 4, cells were washed with Tris-buffered saline, 2.5% glutarealdehyde-fixed and blocked in 2% milk powder/Tris-buffered saline. Cells were stained with mAb L2-412 in the same solution, followed by an alkaline phosphataseconjugated secondary antibody. For color development Fast-Red (Sigma, St. Louis, MO) substrate was used. Plates were analyzed under a normal light microscope, and red cells per plate were scored.
Original pools of the cDNA library containing 5001000 different clones were kept as E. coli glycerol stocks. For the initial screening plasmid DNA was isolated from 10 combined pools. For the second round screening, plasmid DNA from the original pools was used. For further sibling selection, bacteria from the glycerol stock were again plated and 4 x 384 colonies were picked and grown in 384-well microtiter plates. Plasmid was isolated from combined cells from each plate and transfected to CHO cells. From a positive plate, columns and rows were screened to determine the positive clone.
Yeast transformation, vesicle preparation, and transport assays
Transformations were done according a protocol provided with pYES vectors from Invitrogen (Carlsbad, CA). Transformants were cultured on selective medium containing 0.67% bacto-yeast nitrogen base without amino acids supplemented with L-leucine, L-histidine, L-tryptophan, L-lysine, adenine, and 2% glucose. Cells were cultured to a density of 0.8 A600, and copper sulfate was added at a final concentration of 0.5 mM at 2 h before harvest.
Subcellular fractionation and in vitro transport assay were essentially performed as previously described (Aoki et al., 2001
; Segawa et al., 2002
). Cells were harvested by centrifugation 5 min at 1500 x g and washed twice with ice-cold 10 mM NaN3. The pellet volume was measured and resuspended in three volumes of zymolyase buffer (50 mM KPO4 pH 7.5; 1.4 M sorbitol; 10 mM NaN3; and 0.3% ß-mercaptoethanol) containing 2.0 mg Zymolyase-100T (ICN, Irvine, CA) per gram of cells and incubated at 37°C for 20 min. The spheroplasts were collected by centrifugation (5 min 1000 x g) and lysed by resuspending in four volumes of lyses buffer (10 mM HEPES-Tris, pH 7.4; 0.8 M sorbitol; 1 mM ethylenediamine tetra-acetic acid) containing a protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN). After homogenization with 10 strokes in a Dounce, the lysate was centrifuged (5 min at 1500 x g) to remove unlysed cells and debris. The supernatant was separated in two fractions (Goud et al. 1988
) by centrifugation first at z10,000 x g for 10 min (ER rich fraction) followed by centrifugation of the 10,000 x g supernatant at 100,000 x g for 1 h (Golgi rich fraction). The 100,000 x g pellet was resuspended in lyses buffer (0.8 ml/g cells). Aliquots (100 µl) of the vesicle preparation were snap frozen and kept at 80°C. The protein concentrations were determined by using BCA assay from Pierce (Rockford, IL).
Transport assay reactions were started by addition of 50 µl 2 µM radioactive nucleotide-sugar (20004000 dpm/pmol); 10 mM TrisHCl, pH 7.0; 0.8 M sorbitol; 2 mM MgCl2) to 50 µl vesicle preparation (75100 µg protein equivalent) and was incubated at 30°C for 30 s. The reaction stopped by dilution with 1 ml of 10 mM TrisHCl, pH 7.0; 0.8 M sorbitol; 2 mM MgCl2 containing 1 µM cold nucleotide-sugar. Separation of vesicles and nucleotide-sugar was performed by filtration trough nitrocellulose filter (MFtm-Membrane Filters, Millipore, Bedford, MA). Radioactivity associated with the microsomes retained by the filter was then measured by liquid scintillation in a Beckman counter. Membranes prepared from yeast transformed with an empty vector were used to measure endogenous transport. The transport of UDP-glucose (endogenous UDP-Glc) was used as a control for quality of membrane vesicles. Transport was expressed in pmol transported nucleotide-sugars per min per mg total protein (pmol/min/mg).
Two independent experiments using different membrane preparations were carried for each expressed construct. For each experiment all different nucleotide-sugars were assayed in duplicate with the same vesicle preparation.
Multiple alignments, TMD prediction, and phylogeny
Arabidopsis members of the NST-TPT family were identified by WU-BLAST2 searches in the Arabidopsis genomic sequence data at TAIR (www.arabidopsis.org) using various known members of the NST-TPT family as input. Searches were done at protein level and limited to the proteins predicted from the genomic sequence.
Multiple alignments were done using the online CLUSTAL W program at EBI (www.ebi.ac.uk/clustalw) using default settings. N-terminal chloroplast targeting signals were excluded in the alignments as well as some other long N-terminal extensions in other proteins. The alignment in Figure 4 was modified slightly by hand; all gaps introduced close to the N- and C-terminus were removed. Based on these CLUSTAL W results, average distance trees were made in Jalview. TMDs were predicted using the online prediction program HMMTOP (www.enzim.hu/hmmtop) (Tusnady and Simon, 1998
, 2001
). Predictions were done using all sequences in a multiple alignment.
| Acknowledgements |
|---|
The authors would like to thank Dr. James Dennis for CHOP8 cells, Dr. Toshisuke Kawasaki for the glucuronyltransferase clone and Dr. Masao Kawakita for vector pYEX-BESN. The research carried out at Plant Research International was financially supported by a concern-SEO-grant and at the MH-Hannover by the Fonds der Chemischen Industrie and the Deutsche Forschungsgemeinschaft. GenBank accession numbers: UDP-GalT1: AJ633720 [GenBank] and UDP-GalT2: AJ633721 [GenBank] .
| Footnotes |
|---|
1 These authors contributed equally to this work.
| Abbreviations |
|---|
CHO, Chinese hamster ovary; ER, endoplasmic reticulum; GPT, glucose-6-phosphate transporter; mAb, monoclonal antibody; NST, nucleotide-sugar transporter; PAPS, 3'-phosphate-5'-phosphosulfate; PCR, polymerase chain reaction; PPT, phosphoenolpyruvate transporter; TMD, transmembrane domain; TPT, triose-phosphate transporter; XPT, xylulose-5-phosphate transporter
| References |
|---|
|
|
|---|
Abeijon, C., Robbins, P.W., and Hirschberg, C.B. (1996) Molecular cloning of the Golgi apparatus uridine diphosphate-N-acetylglucosamine transporter from Kluyveromyces lactis. Proc. Natl Acad. Sci. USA, 93, 59635968.
Aoki, K., Ishida, N., and Kawakita, M. (2001) Substrate recognition by UDP-galactose and CMP-sialic acid transporters. Different sets of transmembrane helices are utilized for the specific recognition of UDP-galactose and CMP-sialic acid. J. Biol. Chem., 276, 2155521561.
Bakker, H., Friedmann, I., Oka, S., Kawasaki, T., Nifant'ev, N., Schachner, M., and Mantei, N. (1997) Expression cloning of a cDNA encoding a sulfotransferase involved in the biosynthesis of the HNK-1 carbohydrate epitope. J. Biol. Chem., 272, 2994229946.
Bakker, H., Lommen, A., Jordi, W., Stiekema, W., and Bosch, D. (1999) An Arabidopsis thaliana cDNA complements the N-acetylglucosaminyltransferase I deficiency of CHO Lec1 cells. Biochem. Biophys. Res. Commun., 261, 829832.[CrossRef][Web of Science][Medline]
Bakker, H., Schijlen, E., de Vries, T., Schiphorst, W.E., Jordi, W., Lommen, A., Bosch, D., and van, D., I (2001) Plant members of the
1
3/4-fucosyltransferase gene family encode an
1
4-fucosyltransferase, potentially involved in Lewis(a) biosynthesis, and two core
1
3-fucosyltransferases. FEBS Lett., 507, 307312.[CrossRef][Web of Science][Medline]
Baldwin, T.C., Handford, M.G., Yuseff, M.I., Orellana, A., and Dupree, P. (2001) Identification and characterization of GONST1, a golgi-localized GDP-mannose transporter in Arabidopsis. Plant Cell, 13, 22832295.
Berninsone, P.M. and Hirschberg, C.B. (2000) Nucleotide sugar transporters of the Golgi apparatus. Curr. Opin. Struct. Biol., 10, 542547.[CrossRef][Web of Science][Medline]
Berninsone, P., Eckhardt, M., Gerardy-Schahn, R., and Hirschberg, C.B. (1997) Functional expression of the murine Golgi CMP-sialic acid transporter in Saccharomyces cerevisiae. J. Biol. Chem., 272, 1261612619.
Berninsone, P., Hwang, H.Y., Zemtseva, I., Horvitz, H.R., and Hirschberg, C.B. (2001) SQV-7, a protein involved in Caenorhabditis elegans epithelial invagination and early embryogenesis, transports UDP-glucuronic acid, UDP-N-acetylgalactosamine, and UDP-galactose. Proc. Natl Acad. Sci. USA, 98, 37383743.
Betts, M.J. and Russell, R.B. (2003) Amino acid properties and consequences of subsitutions. In Barnes, M.R. and Gray, I.C. (Eds.), Bioinformatics for geneticists. Wiley, New York.
Capasso, J.M. and Hirschberg, C.B. (1984) Mechanisms of glycosylation and sulfation in the Golgi apparatus: evidence for nucleotide sugar/nucleoside monophosphate and nucleotide sulfate/nucleoside monophosphate antiports in the Golgi apparatus membrane. Proc. Natl Acad. Sci. USA, 81, 70517055.
Cummings, L., Warren, C.E., Granovsky, M., and Dennis, J.W. (1993) Antisense and sense cDNA expression cloning using autonomously replicating vectors and toxic lectin selection. Biochem. Biophys. Res. Commun., 195, 814822.[CrossRef][Web of Science][Medline]
Deutscher, S.L. and Hirschberg, C.B. (1986) Mechanism of galactosylation in the Golgi apparatus. A Chinese hamster ovary cell mutant deficient in translocation of UDP-galactose across Golgi vesicle membranes. J. Biol. Chem., 261, 96100.
Eckhardt, M., Mühlenhoff, M., Bethe, A., and Gerardy-Schahn, R. (1996) Expression cloning of the Golgi CMP-sialic acid transporter. Proc. Natl Acad. Sci. USA, 93, 75727576.
Eckhardt, M., Gotza, B., and Gerardy-Schahn, R. (1999) Membrane topology of the mammalian CMP-sialic acid transporter. J. Biol. Chem., 274, 87798787.
Eicks, M., Maurino, V., Knappe, S., Flügge, U.I., and Fischer, K. (2002) The plastidic pentose phosphate translocator represents a link between the cytosolic and the plastidic pentose phosphate pathways in plants. Plant Physiol., 128, 512522.
Fischer, K., Kammerer, B., Gutensohn, M., Arbinger, B., Weber, A., Hausler, R.E., and Flügge, U.I. (1997) A new class of plastidic phosphate translocators: a putative link between primary and secondary metabolism by the phosphoenolpyruvate/phosphate antiporter. Plant Cell, 9, 453462.[Abstract]
Flügge, U.I. (1998) Metabolite transporters in plastids. Curr. Opin. Plant Biol., 1, 201206.[CrossRef][Web of Science][Medline]
Gamas, P., Niebel, F.C., Lescure, N., and Cullimore, J. (1996) Use of a subtractive hybridization approach to identify new Medicago truncatula genes induced during root nodule development. Mol. Plant Microbe Interact., 9, 233242.[Web of Science][Medline]
Gao, X.D., Nishikawa, A., and Dean, N. (2001) Identification of a conserved motif in the yeast golgi GDP-mannose transporter required for binding to nucleotide sugar. J. Biol. Chem., 276, 44244432.
Gerardy-Schahn, R. and Eckhardt, M. (2004) Nucleotide-sugar transporters. In Ernst, S., Hart, G.W., & Sinaÿ, P. (Eds.), Oligosaccharides in chemistry and biology: a comprehensive handbook Vol II Biology of saccharides. Wiley, New York, pp. 1936.
Gillissen, B., Bürkle, L., André, B., Kühn, C., Rentsch, D., Brandl, B., and Frommer, W.B. (2000) A new family of high-affinity transporters for adenine, cytosine, and purine derivatives in Arabidopsis. Plant Cell, 12, 291300.
Goto, S., Taniguchi, M., Muraoka, M., Toyoda, H., Sado, Y., Kawakita, M., and Hayashi, S. (2001) UDP-sugar transporter implicated in glycosylation and processing of Notch. Nat. Cell Biol., 3, 816822.[CrossRef][Web of Science][Medline]
Goud, B., Salminen, A., Walworth, N.C., and Novick, P.J. (1988) A GTP-binding protein required for secretion rapidly associates with secretory vesicles and the plasma membrane in yeast. Cell 53, 753768[CrossRef][Web of Science][Medline]
Ishida, N., Miura, N., Yoshioka, S., and Kawakita, M. (1996) Molecular cloning and characterization of a novel isoform of the human UDP-galactose transporter, and of related complementary DNAs belonging to the nucleotide-sugar transporter gene family. J. Biochem. (Tokyo), 120, 10741078.
Jack, D.L., Yang, N.M., and Saier, M.H. Jr. (2001) The drug/metabolite transporter superfamily. Eur. J. Biochem., 268, 36203639.[Web of Science][Medline]
Kamiyama, S., Suda, T., Ueda, R., Suzuki, M., Okubo, R., Kikuchi, N., Chiba, Y., Goto, S., Toyoda, H., Saigo, K., and others. (2003) Molecular cloning and identification of 3'-phosphoadenosine 5'-phosphosulfate transporter. J. Biol. Chem., 278, 2595825963.
Kluxen, F.W. and Lubbert, H. (1993) Maximal expression of recombinant cDNAs in COS cells for use in expression cloning. Anal. Biochem., 208, 352356.[CrossRef][Web of Science][Medline]
Knappe, S., Flügge, U.I., and Fischer, K. (2003) Analysis of the plastidic phosphate translocator gene family in Arabidopsis and identification of new phosphate translocator-homologous transporters, classified by their putative substrate-binding site. Plant Physiol., 131, 11781190.
Kruse, J., Mailhammer, R., Wernecke, H., Faissner, A., Sommer, I., Goridis, C., and Schachner, M. (1984) Neural cell adhesion molecules and myelin-associated glycoprotein share a common carbohydrate moiety recognized by monoclonal antibodies L2 and HNK-1. Nature, 311, 153155.[CrossRef][Medline]
Luders, F., Segawa, H., Stein, D., Selva, E.M., Perrimon, N., Turco, S.J., and Hacker, U. (2003) Slalom encodes an adenosine 3'-phosphate 5'-phosphosulfate transporter essential for development in Drosophila. EMBO J., 22, 36353644.[CrossRef][Web of Science][Medline]
Lühn, K., Wild, M.K., Eckhardt, M., Gerardy-Schahn, R., and Vestweber, D. (2001) The gene defective in leukocyte adhesion deficiency II encodes a putative GDP-fucose transporter. Nat. Genet., 28, 6972.[CrossRef][Web of Science][Medline]
Ma, D., Russell, D.G., Beverley, S.M., and Turco, S.J. (1997) Golgi GDP-mannose uptake requires Leishmania LPG2. A member of a eukaryotic family of putative nucleotide-sugar transporters. J. Biol. Chem., 272, 37993805.
Miura, N., Ishida, N., Hoshino, M., Yamauchi, M., Hara, T., Ayusawa, D., and Kawakita, M. (1996) Human UDP-galactose translocator: molecular cloning of a complementary DNA that complements the genetic defect of a mutant cell line deficient in UDP-galactose translocator. J. Biochem. (Tokyo), 120, 236241.
Münster, A.K., Eckhardt, M., Potvin, B., Mühlenhoff, M., Stanley, P., and Gerardy-Schahn, R. (1998) Mammalian cytidine 5'-monophosphate N-acetylneuraminic acid synthetase: a nuclear protein with evolutionarily conserved structural motifs. Proc. Natl Acad. Sci. USA, 95, 91409145.
Muraoka, M., Kawakita, M., and Ishida, N. (2001) Molecular characterization of human UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter, a novel nucleotide sugar transporter with dual substrate specificity. FEBS Lett., 495, 8793.[CrossRef][Web of Science][Medline]
Norambuena, L., Marchant, L., Berninsone, P., Hirschberg, C.B., Silva, H., and Orellana, A. (2002) Transport of UDP-galactose in plants. Identification and functional characterization of AtUTr1, an Arabidopsis thaliana UDP-galactos/UDP-glucose transporter. J. Biol. Chem., 277, 3292332929.
Segawa, H., Kawakita, M., and Ishida, N. (2002) Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose. Eur. J. Biochem., 269, 128138.[Web of Science][Medline]
Selva, E.M., Hong, K., Baeg, G.H., Beverley, S.M., Turco, S.J., Perrimon, N., and Hacker, U. (2001) Dual role of the fringe connection gene in both heparan sulphate and fringe-dependent signalling events. Nat. Cell Biol., 3, 809815.[CrossRef][Web of Science][Medline]
Terayama, K., Oka, S., Seiki, T., Miki, Y., Nakamura, A., Kozutsumi, Y., Takio, K., and Kawasaki, T. (1997) Cloning and functional expression of a novel glucuronyltransferase involved in the biosynthesis of the carbohydrate epitope HNK-1. Proc. Natl Acad. Sci. USA, 94, 60936098.
Tusnady, G.E. and Simon, I. (1998) Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J. Mol. Biol., 283, 489506.[CrossRef][Web of Science][Medline]
Tusnady, G.E. and Simon, I. (2001) The HMMTOP transmembrane topology prediction server. Bioinformatics, 17, 849850.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
B. Cubero, Y. Nakagawa, X.-Y. Jiang, K.-J. Miura, F. Li, K. G. Raghothama, R. A. Bressan, P. M. Hasegawa, and J. M. Pardo The Phosphate Transporter PHT4;6 Is a Determinant of Salt Tolerance that Is Localized to the Golgi Apparatus of Arabidopsis Mol Plant, May 1, 2009; 2(3): 535 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Johswich, B. Kraft, M. Wuhrer, M. Berger, A. M. Deelder, C. H. Hokke, R. Gerardy-Schahn, and H. Bakker Golgi targeting of Drosophila melanogaster {beta}4GalNAcTB requires a DHHC protein family-related protein as a pilot J. Cell Biol., January 12, 2009; 184(1): 173 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ibar and A. Orellana The Import of S-Adenosylmethionine into the Golgi Apparatus Is Required for the Methylation of Homogalacturonan Plant Physiology, October 1, 2007; 145(2): 504 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Cottrell, C. L. Griffith, H. Liu, A. A. Nenninger, and T. L. Doering The Pathogenic Fungus Cryptococcus neoformans Expresses Two Functional GDP-Mannose Transporters with Distinct Expression Patterns and Roles in Capsule Synthesis Eukaryot. Cell, May 1, 2007; 6(5): 776 - 785. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-C. Lamerz, T. Haselhorst, A. K. Bergfeld, M. von Itzstein, and R. Gerardy-Schahn Molecular Cloning of the Leishmania major UDP-glucose Pyrophosphorylase, Functional Characterization, and Ligand Binding Analyses Using NMR Spectroscopy J. Biol. Chem., June 16, 2006; 281(24): 16314 - 16322. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kabuss, A. Ashikov, S. Oelmann, R. Gerardy-Schahn, and H. Bakker Endoplasmic reticulum retention of the large splice variant of the UDP-galactose transporter is caused by a dilysine motif Glycobiology, October 1, 2005; 15(10): 905 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ashikov, F. Routier, J. Fuhlrott, Y. Helmus, M. Wild, R. Gerardy-Schahn, and H. Bakker The Human Solute Carrier Gene SLC35B4 Encodes a Bifunctional Nucleotide Sugar Transporter with Specificity for UDP-Xylose and UDP-N-Acetylglucosamine J. Biol. Chem., July 22, 2005; 280(29): 27230 - 27235. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











