Skip Navigation


Glycobiology Advance Access originally published online on September 29, 2004
Glycobiology 2005 15(2):177-191; doi:10.1093/glycob/cwh158
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/2/177    most recent
cwh158v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Citing Articles
Right arrowScopus Links
Google Scholar
Right arrow Articles by Olson, F. J.
Right arrow Articles by Hansson, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olson, F. J.
Right arrow Articles by Hansson, G. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology vol. 15 no. 2 © Oxford University Press 2005; all rights reserved.

A MUC1 tandem repeat reporter protein produced in CHO-K1 cells has sialylated core 1 O-glycans and becomes more densely glycosylated if coexpressed with polypeptide-GalNAc-T4 transferase

Fredrik J. Olson2, Malin Bäckström2, Hasse Karlsson2, Joy Burchell3 and Gunnar C. Hansson1,2

2 Department of Medical Biochemistry, Göteborg University, 413 90 Gothenburg, Sweden, and 3 Cancer Research UK Breast Cancer Biology, Guy's Hospital, London SE1 9RT, United Kingdom


1 To whom correspondence should be addressed; e-mail: gunnar.hansson{at}medkem.gu.se

Received on June 9, 2004; revised on September 21, 2004; accepted on September 22, 2004


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
A recombinant mucin O-glycosylation reporter protein, containing 1.7 tandem repeats (TRs) from the transmembrane mucin MUC1, was constructed. The reporter protein, MUC1(1.7TR)-IgG2a, was produced in CHO-K1 cells to study the glycosylation of the MUC1 TR and the in vivo role of polypeptide-GalNAc-T4 glycosyltransferase. N-terminal sequencing of MUC1(1.7TR)-IgG2a showed that all five potential O-glycosylation sites within the TR were used, with an average density of 4.5 glycans per repeat. The least occupied site was Thr in the PDTR motif, where 75% of the molecules were glycosylated, compared to 88–97% at the other sites. This glycan density was confirmed by an alternative liquid chromatography–mass spectrometry (LC-MS) based approach. The O-linked oligosaccharides were released from MUC1(1.7TR)-IgG2a and analyzed by nano-LC-MS and LC-MS/MS. Four oligosaccharides were present, NeuAc{alpha}2-3Galß1-3GalNAcol, NeuAc{alpha}2-3Galß1-3(NeuAc{alpha}2-6)GalNAcol, Galß1-3(NeuAc{alpha}2-6)GalNAcol, and Galß1-3GalNAcol, the two first being most abundant. Coexpression of the human polypeptide-GalNAc-T4 transferase with MUC1(1.7TR)-IgG2a increased the glycan occupancy at Thr in PDTR, Ser in VTSA, and Ser in GSTA, supporting the function of GalNAc-T4 proposed from previous in vitro studies. The expression of GalNAc-T4 with a mutation in the first lectin domain ({alpha}) had no glycosylation effect on PDTR and GSTA but surprisingly gave a dominant negative effect with a decreased glycosylation to around 50% at the Ser in VTSA. The results show that introduction of glycosyltransferases can specifically alter the sites for O-glycosylation in vivo.

Key words: Edman sequencing / glycosyltransferase / mass spectrometry / mucin / O-glycosylation


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Mucins are large and heavily glycosylated proteins, with most of their mass (characteristically 50–80%) consisting of O-linked oligosaccharides. Up to now, 15 human mucins have been identified and fully or partly sequenced (Moniaux et al., 2001Go; Perez-Vilar and Hill, 1999Go; Zhang et al., 2003Go). These are classified as secreted or transmembrane mucins. The secreted mucins are primarily gel-forming and serve as the main protein constituent of the mucus layer acting as a first line of defense for the epithelial surfaces against a hostile extracellular milieu. Also, the transmembrane mucins are expressed in epithelial cells, on the apical side where they may interact with the secreted mucins, anchoring the mucus layer to the epithelium.

The O-glycan biosynthesis is initiated by the transfer of GalNAc to Ser or Thr of the protein backbone, catalyzed by a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases (GalNAc-Ts). Multiple members of this protein family have been identified with different kinetic properties and different expression patterns both temporarily and spatially (Nehrke et al., 1998Go). Few studies have addressed how GalNAc-O-glycosylation proceeds in vivo and if indeed the large amount of data from in vitro studies applies in vivo. One complication with interpretation of in vivo data is that the repertoires of GalNAc-Ts in cells are unknown, as are the full capacities for O-glycosylation these have. Nehrke et al. (1998)Go originally addressed this using a minigene expression construct containing a peptide substrate derived from the HIV gp120 protein. This peptide contains one single Thr, which is glycosylated in vitro only by GalNAc-T3 (Bennett et al., 1996Go). Using this system it was possible to fully recapitulate in vivo the GalNAc-T3 function found in vitro (Nehrke et al., 1998Go). Mutations in the gene encoding GalNAc-T3 has recently been found to cause familial tumoral calcinosis, a severe autosomal recessive metabolic disorder (Topaz et al., 2004Go).

MUC1, the first mucin to be cloned, is a transmembrane mucin expressed on the apical surface of most epithelial cells, including the mammary glands, and also on hematopoietic cells and in bone marrow (Gendler, 2001Go). The MUC1 protein consists of a very large extracellular domain (1000–2200 amino acids), a transmembrane domain, and a phosphorylated cytoplasmic tail involved in intracellular signaling. The extracellular domain is dominated by a 20-amino-acid tandem repeat (TR) sequence, repeated 20–120 times. This variable number of TRs (VNTR) is an inherited polymorphism. The VNTR domain carries most of the carbohydrates of the glycoprotein, with each TR containing five possible O-glycan attachment sites. MUC1 is highly overexpressed in many forms of cancer, in particular breast carcinomas (Girling et al., 1989Go) when the apical polarization is lost, resulting in MUC1 being expressed over the entire cell surface (Gendler, 2001Go). Aberrant O-linked glycosylation of MUC1 is also observed in carcinomas, both at the level of the composition of the glycans and in the degree of site occupancy. In lactating milk and hence presumably in normal breast tissue, the most common oligosaccharides are based on the core 2 structure GlcNAcß1-6(Galß1-3)GalNAc-polypeptide (Amano et al., 1991Go; Hanisch et al., 1989Go) and terminated by Lewis type epitopes (Hanisch et al., 1990Go). Sialylated Lewis-type epitopes are also expressed in colon carcinomas (Baeckstrom et al., 1991Go). Studies of MUC1 expressed in the human breast cancer cell line T47D show that the glycans are shorter, are core 1–based (Galß1-3GalNAc-polypeptide), and can be highly sialylated (Hanisch et al., 1996Go; Hull et al., 1989Go; Lloyd et al., 1996Go). However, some breast cancer cell lines (MCF7, MDA 231, and ZR75-1) can express core 2 O-glycans (Bäckström et al., 2003Go; Muller and Hanisch, 2002Go). In accordance, studies on primary breast carcinomas have shown that the glycosyltransferase responsible for adding sialic acid to core 1 glycans is elevated in breast carcinomas, whereas no consistent change was seen for C2GnT1 (Burchell et al., 1999Go).

To glycosylate all five acceptor sites of the MUC1 TR (PAPGSTAPPAHGVTSAPDTR; sites underscored, numbering order) in vitro, the combined and sequential action of several GalNAc-Ts are needed. Ser5 and Thr6 (in GSTA) and Thr14 (in VTSA) are readily glycosylated by GalNAc-T1, -T2, or -T3 (Wandall et al., 1997Go), but only one transferase identified this far, GalNAc-T4, has the ability to use Ser15 (in VTSA) and Thr19 (in PDTR) and complete the glycosylation (Bennett et al., 1998Go). However, GalNAc-T4 is not active on naked MUC1 TR peptides in vitro but requires prior glycosylation with GalNAc residues at other sites. In vitro studies showed that this specificity for GalNAc-MUC1 of GalNAc-T4 was directed by its lectin domain (Hassan et al., 2000Go).

To be able to study the site occupancy of the MUC1 TR, we constructed a shorter recombinant reporter protein, MUC1(1.7TR)-IgG2a, designed for studies of O-glycosylation in vivo. The recombinant protein, containing 1.7 TR of MUC1, fused to a murine IgG2a Fc chain, was produced in Chinese hamster ovary (CHO) K1 cells, where it achieved an O-glycosylation profile similar to that found on breast cancer MUC1. The system was also used to investigate the effect of GalNAc-T4 in vivo by coexpressing the transferase with MUC1(1.7TR)-IgG2a.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Construction of the secreted recombinant reporter protein MUC1(1.7TR)-IgG2a
To study the O-glycosylation of the MUC1 TR, a recombinant reporter protein was constructed, containing 1.7 repeats of the 20-amino-acid long MUC1 TR. This was short enough to allow the Edman analysis of individual glycosylation sites but still offered a normal surrounding to all glycosylation sites of one TR. The minigene was constructed by fusing 1.7 TR of MUC1 to a myc-tag, a His-tag and a {kappa}-chain signal sequence. To facilitate the analysis of the TR by N-terminal sequencing, the ability to create a new N-terminus closer to the TR sequence was needed. For this purpose, an enterokinase cleavage site was introduced five amino acids N-terminally of the TR. For maximum expression and secretion, a murine IgG2a Fc chain was added to the construct. To prevent recombination events due to sequence repetition in the MUC1 TR, which frequently caused the loss of one TR in the plasmid when propagated in Escherichia coli, the codon usage had to be modified, and a nonrepetitive DNA sequence was created by site-directed mutagenesis. Important features of the MUC1.7TR-IgG2a fusion protein are shown in Figure 1.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. The MUC1(1.7TR)-IgG2a recombinant protein. (A) Schematic drawing of MUC1(1.7TR)-IgG2a. (B) The amino acid sequence of MUC1(1.7TR)-IgG2a. The features of the construct are marked by bars above the sequence. (C) The amino acid sequence of one TR of MUC1, with numbering as used in this study.

 
Expression of MUC1(1.7TR)-IgG2a and GalNAc-T4 in CHO-K1 cells
The MUC1(1.7TR)-IgG2a expression vector was transfected into CHO-K1 cells, and a stable clone (#M6) was established that expressed and secreted MUC1(1.7TR)-IgG2a. To investigate the in vivo function of human GalNAc-T4, the MUC1(1.7TR)-IgG2a expression vector was also transfected into CHO-K1 cells stably transfected with the wild-type GalNAc-T4 or with mutant GalNAc-T4D459H carrying a point mutation in the first ({alpha}) of the three repeats in the lectin domain (Hassan et al., 2000Go). Stable clones coexpressing MUC1(1.7TR)-IgG2a with either of the GalNAc-T4 transferases were established (wild-type GalNAc-T4-expressing clones: #1G8 and #3D9; GalNAc-T4D459H-expressing clones: #13 and #15). Expression of MUC1(1.7TR)-IgG2a and GalNAc-T4 was confirmed by western blotting of cell lysates using anti-mouse Ig and the UH6 anti-GalNAc-T4 antibody, respectively (data not shown). The secretion in the five clones were between 2 and 10 pmoles MUC1(1.7TR)-IgG2a (~0.1–0.5 µg) per ml supernatant (Table I).


View this table:
[in this window]
[in a new window]
 
Table I. Characteristics of CHO-K1 clones established

 
Purification of MUC1(1.7TR)-IgG2a by metal affinity chromatography
MUC1(1.7TR)-IgG2a was purified from spent culture medium by binding the fusion protein, via its His-tag, to Co2+ ions immobilized on a HiTrap chelating column. Washing the bound material with 4 M guanidinium chloride improved the purity of the final product and was performed although it decreased the yield. After sequential washing with guanidinium chloride and 20 mM imidazole, the protein was digested on-column with enterokinase to create a new N-terminus five amino acids before the TR. Analysis by Edman degradation confirmed that the digestion was successful. Material removed by the enterokinase digestion was washed off the column with 20 mM imidazole before MUC1(1.7TR)-IgG2a was eluted with 100 mM imidazole. Analysis of the purified material on a sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) gel as visualized by silver staining showed only one band (Figure 2). N-terminal sequencing of this pure protein, as well as a western blot using anti-mouse Ig antibodies, confirmed that the purified product was the desired one. No significant amount of MUC1(1.7TR)-IgG2a remained on the column after the elution, as seen by analysis of the fraction collected when ethylenediamine tetra-acetic acid was used to strip the column of Co2+ ions (data not shown). The overall yield of the purifications varied between 63% and 83% (Table I).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 2. 10–20% SDS–PAGE of purified MUC1(1.7TR)-IgG2a. Proteins in lane 1 were visualized by silver staining. Lane 2 shows a western blot of the same material, immunostained with AP-conjugated goat anti-mouse Ig detecting the IgG chain of the fusion protein. M is for marker.

 
CHO-K1 cells produce mainly sialylated core 1 O-glycans
The structures of the O-linked oligosaccharides expressed on MUC1(1.7TR)-IgG2a produced in wild-type CHO-K1 were determined and compared to the 16 TR MUC1-IgG2a (Bäckström et al., 2003Go). The oligosaccharides were released from 10 pmoles of MUC1(1.7TR)-IgG2a by reductive ß-elimination in a miniaturized scale, and after desalting the entire oligosaccharide alditol pool was subjected underivatized to negative ion mode liquid chromatography (LC) electrospray ionization (ESI) mass spectrometry (MS) or LC-ESI-MS/MS, using a nano column packed with 5 µm Hypercarb particles (Schulz et al., 2002Go). Two major and two minor components were found in the mass chromatogram (Figure 3A), corresponding to one ion at m/z 384, two ions at m/z 675, and one ion at m/z 966. An ion at m/z 384 corresponds to the monosaccharide composition Hex1, HexNAcol1 ions at m/z 675 to NeuAc1, Hex1, HexNAcol1 and the ion at m/z = 966 to NeuAc2, Hex1, HexNAcol1. The four oligosaccharides were assumed to be Galß1-3GalNAcol, NeuAc{alpha}2-3Galß1-3GalNAcol, Galß1-3(NeuAc{alpha}2-6)GalNAcol, and NeuAc{alpha}2-3Galß1-3(NeuAc{alpha}2-6)GalNAcol, because these oligosaccharides have been reported previously from CHO cells (Bäckström et al., 2003Go; Inoue et al., 1993Go; Sasaki et al., 1987Go). LC-MS/MS (Figure 4) was used to confirm this and to assign the two isobaric components at m/z 675. On MS/MS, fragmentation occurred primarily in the glycosidic bonds, rendering and or and fragment ions (nomenclature according to Domon and Costello, 1988Go). The and fragment ions lose 2 H+ to become negatively charged, and appear as Bi = [Bi–2H] and Zj = [Zj–2H] ions in the mass spectra.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. O-glycan profiles of MUC1(1.7TR)-IgG2a expressed in CHO-K1 in the absence or presence of polypeptide-GalNAc-T4. Released oligosaccharide alditols from MUC1(1.7TR)-IgG2a produced in the different clones (Table I) were analyzed by LC-ESI-MS on a Hypercarb column. The combined mass chromatogram of m/z 223, 384, 482.7, 587, 675.3, and 966.4 is presented for each sample. The m/z of the [M-H] of each component is given above the peak, with an exception of m/z 482.7, corresponding to [M-2H]2– of the last eluted component with [M-H] at m/z 966.4 and indicating that this component was detected also as its doubly charged ion. (A) wt CHO-K1 #M6. (B) CHO-K1/GalNAcT4 #1G8. (C) CHO-K1/GalNAcT4 #3D9. (D) CHO-K1/GalNAcT4D459H #13. (E) CHO-K1/GalNAcT4D459H #15. The chromatograms were recorded at different occasions and the retention times varied somewhat between the analyses. For certainty, the identity of all components was confirmed by LC-MS/MS analysis.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. MS/MS spectra of the O-linked oligosaccharides expressed on MUC1(1.7TR)-IgG2a in CHO-K1 cells. MS/MS spectra, from LC-ESI-MS/MS on a Hypercarb column, of the oligosaccharide alditols with the following [M-H] parent ions: (A) m/z 384, (B) and (C) m/z 675.3, and (D) m/z 966.4. (C) corresponds to the most abundant m/z 675 component, eluting later from the column at a higher acetonitrile concentration. The proposed fragmentation pattern for each component is presented in connection to the corresponding spectrum. Fragment annotations are based on the suggested nomenclature by Domon and Castello (1988)Go.

 
The [M-H-18] fragment ion at m/z 657 resulting from LC-MS/MS of the first eluted m/z 675 component (Figure 4B) was interpreted as the loss of H2O from a pair of hydroxyl groups at adjacent carbons in cis position, indicating a free C3 of Gal. The fragment ion at m/z 454 in the same spectrum could not be explained but appeared also on fragmentation of NeuAc{alpha}2-3Galß1-3(NeuAc{alpha}2-6)GalNAcol, indicating a structural similarity to this component. Possibly, this fragment ion was created by a 0,2X1 internal ring cleavage within the NeuAc. The oligosaccharide analyzed in Figure 4B was interpreted as Galß1-3(NeuAc{alpha}2-6)GalNAcol, based on the reasons given and in line with the absence of a fragment ion at m/z 204 that if present would indicate a monosubstituted GalNAcol. The second component with a [M-H] ion at m/z 675 was interpreted as the NeuAc{alpha}2-3Galß1-3GalNAcol oligosaccharide, an assignment supported by the presence of an m/z 204 fragment ion in the MS/MS spectrum of this component (Figure 4C). Furthermore, this is in agreement with the elution order of these two m/z 675 oligosaccharides on the Hypercarb columns, as determined from analysis of standards with known structure. The data presented here were similar to MUC1(16TR)-IgG2a (Bäckström et al., 2003Go) and showed that the major O-glycans were NeuAc{alpha}2-3Galß1-3GalNAcol and NeuAc{alpha}2-3Galß1-3(NeuAc{alpha}2-6)GalNAcol, and that Galß1-3(NeuAc{alpha}2-6)GalNAcol and Galß1-3GalNAcol were expressed in lower amounts (Table II).


View this table:
[in this window]
[in a new window]
 
Table II. Relative abundance of the O-glycans on MUC1(1.7TR)-IgG2a produced in different CHO-K1 clones

 
Determination of response factors for the oligosaccharides in LC-ESI-MS
To be able to determine the relative amounts of the different oligosaccharide species using integrated peak areas in the LC-MS chromatograms, response factors were needed to compensate for the difference in ionization efficiency between the oligosaccharides. To achieve this, individual oligosaccharides were isolated from a recombinant MUC1 based protein carrying the same oligosaccharides, MUC1(16TR)-IgG, produced in CHO-K1 cells (Bäckström et al., 2003Go). The oligosaccharides were released and subjected to high-performance liquid chromatography (HPLC) on a Hypercarb column to isolate the oligosaccharides Galß1-3GalNAcol, NeuAc{alpha}2-3Galß1-3GalNAcol and NeuAc{alpha}2-3Galß1-3(NeuAc{alpha}2-6)GalNAcol. The identity and purity of the isolated oligosaccharide standards was confirmed by nano-ESI-MS, and their concentrations determined by monosaccharide composition analysis. Sample mixtures containing known concentrations of the oligosaccharide standards were prepared and analyzed by nano LC-ESI-MS under the same conditions. Integrated peak areas in the mass chromatograms were then used to calculate relative ionization efficiency correction factors for neutral, monosialylated, and disialylated oligosaccharides (Figure 5). The ratio between the areas obtained from equal concentrations of Galß1-3GalNAc (m/z 384) and NeuAc{alpha}2-3Galß1-3GalNAc (m/z 675) was determined to 0.40 ± 0.10 (mean ± SD, n = 11). The corresponding value when comparing Galß1-3GalNAc (m/z 384) and NeuAc{alpha}2-3Galß1-3(NeuAc{alpha}2-6)GalNAc (m/z 966) was determined to 0.30 ± 0.10 (mean ± SD, n = 11).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. LC-ESI-MS of equal concentrations of oligosaccharide standards. (Upper panel) Typical mass chromatogram (experiment 4) from nano LC-ESI-MS on a mixture of oligosaccharide standards with equal concentration. (Lower panel) Overview of the data from eleven experiments performed to obtain correction factors for the difference in ionization efficiency of neutral, singly charged, and doubly charged oligosaccharides. The factors are calculated as the average of the ratios of integrated peak areas in the mass chromatograms generated in the 11 experiments. The asterisk marks one experiment (5) with different concentrations of the oligosaccharide standards. The relative peak areas are given after recalculation to identical amounts.

 
All O-glycosylation sites of the MUC1 TR are used in CHO-K1 cells
To determine the occupancy of the individual O-glycosylation sites of the TR region within the MUC1(1.7TR)-IgG2a, a strategy using N-terminal degradation by Edman chemistry was used. Unsubstituted Ser or Thr residues can be distinguished from their corresponding glycosylated residues, because these do not coelute in the HPLC used to analyze the released and processed N-terminal amino acids. The amounts of Ser or Thr obtained in these cycles correspond solely to the nonglycosylated amino acids present at that certain position. By comparing this amount to a hypothetical expected amount, corresponding to that from a totally nonglycosylated amino acid population, the degree of glycan substitution was calculated. The expected value was based on the amount of starting material and the repetitive yield. GalNAc-Ser and GalNAc-Thr was detected in low amounts as individual peaks in the chromatograms but could not be used to determine the amounts of substituted amino acids because no deglycosylation to obtain only GalNAc substituted peptides was performed prior to analysis.

Purified and enterokinase-digested MUC1(1.7TR)-IgG2a from wild-type CHO-K1 was subjected to Edman degradation. It was found that a majority of the amino acids at all five potential O-glycosylation sites were occupied, in addition to two non-TR Ser before the MUC1 sequence (Table III and Figure 6, black bars). The Thr6 (in GSTA) and Thr14 (in VTSA) motives were almost fully glycosylated (more than 95%), whereas the Ser5 and Ser15 of these motives showed lower occupancy (88%). However, Ser5 (in GSTA) was more occupied in the second TR (96%). This deviation could possibly be due to that this amino acid in the second repeat is more embedded in its normally surrounding amino acids and that this could have an impact on the glycosylation event. Least occupied was the Thr19 of the PDTR motif with a substitution of ~75%. The glycosylation of Thr19 (in PDTR) and Ser15 (in VTSA) indicated the presence of an endogenous GalNAc-T4 (or a GalNAc-T with a similar activity) in CHO-K1 cells.


View this table:
[in this window]
[in a new window]
 
Table III. Site-specific glycosylation of MUC1(1.7TR)-IgG2a produced in wild-type CHO-K1 cells and CHO-K1 cells with wild-type or mutated GalNAc-T4

 


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6. Site-specific glycosylation of the MUC1 TR. The glycosylation at the individual Ser and Thr of the MUC1 TR is summarized. Values were determined from Edman degradation of MUC1(1.7TR)-IgG2a, produced in CHO-K1 cells in the absence or presence of wild-type GalNAc-T4 or GalNAc-T4D459H, and represent the ratio of glycosylated amino acids in percent of the total amino acid population at each site. The left bar (CHO) in each group represents MUC1(1.7TR)-IgG2a from wild-type CHO-K1, as the average of five analyses. The middle bar (T4459D) in each group represents MUC1(1.7TR)-IgG2a from CHO-K1 and co-expressed with the wild-type GalNAcT4. The values are the average from four analyses each of the two clones #1G8 and #3D9. The right bar (T4459H) in each group represents MUC1(1.7TR)-IgG2a from CHO-K1 and coexpressed with GalNAcT4D459H, carrying a point mutation in its lectin domain. The values are the average from four analyses each of the two clones #13 and #15. Error bars show the standard deviation.

 

View this table:
[in this window]
[in a new window]
 
Table IV. O-glycosylation site occupancy of the MUC1TR-XL glycopeptide

 
Coexpression of wild-type GalNAc-T4 increases the site occupancy of MUC1
The MUC1(1.7TR) glycosylation reporter system was used to investigate the in vivo function of the human GalNAc-T4. MUC1(1.7TR)-IgG2a was coexpressed with wild-type GalNAc-T4 or GalNAc-T4D459H in CHO-K1 cells. The D459H mutation in the lectin domain is known to abolish the GalNAc-T4 activity on MUC1 TR glycopeptides in vitro. Purified and enterokinase-cleaved MUC1(1.7TR)-IgG2a secreted from these cells was subjected to N-terminal sequencing, and the glycan occupancy of the individual O-glycosylation sites within the TR was determined as described. Expression of human wild-type GalNAc-T4 increased the glycosylation closer to full occupancy at the sites not already fully occupied by the endogenous GalNAc-Ts (Table III and Figure 6, light gray bars). This was in line with results from in vitro studies, where GalNAc-T4 was able to glycosylate Ser5 (in GSTA), Ser15 (in VTSA), and Thr19 (in PDTR) (Bennett et al., 1998Go; Hanisch et al., 2001GoGo).

Mutant GalNAc-T4D459H did not result in the increase in site occupancy found with wild-type GalNAc-T4. However, the effect of the mutated GalNAc-T4D459H was more complex (Table III and Figure 6, dark gray bars). The residues fully occupied in wild-type CHO were not affected. At the three remaining sites, two different effects were observed. At Ser5 (in GSTA) and Thr19 (in PDTR), the occupancy was similar to that on MUC1 TR from wild-type CHO, suggesting that the mutation inactivated the effect of the human GalNAc-T4 on these sites, in line with previous in vitro studies. At Ser15 (in VTSA), a dominant negative effect was observed, with a decreased occupancy from almost 90% in wild-type CHO to around 50%. The reason for this phenomenon is not known, but there seems to be a direct relation to the level of transferase expression as the clone with the higher expression of GalNAc-T4D459H, clone #15, had a lower occupancy of this Ser compared to clone #13 (Tables I and III).

The oligosaccharides expressed on MUC1(1.7TR)-IgG2a from the GalNAc-T4 clones were released and analyzed by LC-MS (Figure 3B–E). The same oligosaccharides were produced in these cell lines as in wild-type CHO-K1, but the relative amounts of the components differed (Table II). The two major components in wild-type CHO-K1, NeuAc{alpha}2-3Galß1-3GalNAcol and NeuAc{alpha}2-3Galß1-3(NeuAc{alpha}2-6)GalNAcol, were the dominating in all GalNAc-T4-expressing clones as well. Trace amounts of an additional component with [M-H] at m/z 587 was detected among the O-glycans from GalNAc-T4 expressing clone #3D9. The differences in the O-glycosylation profiles could not be correlated to the expression levels of GalNAc-T4 (Table I) or to the form of GalNAc-T4 expressed.

Validation of the results on the O-glycan occupancy
To validate the results from the Edman degradation, a second approach to determine the O-glycan site occupancy of the MUC1 TR was employed. The MUC1(1.7TR)-IgG2a was enzymatically deglycosylated, leaving only the innermost GalNAc intact and attached to the protein as a marker of substituted O-glycan sites. Then a 25-amino-acid-long glycopeptide, MUC1TR-XL containing the MUC1 TR plus the five adjacent amino acids on its N-terminal side, was cleaved out of MUC1(1.7TR)-IgG2a by sequential enterokinase and clostripain (an endo-ArgC protease) digestion. The five extra amino acids (GASSM) stem from the cassette used during the cDNA construction and have no biological significance in the context of MUC1. However, the two extra Ser residues function as O-glycan sites, giving the MUC1TR-XL peptide a total of seven possible O-glycan sites.

Nano LC-ESI-MS was then performed on the MUC1TR-XL glycopeptides to determine the number of GalNAcs attached. Using the theoretical masses of the glycopeptides of interest, we could specifically target these in the MS analysis. This showed that glycopeptides carrying four to seven GalNAcs were present in the samples produced by all the cell lines. The identities of the ions for the glycopeptides were confirmed by nano LC-ESI-MS/MS. An example of this is shown in Figure 7 by a collision-induced mass spectrum of MUC1TR-XL substituted with six GalNAcs, [M+3H]3+ at m/z 1181. The fragmentation was primarily observed only in peptide bonds at the amino acid Pro, making it difficult to accurately predict detailed site occupancy by MS. However, the average O-glycan site occupancy on the whole glycopeptide could be calculated by integrating the peak areas in the LC-MS mass chromatograms for the glycopeptides with different number of sites used (Table IV). The results were in agreement with the results from the Edman degradation, with the highest degree of glycan substitution in the CHO-K1/wild-type GalNAcT4 cell lines.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 7. MS/MS on MUC1TR-XL carrying 6 GalNAc residues. (A) Amino acid sequence of MUC1TR-XL glycopeptide, with the seven potential O-glycosylation sites marked. Observed fragment ions of the y series are also indicated. (B) Theoretical masses [M+H]+ of all possible glycan forms of the whole peptide as well as of observed peptide fragments. (C) MS/MS spectrum obtained after collision of the [M+3H]3+ at m/z 1181 ion (corresponding to the glycoform with 6 GalNAc attached to the MUC1TR-XL peptide), converted to a monoisotopic, singly charged spectrum by MaxEnt 3 in the MassLynx 3.4 software.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Here, an in vivo reporter system for MUC1 TR O-glycosylation was used to explore the O-glycan expression profile of MUC1 in CHO-K1 cells, as well as the in vivo effect of the human GalNAc-T4 transferase. The results suggest that this enzyme glycosylates three specific O-glycosylation sites within the MUC1 TR in vivo, as proposed from in vitro studies. Overexpression of a GalNAc-T4 with one lectin binding site inactivated caused a dominant negative effect on one specific glycosylation site, suggesting a complex regulation of glycosylation site occupancy.

Studies on the effect and mechanism of the O-glycosylation machinery are complicated, due to both the complexity of the system in terms of the number and location of glycosyltransferases and difficulties in producing sufficient amounts of the glycoproteins. Most specificity studies of glycosyltransferases have therefore been performed in vitro, and this has produced valuable and extended insight into the mechanisms of O-glycosylation. To confirm and further study these results in vivo, a MUC1 TR O-glycosylation reporter protein was constructed allowing analysis by Edman sequencing. An IgG2a-Fc domain encoded by a genomic sequence was added to achieve maximum expression and secretion. The construct also included a myc-tag for detection, a His-tag for purification, and a carboxylic acid–rich C-terminus to allow covalent attachment of the protein prior to Edman sequencing. A recombinant protein has been used before as a glycosylation reporter protein by Nehrke et al. (1996)Go. Muller and Hanisch (2002)Go have used a reporter plasmid containing six MUC1 TRs to analyze the glycans added but not the sites of glycosylation.

The O-glycosylation reporter was used to produce a recombinant protein including 34 amino acids corresponding to 1.7 TR of MUC1. The recombinant protein MUC1(1.7TR)-IgG2a was expressed in CHO-K1 cells, known to produce a rather simple O-glycosylation (Sasaki et al., 1987Go). The oligosaccharides were made up of four components, NeuAc{alpha}2-3Galß1-3GalNAcol, NeuAc{alpha}2-3Galß1-3 (NeuAc{alpha}2-6)GalNAcol, Galß1-3(NeuAc{alpha}2-6)GalNAcol, and Galß1-3GalNAcol, the two first being the most abundant. The glycan density of the TR domain was 4.5 glycans per TR, and all individual glycosylation sites were occupied to 75–97%, seen over the reporter protein population. Least occupied was the Thr19 of the immunodominant PDTR motif, which was glycosylated in 75% of the molecules. GalNAc-T4 is the only GalNAc-T identified so far that can glycosylate the final two of the five sites (Ser15 in VTSA and Thr19 in PDTR) within the TR of MUC1, and so take the glycosylation to completion (Bennett et al., 1998Go). The repertoire of GalNAc-Ts in CHO cells is unknown, but the results presented here suggest that a GalNAc-T4 ortholog or a new GalNAc-T with similar activity is expressed. A GalNAc-T4-like activity in CHO cells has indeed been implicated before, because Thr57 of PSGL-1 is glycosylated in these cells (Li et al., 1996Go), a site known to be glycosylated by GalNAc-T4 (Bennett et al., 1998Go). However, the endogenous GalNAc-T4 was not capable of fully glycosylating MUC1 TR.

One of the more challenging analytical problems is to determine the glycosylation sites and the specific glycans attached to each site in mucin domains. These domains are usually not degradable with proteases. This can be overcome by trimming the glycans down to GalNAc only, as shown for PSM and MUC1 (Gerken et al., 1997Go; Muller et al., 1997Go), allowing MS determination of the total number of glycans attached to the generated glycopeptides. However, for analysis of specific glycosylation sites, Edman sequencing is at present the superior method, because it cleaves off the glycoamino acids with identical yields irrespective of glycans attached and allows better quantification. The importance of this is illustrated here, where an accurate determination of the level of occupancy revealed subtle site-specific alterations by the addition of different glycosyltransferases. The value of Edman sequencing for solving problems of this type has been shown by Gerken et al. (1997Go, 1998Go, 2002)Go on PSM. When analyzing full mucins it is necessary to partially deglycosylate the protein to allow proteolytic cleavage, something that might generate miscleavages and biased results. This problem is circumvented with small reporter constructs, especially designed for Edman sequencing such as that described here. One could argue that these may not reflect the normal glycosylation of the full-length molecule. However, comparing the O-glycosylation of MUC1(1.7TR)-IgG2a to that of a recombinant protein containing 16 TR of MUC1 produced in CHO-K1 (Bäckström et al., 2003Go), the dominating oligosaccharides were the same and the glycan densities similar. Thus the MUC1 TR seems to have the same glycosylation profile in CHO-K1 cells, irrespective of the number of TR on the protein.

Controlled manipulation of the glycosylation pattern of cell lines would also be valuable in studies of the glycosylation machinery of the secretory pathway and the importance of individual glycosyltransferases in vivo. Here we show that recombinant expression of GalNAc-T4 in vivo added to the activity of CHO-K1 endogenous GalNAc-Ts, which resulted in increased glycan occupancy at Ser5 (in GSTA), Ser15 (in VTSA), and Thr19 (in PDTR). These are the sites of human GalNAc-T4 specificity within the MUC1 TR, as predicted from in vitro studies (Bennett et al., 1998Go; Hanisch et al., 2001GoGo). The present results thus supported the proposed function and specificity of GalNAc-T4 and that the in vivo effect is similar to that observed in vitro. It also demonstrated that it is possible to manipulate the glycosylation site occupancy by the introduction of new glycosyltransferases.

GalNAc-T4 contains a ricin-like lectin domain with three repeats named {alpha}, ß, and {gamma} using the nomenclature of Hagen et al. (1999)Go. Point-mutation from Asp to His in the {alpha}-repeat generates the GalNAc-T4D459H mutant, incapable of glycosylating MUC1 TR glycopeptides in vitro (Hassan et al., 2000Go). When MUC1(1.7TR)-IgG2a was coexpressed with GalNAcT4D459H, the glycan occupancies of the TR glycosylation sites were as expected similar to those found in wild-type CHO-K1 cells, supporting that the mutation inactivates the GalNAc-T4. Surprisingly, one exception to the predicted effect was that Ser in VTSA was less glycosylated than in wild-type CHO-K1. This competition between the mutant GalNAcT4D459H and the CHO-K1 endogenous GalNAc-T glycosylating this particular Ser is currently not understood. This dominant negative effect suggests that the GalNAcT4D459H can bind the glycopeptide while still being unable to glycosylate this site or is related to the two other nonmutated lectin domain repeats (ß and {gamma}).

In conclusion, the O-glycosylation reporter protein, MUC1(1.7TR)-IgG2a, has been used to show that the sites for glycosylation can be modulated in vivo by overexpressing GalNAc-T4 but also that the in vivo situation can be more complex. This work opens for engineering cell lines for the manipulation of O-glycans to specific sites, further improving the possibility to produce recombinant proteins with specific glycosylation.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Construction of the MUC1(1.7TR)-IgG2a expression vector
A DNA cassette encoding an enterokinase cleavage site, a myc-tag, a His-tag, and a stop codon was constructed by annealing two complementary and 5' phosphorylated oligonucleotides; O18F: 5'-AGCTTGCTAGCCCTGACA-CGACGACAAAGGCGCCTCTAGACCTGAGCAGA-AGCTGATCAGCGAGGAGGACCTGCACCATCAC-CATCACCATCCTGACGACGACGACAAGGCTAGC-TGAGGGCC-3' and O18B: 5'-CTCAGCTAGCCTTGT-CGTCGTCGTCAGGATGGTGATGGTGATGGTGCA-GGTCCTCCTCGCTGATCAGCTTCTGCTCAGGTCT-AGAGGCGCCTTTGTCGTCGTCGTCAGGGCTAGC-A-3'. The obtained double-stranded fragment was ligated into the multiple cloning site of pSecTagB (Invitrogen, Baltimore, MD), between the HindIII and ApaI cleavage sites, resulting in the vector pSecTagBO18. A DNA fragment encoding 1.7 TR of MUC1 was obtained by annealing two complementary and 5' phosphorylated oligonucleotides; GH84A: 5'-CTAGCATGCCTGCCCCCGGCTCTACCGCCCCTCCCGCCCACGGCGTGACCTCCGCCCCCGACACCCGCCCCGCCCCTGGCAGCACCGCCCCTCCCGCCCACGGCGTGACCATGT-3' and GH84B: 5'-CTAGACATGGTCACGCCGTGGGCGGGAGGGGCGGTGCTGCCAGGGGCGGGGCGGGTGTCGGGGGCGGAGGTCACGCCGTGGGCGGGAGGGGCGGTAGAGCCGGGGGCAGGCATG-3'. The resulting double-stranded fragment was ligated into XbaI-cleaved pSecTagBO18, upstream of the myc-tag. Murine IgG2a Fc chain was amplified from the vector pcDNA3.CD43/IgG2a (kindly provided by Dr. B. Ardman, Boston, MA) by polymerase chain reaction with the oligonucleotide primers GH111A: 5'-TAGCAGGACCTA GGTGAGTCTCGAG-3' and GH111B: 5'-GTATAGGTCCTTTTACCCGGAGTCC, and ligated into PpuMI-cleaved pSecTagBO18/MUC1(1.7TR), downstream of the MUC1(1.7TR) insert. The insertion of the IgG2a-tag caused a reading frame shift that destroyed the His-tag. This was corrected by deleting two nucleotides close to the PpuMI cleavage site by site-directed mutagenesis using the oligonucleotides GH115A: 5'-CGGACTCCGGGTAAAAGGACCTACCATCACCATCACCATCC-3' and GH115B: 5'-GGATGGTGATGGTGATG GTAGGTCTTTTACCCGGAGTCCG-3' with the Quik-change Site Directed Mutagenesis kit from Stratagene (Cedar Creek, TX). This caused the loss of one His from the His6-tag. To prevent recombination in the TR region, individual nucleotides in this region were point-mutated without affecting the amino acid sequence. This was accomplished by site-directed mutagenesis using the Quik-change Site Directed Mutagenesis kit with the oligonucleotides GH182A: 5'-CCTGCCCCCGGCTCTACTGCACCAC-CTGCGCATGGAGTCACTAGTGCCCCCGACACCCGCCC-3' and GH182B: 5'-GGGCGGGTGTCGGGGGCACTAGTGACTCCATGCGCAGGTGGTGCAGTAGAGCCGGGGGCAGG-3'.

Cell culture and transfections
CHO-K1 cells (ATCC, Manassas, VA) were cultured in Iscove's modified Dulbecco's medium (Invitrogen) supplemented with 10% fetal bovine serum, penicillin, and streptomycin. Geneticin (Invitrogen) was used at 250 mg/L and zeocin (Invitrogen) at 50 mg/L when appropriate. The plasmids encoding the human full-length GalNAc-T4neo and were kindly provided by Drs. Henrik Clausen and Eric Bennett, Copenhagen University (Hassan et al., 2000Go). CHO-K1 cells stably expressing these transferases were generated by transfection of CHO-K1 cells. DNA was produced in XL-10 Gold bacteria (RecA–, Stratagene) and prepared using the Megaprep Tip 2500 protocol from Qiagen (Hilden, Germany). The pSecTagBO18/MUC1(1.7TR)/IgG2a vector was transfected into wild-type and GalNAc-T4 CHO-K1 cells using DMRIE-C (Invitrogen). Stable clones were generated by adding selection pressure after 24 h. Cells were passaged after 8 days of confluency. Spent culture medium containing MUC1(1.7TR)-IgG2a was collected every 5 days, cleared by centrifugation (4500 x g, +4°C, 15 min) and after addition of 0.05% NaN3 stored at +4°C. Cell lysates were prepared as described previously (Axelsson et al., 1998Go), in the presence of N-ethylmaleimide (Sigma, St. Louis, MO), phenylmethylsulfonyl fluoride (Calbiochem, San Diego, CA), aprotinin (Trasylol, Bayer, Leverkusen, Germany), and leupeptin (Sigma).

Purification and on-column enterokinase digestion of MUC1(1.7TR)-IgG2a
Spent culture medium containing MUC1(1.7TR)-IgG2a fusion protein was dialyzed against H2O. NaCl (0.3 M) was added and pH adjusted to 7.4 before application onto a 1 ml HiTrap chelating column (Amersham Bioscience, Uppsala, Sweden), loaded with Co2+ according to the manufacturer's instructions. The column was sequentially washed with start buffer (20 mM sodium phosphate, pH 7.4, 0.5 M NaCl), with 4 M guanidinium-HCl in start buffer and with 20 mM imidazole in start buffer, and then equilibrated with EKMax buffer (50 mM Tris–HCl, pH 8.0, 1 mM CaCl2, 0.1% Tween-20). Enterokinase Max (Invitrogen, 5 U in 2 ml EKMax buffer) was applied, and the column was incubated at 37°C for 20 h. After washing the column with EKMax buffer and with 20 mM imidazole in start buffer, MUC1(1.7TR)-IgG2a was eluted with 100 mM imidazole in start buffer. The eluates were desalted on a PD-10 column (Amersham Bioscience), eluted in H2O, lyophilized, and dissolved in H2O.

The amount of MUC1(1.7TR)-IgG2a in different fractions was determined by dissociation-enhanced lanthanide fluoroimmunoassay (DELFIA), as described (Baeckstrom et al., 1991Go). PolySorp ELISA plates (Nunc, Roskilde, Denmark) were coated with rabbit anti-mouse Ig antibodies (0.5 µg/well; Dako, Glostrup, Denmark), samples were applied, and bound MUC1(1.7TR)-IgG2a was detected with europium-conjugated goat anti-mouse IgG antiserum (Jackson Immunoresearch, West Grove, PA). Obtained reactivities were compared to those from a MUC1(1.7TR)-IgG2a standard sample with known concentration, determined from Edman degradation analysis data. Fractions were also analyzed with SDS–PAGE and western blotting. Some MUC1(1.7TR)-IgG2a was eluted in the 4 M guanidinium-HCl and 20 mM imidazole wash fractions. These fractions were pooled, dialyzed against H2O, and repurified in the same procedure just described after addition of NaCl and adjustment of pH. Eluates from such repurifications were pooled with the eluate from the corresponding first round.

SDS–PAGE and western blotting
Proteins were analyzed by SDS–PAGE with 0.1% SDS using reducing conditions. Equal amounts of protein were loaded in all lanes, as determined by the BCA protein determination assay (Pierce, Rockford, IL). Proteins were either visualized with silver staining or Alcian blue (0.125% in 25% ethanol, 10% acetic acid; Sigma), or blotted to 0.45 µM nitrocellulose membranes (Bio-Rad, Hercules, CA). Western blotting was performed in a Trans-blot SD semi-dry transfer cell (Bio-Rad) at a current of 1.25 mA/cm2 for 50 min, with 20% MeOH, 25 mM Tris, 192 mM glycin as transfer buffer. IgG2a-tagged proteins were immunodetected with AP-conjugated goat anti-mouse immunoglubulins diluted 1:1000 (Dako). GalNAc-T4 was immunodetected with UH6 anti-GalNAc-T4 antibody (Bennett et al., 1998Go) diluted 1:10 followed by AP-conjugated goat anti-mouse Igs antibody diluted 1:1000.

Miniscale release of O-linked oligosaccharides
O-linked oligosaccharides were released from 100 pmol of MUC1(1.7TR)-IgG2a by miniaturized reductive ß-elimination (Schulz et al., 2002Go). In short, glycoproteins were incubated in 40–100 µl 0.05 M KOH and 1 M NaBH4 at 45°C for 16 h, in 200-µl tubes with perforated lids to allow the H2 formed to evaporate. After incubation, the solution was neutralized with ~0.05 vol glacial acetic acid, and desalted with 50 µl AG50Wx8 cation exchange resin (Bio-Rad) packed in a Zip-tip (Millipore, Bedford, MA). The desalted material was eluted in H2O and dried by vacuum centrifugation in a Hetovac (Heto-Holten, Allerød, Denmark). Borate was removed as its methyl ester by the addition of 50 µl 2% HAc in methanol and evaporation in the Hetovac, repeated five times. Finally, the samples were dissolved in 10 µl H2O.

Preparation of oligosaccharide standards
O-linked oligosaccharides were released by reductive ß-elimination (Carlstedt et al., 1993Go) from approximately 50 mg of recombinant MUC1(16TR)-IgG (Bäckström et al., 2003Go) produced in CHO-K1 cells. Released and desalted oligosaccharides were separated on a Hypercarb 5-µm column (100 x 4.6 mm; Thermo Hypersil-Keystone, Bellefonte, PA) using the ÄKTA prime HPLC system (Amersham Biosciences) and water-acetonitrile gradients with 20 mM NH4HCO3 (0–40% acetonitrile in 40 min at 0.5 ml/min flow collecting 0.15-ml fractions to isolate Gal-GalNAcol and NeuAc-Gal-GalNAcol; 0–40% acetonitrile in 80 min at 0.5 ml/min flow collecting 0.4-ml fractions to isolate NeuAc-Gal-(NeuAc-)GalNAcol). Eluted oligosaccharides were detected by UV absorption (206 nm) and fractions corresponding to individual peaks in the chromatograms were pooled. Identity and purity of the oligosaccharides were controlled by nano ESI-MS, and their concentration determined by monosaccharide composition analysis (Karlsson and Hansson, 1995Go). The mean of the Gal and the GalNAcol molar concentrations (mean of two analyses) was used to calculate the oligosaccharide concentration.

N-terminal sequencing and evaluation of site-specific glycan substitution
N-terminal sequencing of purified enterokinase-digested MUC1(1.7TR)-IgG2a by Edman degradation was performed on a 492 Procise Sequencer (Applied Biosystems, Foster City, CA). Samples were applied by adsorption of sample solution (0.3–3 pmol/µl) to TFA-resistant filters (Applied Biosystems). A pulsed-liquid standard procedure was used, with exception of cycles 6, 8, 13, 14, 22, 26, 28, 33, and 34, where TFA release was performed at 53°C to increase the yield of proline. The amount (in pmoles) of nonglycosylated amino acid resulting from each cycle was obtained from the lag-corrected values given by the machine's software. A hypothetical expected amount was calculated for each cycle corresponding to the amount that would result from a totally nonglycosylated amino acid population. This value was based on the repetitive yield and on the amount of sample applied at the start. The level of glycan substitution at each glycosylation site was determined from the loss of Ser or Thr signal, judged by the ratio of obtained signal to expected signal.

Preparation of MUC1TR-XL glycopeptides containing one TR of MUC1 and five adjacent amino acids
Three hundred picomoles of MUC1(1.7TR)-IgG2a in spent culture medium was bound to 100 µl anti-mouse Ig agarose beads (Sigma-Aldrich) and then proteolytically digested and deglycosylated using sequential incubations at 37°C with 2 U Enterokinase Max in 50 mM Tris–HCl (pH 8.0) with 1 mM CaCl2 and 0.1% Tween-20 for 22 h; 4 mU Vibrio cholerae neuraminidase (Roche, Indianapolis, IN) in 0.05 M sodium acetate (pH 5.5) with 4 mM CaCl2 and 100 µg/ml bovine serum albumin for 22 h; and 4 mU ß-galactosidase (bovine testes, Sigma-Aldrich) in 0.1 M citrate phosphate buffer (pH 5.0) for 44 h with 4 mU fresh enzyme added after 22 h. The partially deglycosylated protein was released from the agarose beads using 0.1 M glycin-HCl, pH 2.4, 0.15 M NaCl, neutralized using 2.5 M Tris–HCl pH 10, dialyzed against H2O in a Slide-A-Lyzer cassette (Pierce), lyophilized, and dissolved in 25 mM sodium phosphate (pH 7.6), 0.2 mM CaCl2. One unit Clostripain (Sigma-Aldrich), which had been preactivated with 2.5 mM dithiothreitol for 4 h at 20–25°C, was added and allowed to digest the protein for 20 h at 37°C. The reaction mixture was then stored in –20°C until analyzed by nano LC-ESI-MS.

LC-MS
Desalted oligosaccharide alditols were subjected to nano LC-ESI-MS or LC-ESI-MS/MS on a 150 x 0.25 mm ID column packed with 5 µm Hypercarb particles (Thermo-Hypersil, Runcorn, UK). HPLC was performed using an HP1100 binary pump (Hewlett-Packard, Palo Alto, CA) delivering 200 µl/min, and the flow was splitted in a Valco Tee (VICI, Schenkon, Switzerland) using a 40 cm x 50 µm ID fused silica tubing as a restrictor, down to a flow rate of 5 µl/min through the column. A water-acetonitrile gradient (0–40% acetonitrile in 40 min) with 5 mM NH4HCO3 was used. The column eluent was transferred via a 50 µm ID fused silica tubing into a nano-LC interface (Micromass, Manchester, UK). ESI-MS and ESI-MS/MS were performed on a Q-TOF1 mass spectrometer (Micromass) in the negative ion mode. Electrospray voltage was –3.5 kV; sample cone voltage was 38 V; sample cone temperature was 100°C; compressed air was used as cone gas at a flow rate of 300 L/h and as nebulizer gas at 3 bar. In LC-MS, full scans were performed over the range m/z 200–1500. The TOF spectrometer was calibrated in the negative ion mode using NaI. For LC-MS/MS, automatic function switching was used for colliding [M-H] ions at intensities higher than 10 counts/s. Argon was used as collision gas with a collision energy of 22 eV for m/z 300–600, 30 eV for m/z 600–900, 45 eV for m/z 900–1100, and 60 eV for m/z 1100–2000. Full scans were performed over the range m/z 100–1500.

MUC1TR-XL glycopeptides were analyzed by nano LC-ESI-MS in the positive ion mode. Glycopeptides, 0.4 µl of 20 µl, were injected using a Microinjection valve M-435 (Upchurch Scientific, Oak Harbor, WA) into a fused-silica 120 x 0.075 mm ID column, packed with Kromasil C18-bonded 3.5 µm porous particles (100 Å, Eka Chemicals, Bohus, Sweden). PEEK tubing 400 µm ID (Upchurch Scientific) was used to seal the fused-silica column in a 1.58-mm Valco through-bore union (Valco Instruments, Houston, TX) against a 2 µm steel screen (Valco). A tapered emitter tip made by fused-silica (150 µm OD, 20 µm ID, Polymicro Technologies, Phoenix, AZ) was connected to the union by an in-house interface using 150 µm ID PEEK tubing. The flow rate was splitted down to 250 nl/min. A gradient of 0–50% acetonitrile in 0.1% formic acid (1% acetonitrile/min) was used. The electrospray capillary voltage was +3.2 kV; sample cone voltage was +40 V; sample cone temperature was 80°C; nitrogen was used as cone gas at a flow rate of 250 L/h and as nebulizer gas at 2 bar. Full scans were performed over the range m/z 400–1500. Mass chromatograms for [M+3H]3+ for the different MUC1 glycopeptides were generated and the peaks integrated using MassLynx 3.4. For LC-MS/MS, selected ions were collided using argon as collision gas with a collision energy of 35 eV for m/z 1045 and m/z 1113 and 40 eV for m/z 1181 and m/z 1248. Full scans were performed over the range m/z 100–2000.


    Acknowledgements
 
Drs. Eric Bennett and Henrik Clausen are acknowledged for the recombinant GalNAc-T4 expression vectors and helpful discussions. Dr. Ulla Mandel is acknowledged for the UH6 antibody. Drs. Niclas Karlsson and Haike Leibiger are acknowledged for the initial cloning of the reported plasmid. This work was supported by the Glycoconjugates in Biological Systems program sponsored by the Swedish Foundation for Strategic Research, the Swedish Research Council Grant no. 07461, the IngaBritt and Arne Lundberg Foundation, and EU grants QLK3-CT-1999-00217 and QLQ3-CT-2002-02010.


    Abbreviations
 
CHO, Chinese hamster ovary; DELFIA, dissociation-enhanced lanthanide fluoroimmunoassay; ESI, electrospray ionization; HPLC, high-performance liquid chromatography; LC, liquid chromatography; MS, mass spectrometry; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; TR, tandem repeat; VNTR, variable number of tandem repeats


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Amano, J., Straehl, P., Berger, E.G., Kochibe, N., and Kobata, A. (1991) Structures of mucin-type sugar chains of the galactosyltransferase purified from human milk. Occurrence of the ABO and Lewis blood group determinants. J. Biol. Chem., 266, 11461–11477.[Abstract/Free Full Text]

Axelsson, M.A., Asker, N., and Hansson, G.C. (1998) O-glycosylated MUC2 monomer and dimer from LS 174T cells are water-soluble, whereas larger MUC2 species formed early during biosynthesis are insoluble and contain nonreducible intermolecular bonds. J. Biol. Chem., 273, 18864–18870.[Abstract/Free Full Text]

Bäckström, M., Link, T., Olson, F.J., Karlsson, H., Graham, R., Picco, G., Burchell, J., Taylor-Papadimitriou, J., Noll, T., and Hansson, G.C. (2003) Recombinant MUC1 mucin with a breast cancer-like O-glycosylation produced in large amounts in Chinese hamster ovary cells. Biochem. J., 376, 677–686.[CrossRef][Web of Science][Medline]

Baeckstrom, D., Hansson, G.C., Nilsson, O., Johansson, C., Gendler, S.J., and Lindholm, L. (1991) Purification and characterization of a membrane-bound and a secreted mucin-type glycoprotein carrying the carcinoma-associated sialyl-Lea epitope on distinct core proteins. J. Biol. Chem., 266, 21537–21547.[Abstract/Free Full Text]

Bennett, E.P., Hassan, H., and Clausen, H. (1996) cDNA cloning and expression of a novel human UDP-N-acetyl-alpha-D-galactosamine. Polypeptide N-acetylgalactosaminyltransferase, GalNAc-t3. J. Biol. Chem., 271, 17006–17012.[Abstract/Free Full Text]

Bennett, E.P., Hassan, H., Mandel, U., Mirgorodskaya, E., Roepstorff, P., Burchell, J., Taylor-Papadimitriou, J., Hollingsworth, M.A., Merkx, G., van Kessel, A.G., and others. (1998) Cloning of a human UDP-N-acetyl-alpha-D-Galactosamine:polypeptide N-acetylgalactosaminyltransferase that complements other GalNAc-transferases in complete O-glycosylation of the MUC1 tandem repeat. J. Biol. Chem., 273, 30472–30481.[Abstract/Free Full Text]

Burchell, J., Poulsom, R., Hanby, A., Whitehouse, C., Cooper, L., Clausen, H., Miles, D., and Taylor-Papadimitriou, J. (1999) An alpha2,3 sialyltransferase (ST3Gal I) is elevated in primary breast carcinomas. Glycobiology, 9, 1307–1311.[Abstract/Free Full Text]

Carlstedt, I., Herrmann, A., Karlsson, H., Sheehan, J., Fransson, L.A., and Hansson, G.C. (1993) Characterization of two different glycosylated domains from the insoluble mucin complex of rat small intestine. J. Biol. Chem., 268, 18771–18781.[Abstract/Free Full Text]

Domon, B. and Costello, C.E. (1988) A systematic nomenclature for carbohydrate fragmentations in FAB-MS/MS spectra of glycoconjugates. Glycoconj. J., 5, 397–409.[CrossRef][Web of Science]

Gendler, S.J. (2001) MUC1, the renaissance molecule. J. Mamm. Gland Biol. Neoplasia, 6, 339–353.[CrossRef][Web of Science][Medline]

Gerken, T.A., Owens, C.L., and Pasumarthy, M. (1997) Determination of the site-specific O-glycosylation pattern of the porcine submaxillary mucin tandem repeat glycopeptide. Model proposed for the polypeptide:galnac transferase peptide binding site. J. Biol. Chem., 272, 9709–9719.[Abstract/Free Full Text]

Gerken, T.A., Owens, C.L., and Pasumarthy, M. (1998) Site-specific core 1 O-glycosylation pattern of the porcine submaxillary gland mucin tandem repeat. Evidence for the modulation of glycan length by peptide sequence. J. Biol. Chem., 273, 26580–26588.[Abstract/Free Full Text]

Gerken, T.A., Zhang, J., Levine, J., and Elhammer, A. (2002) Mucin core O-glycosylation is modulated by neighboring residue glycosylation status. Kinetic modeling of the site-specific glycosylation of the apo-porcine submaxillary mucin tandem repeat by UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases T1 and T2. J. Biol. Chem., 277, 49850–49862.[Abstract/Free Full Text]

Girling, A., Bartkova, J., Burchell, J., Gendler, S., Gillett, C., and Taylor-Papadimitriou, J. (1989) A core protein epitope of the polymorphic epithelial mucin detected by the monoclonal antibody SM-3 is selectively exposed in a range of primary carcinomas. Int. J. Cancer, 43, 1072–1076.[Web of Science][Medline]

Hagen, F.K., Hazes, B., Raffo, R., deSa, D., and Tabak, L.A. (1999) Structure-function analysis of the UDP-N-acetyl-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase. Essential residues lie in a predicted active site cleft resembling a lactose repressor fold. J. Biol. Chem., 274, 6797–6803.[Abstract/Free Full Text]

Hanisch, F.G., Uhlenbruck, G., Peter-Katalinic, J., Egge, H., Dabrowski, J., and Dabrowski, U. (1989) Structures of neutral O-linked polylactosaminoglycans on human skim milk mucins. A novel type of linearly extended poly-N-acetyllactosamine backbones with Gal beta(1-4) GlcNAc beta(1-6) repeating units. J. Biol. Chem., 264, 872–883.[Abstract/Free Full Text]

Hanisch, F.G., Peter-Katalinic, J., Egge, H., Dabrowski, U., and Uhlenbruck, G. (1990) Structures of acidic O-linked polylactosaminoglycans on human skim milk mucins. Glycoconj. J., 7, 525–543.[CrossRef][Web of Science][Medline]

Hanisch, F.G., Stadie, T.R., Deutzmann, F., and Peter-Katalinic, J. (1996) MUC1 glycoforms in breast cancer–cell line T47D as a model for carcinoma-associated alterations of O-glycosylation. Eur. J. Biochem., 236, 318–327.[Web of Science][Medline]

Hanisch, F.G., Jovanovic, M., and Peter-Katalinic, J. (2001a) Glycoprotein identification and localization of O-glycosylation sites by mass spectrometric analysis of deglycosylated/alkylaminylated peptide fragments. Anal. Biochem., 290, 47–59.[CrossRef][Web of Science][Medline]

Hanisch, F.G., Reis, C.A., Clausen, H., and Paulsen, H. (2001b) Evidence for glycosylation-dependent activities of polypeptide N-acetylgalactosaminyltransferases rGalNAc-T2 and -T4 on mucin glycopeptides. Glycobiology, 11, 731–740.[Abstract/Free Full Text]

Hassan, H., Reis, C.A., Bennett, E.P., Mirgorodskaya, E., Roepstorff, P., Hollingsworth, M.A., Burchell, J., Taylor-Papadimitriou, J., and Clausen, H. (2000) The lectin domain of UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase-T4 directs its glycopeptide specificities. J. Biol. Chem., 275, 38197–38205.[Abstract/Free Full Text]

Hull, S.R., Bright, A., Carraway, K.L., Abe, M., Hayes, D.F., and Kufe, D.W. (1989) Oligosaccharide differences in the DF3 sialomucin antigen from normal human milk and the BT-20 human breast carcinoma cell line. Cancer Commun., 1, 261–267.[Medline]

Inoue, N., Takeuchi, M., Asano, K., Shimizu, R., Takasaki, S., and Kobata, A. (1993) Structures of mucin-type sugar chains on human erythropoietins purified from urine and the culture medium of recombinant Chinese hamster ovary cells. Arch. Biochem. Biophys., 301, 375–378.[CrossRef][Medline]

Karlsson, N.G. and Hansson, G.C. (1995) Analysis of monosaccharide composition of mucin oligosaccharide alditols by high-performance anion-exchange chromatography. Anal. Biochem., 224, 538–541.[CrossRef][Web of Science][Medline]

Li, F., Wilkins, P.P., Crawley, S., Weinstein, J., Cummings, R.D., and McEver, R.P. (1996) Post-translational modifications of recombinant P-selectin glycoprotein ligand-1 required for binding to P- and E-selectin. J. Biol. Chem., 271, 3255–3264.[Abstract/Free Full Text]

Lloyd, K.O., Burchell, J.M., Kudryashov, V., Yin, B.W.T., and Taylor-Papadimitriou, J. (1996) Comparison of O-linked carbohydrate chains in MUC 1 mucin from normal breast epithelial cell lines and breast carcinoma cell lines: demonstration of a simpler and fewer glycan chains in tumor cells. J. Biol. Chem., 271, 33325–33334.[Abstract/Free Full Text]

Moniaux, N., Escande, F., Porchet, N., Aubert, J.P., and Batra, S.K. (2001) Structural organization and classification of the human mucin genes. Front. Biosci., 6, D1192–1206.[Web of Science][Medline]

Muller, S. and Hanisch, F.G. (2002) Recombinant MUC1 probe authentically reflects cell-specific O-glycosylation profiles of endogenous breast cancer mucin. J. Biol. Chem., 277, 26103–26112.[Abstract/Free Full Text]

Muller, S., Goletz, S., Packer, N., Gooley, A., Lawson, A.M., and Hanisch, F.G. (1997) Localization of O-glycosylation sites on glycopeptide fragments from lactation-associated MUC1. All putative sites within the tandem repeat are glycosylation targets in vivo. J. Biol. Chem., 272, 24780–24793.[Abstract/Free Full Text]

Nehrke, K., Hagen, F.K., and Tabak, L.A. (1996) Charge distribution of flanking amino acids influences O-glycan acquisition in vivo. J. Biol. Chem., 271, 7061–7065.[Abstract/Free Full Text]

Nehrke, K., Hagen, F.K., and Tabak, L.A. (1998) Isoform-specific O-glycosylation by murine UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-T3, in vivo. Glycobiology, 8, 367–371.[Abstract/Free Full Text]

Perez-Vilar, J. and Hill, R.L. (1999) The structure and assembly of secreted mucins. J. Biol. Chem., 274, 31751–31754.[Free Full Text]

Sasaki, H., Bothner, B., Dell, A., and Fukuda, M. (1987) Carbohydrate structure of erythropoietin expressed in Chinese hamster ovary cells by a human erythropoietin cDNA. J. Biol. Chem., 262, 12059–12076.[Abstract/Free Full Text]

Schulz, B.L., Packer, N.H., and Karlsson, N.G. (2002) Small scale analysis of O-linked oligosaccharides from glycoproteins and mucins separated by gel electrophoresis. Anal. Chem., 74, 6088–6097.[Medline]

Topaz, O., Shurman, D.L., Bergman, R., Indelman, M., Ratajczak, P., Mizrachi, M., Khamaysi, Z., Behar, D., Petronius, D., Friedman, V., and others. (2004) Mutations in GALNT3, encoding a protein involved in O-linked glycosylation, cause familial tumoral calcinosis. Nat. Genetics, 36, 579–581.[CrossRef][Web of Science][Medline]

Wandall, H.H., Hassan, H., Mirgorodskaya, E., Kristensen, A.K., Roepstorff, P., Bennett, E.P., Nielsen, P.A., Hollingsworth, M.A., Burchell, J., Taylor-Papadimitriou, J., and Clausen, H. (1997) Substrate specificities of three members of the human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase family, GalNAc-T1, -T2, and -T3. J. Biol. Chem., 272, 23503–23514.[Abstract/Free Full Text]

Zhang, Y., Iwasaki, H., Wang, H., Kudo, T., Kalka, T.B., Hennet, T., Kubota, T., Cheng, L., Inaba, N., Gotoh, M., and others. (2003) Cloning and characterization of a new human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase, designated pp-GalNAc-T13, that is specifically expressed in neurons and synthesizes GalNAc alpha-serine/threonine antigen. J. Biol. Chem., 278, 573–584.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
C. Sihlbom, I. van Dijk Hard, M. E Lidell, T. Noll, G. C Hansson, and M. Backstrom
Localization of O-glycans in MUC1 glycoproteins using electron-capture dissociation fragmentation mass spectrometry
Glycobiology, April 1, 2009; 19(4): 375 - 381.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
J. Holgersson and J. Lofling
Glycosyltransferases involved in type 1 chain and Lewis antigen biosynthesis exhibit glycan and core chain specificity
Glycobiology, July 1, 2006; 16(7): 584 - 593.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Sewell, M. Backstrom, M. Dalziel, S. Gschmeissner, H. Karlsson, T. Noll, J. Gatgens, H. Clausen, G. C. Hansson, J. Burchell, et al.
The ST6GalNAc-I Sialyltransferase Localizes throughout the Golgi and Is Responsible for the Synthesis of the Tumor-associated Sialyl-Tn O-Glycan in Human Breast Cancer
J. Biol. Chem., February 10, 2006; 281(6): 3586 - 3594.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/2/177    most recent
cwh158v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Right arrowScopus Links
Google Scholar
Right arrow Articles by Olson, F. J.
Right arrow Articles by Hansson, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olson, F. J.
Right arrow Articles by Hansson, G. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?