Glycobiology Advance Access originally published online on August 11, 2005
Glycobiology 2005 15(12):1407-1415; doi:10.1093/glycob/cwj026
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© Published by Oxford University Press 2005.
Two oligosaccharyl transferase complexes exist in yeast and associate with two different translocons
Department of Biochemistry and Cell Biology and the Institute for Cell and Developmental Biology, State University of New York, Stony Brook, NY 11794-5215
1 To whom correspondence should be addressed; e-mail: wlennarz{at}notes.cc.sunysb.edu
Received on July 5, 2005; revised on August 3, 2005; accepted on August 3, 2005
| Abstract |
|---|
|
|
|---|
Oligosaccharyl transferase (OT) scans and selectively glycosylates Asn-X-Thr/Ser-motifs in nascent polypeptide chains in the endoplasmic reticulum (ER). Several groups have reported different results for the composition of this enzyme complex. In this study, using a membrane protein two-hybrid approach, the split-ubiquitin system, we show that except for Ost3p and Ost6p, all of the other subunits of OT exist as dimers or oligomers in the yeast, Saccharomyces cerevisiae. Ost3p and Ost6p behave strikingly similar in a series of genetic and biochemical assays, but clearly do not exist in the same OT complex. This observation, as well as the results in an accompanying study to analyze the composition of OT complex by blue native gel electrophoresis using a series of wild-type and mutant yeast strains strongly suggests that two isoforms of the OT complex exist in the ER, differing only in the presence of Ost3p or Ost6p. Each of these two isoforms of the OT complex specifically interacts with two structurally similar, but functionally different translocon complexes: the Sec61 and the Ssh1 translocon complexes.
Key words: oligosaccharyl transferase / Sec61 translocon / split-ubiquitin system / Ssh1 translocon
| Introduction |
|---|
|
|
|---|
In eukaryotic cells, secreted and membrane-bound proteins are synthesized and sorted via the secretory pathway. Protein processing in this pathway is critical to the organization and functioning of eukaryotic cells. The initial step of this pathway involves protein synthesis on ribosomes bound to rough ER and cotranslational protein translocation across the ER membrane (Walter and Johnson, 1994
Because more than 70% of all proteins processed by this pathway are N-glycosylated (Dempski and Imperiali, 2002
), another protein complex which plays a critical role at the initial step of the secretory pathway is oligosaccharyl transferase (OT) complex. It scans and acts on the tripeptidyl motif of -Asn-X-Thr/Ser- on the nascent polypeptide chain as soon as this consensus sequence emerges from the translocon channel. OT catalyzes the transfer of a high mannose oligosaccharide chain from a dolichol-linked pyrophosphate to the side chain of asparagine to form N-linked glycoproteins (Karaoglu et al., 1995b
; Knauer and Lehle, 1999; Yan and Lennarz, 2005
). Because the addition and subsequent processing of the carbohydrate chains is crucial for the folding, stability, and maturation of many glycoproteins, the OT complex has been referred to as the gatekeeper to the secretory pathway (Dempski and Imperiali, 2002
).
The OT is highly conserved in all eukaryotic systems. It has been established that in both higher eukaryotes and yeast, the enzyme is composed of multiple, nonidentical membrane protein subunits. In the yeast Saccharomyces cerevisiae, nine different genes encoding the OT subunits have been cloned and identified. Among them, the genes encoding Ost1p, Ost2p, Stt3p, Wbp1p, and Swplp are essential for the viability of the cell; the gene encoding Ost4p is essential for growth of the cell at 37°C, but not at 25°C; Ost3p, Ost5p, Ost6p subunits are not essential for the viability of the cell, but are required for maximal activity of OT in vivo and in vitro (Karaoglu et al., 1995b
; Knauer and Lehle, 1999b; Yan and Lennarz, 2005
). It is known that OT functions as an enzyme complex because multiple components have been detected from the biochemically purified enzyme fractions that are isolated from a variety of organisms (Kelleher et al., 1992
; Kelleher and Gilmore, 1994
; Kumar et al., 1994
, 1995a
,b
; Pathak and Imperiali, 1997
). However, the exact composition of the isolated enzyme complex differed when different detergent solutions were used by these investigators. Coimmunoprecipitation experiments revealed that immuno-affinitive reaction against the HA epitope at the C-terminus of Ost3p results in coprecipitation of Ost1p, Ost2p, Ost4p, Ost5p, Wbp1p, Swp1p, and Stt3p in nondenaturing solutions (1.5% digitonin) (Karaoglu et al., 1997
). Thus, it was proposed that yeast OT is composed of eight subunits in approximately equimolar amounts (Karaoglu et al., 1997
).
Recently, several studies have demonstrated that mammalian organisms do not have only one OT, but instead express several OST (oligosaccharyl transferase) isoforms (Kelleher et al., 2003
; Shibatani et al., 2005
). Kelleher and coworkers (Kelleher et al., 2003
) showed that canine microsomes contain two isoforms of the OST complex. They differ with respect to the STT3-A or STT3-B subunits in the central core complex and the presence of N33 (homologue of yeast Ost3p) or IAP (homologue of yeast Ost6p) which peripherally associate with STT3-A or STT3-B respectively. These two forms of the OST complex differ in terms of their activity, as well as the ability to discriminate between donor substrates with different oligosaccharide structures. In addition to the OT complex, several of the other enzyme complexes which are involved in the protein translocation across the ER membrane, such as SR and RAMP4 were also proposed to exist in more than one form (Wang and Dobberstein, 1999
). These observations prompted us to ask whether yeast also contains different isoforms of the OT complex and if so, how do they functionally coordinate with other enzyme complexes that are involved in the initial steps of secretory pathway.
Using a yeast membrane protein two-hybrid approach, namely the split-ubiquitin system, we found that except for Ost3p and Ost6p, a second set of all the other OT subunits exists. Further, we found that Ost3p and Ost6p display virtually the same interaction pattern with all the other OT subunits, but these two proteins themselves are not present in the same OT complex. This finding combined with those of the accompanying study (Spirig et al., 2005) of the OT complex using blue native gel electrophoresis suggest that indeed two isoforms of OT complex exist in the ER. One complex contains Ost3p but not of Ost6p, and a secondary contains Ost6p but not Ost3p. The functional implication of the two isoforms of OT complex was examined, and they were found to associate with two structurally similar but functionally different translocon complexes.
| Results |
|---|
|
|
|---|
In a previous study, we utilized the split-ubiqutin system to investigate the topological features as well as the pair-wise in vivo interactions of all yeast OT subunits, and it was demonstrated that OT subunit proteins display specific interactions with each other in a functional complex (Yan et al., 2005
OT subunits in the ER
As shown in Figure 1A, two series of plasmids were generated: pRS315-X-Cub-PLV, in which X-Cub-PLVp is expressed and pRS314-X-NubGp, in which X-NubGp is expressed, where X is Ost1p, Ost3p, Ost4p, Ost5p, Ost6p, Wbp1p or Swp1p. Each pair of these plasmids was subsequently introduced into the L40 strain. To verify that this approach can detect dimerization of proteins, we first analyzed another protein, Alg1p. Alg1p is an enzyme of the ER that catalyzes the addition of the first mannosyl residue to GlcNAc2-PP-Dol in the assembly of full length lipid-linked oligosaccharides (Albright and Robbins, 1990
). Gao and coworkers have shown that Alg1p exists as a dimer in yeast by gel filtration and coimmunoprecipitation analysis (Gao et al., 2004
). To measure its dimerization by the split-ubiquitin system, we constructed pRS315-Alg1-Cub-PLV and pRS314-Alg1-NubG and cotransformed these two plasmids into L40 strain. The transformant was subjected to ß-gal activity and growth analysis on His plates. As can be seen in Figure 2 (lane 3), coexpression of Alg1-Cub-PLVp with Alg1-NubGp yielded positive ß-gal activity and growth onHis plate, indicating these two tagged forms of the same protein indeed interact with each other in the split-ubiqutin analysis. This observation suggests that split-ubiquitin assay is applicable to study protein dimerization or oligomerization. We next analyzed the transformants bearing the pair of the Cub and NubG fused Ost1p, Ost4p, Ost5p, Wbp1p or Swp1p. Surprisingly, as shown in Figure 2A and B (lanes 4, 6, 7, 9, and 10), all of them exhibited positive ß-gal activity and growth capability on His plate, indicating that all of these proteins are able to dimerize or oligomerize. The only two subunits which distinctly showed negative results in the analysis were Ost3p and Ost6p (Figure 2A and B; lanes 5 and 8).
|
|
|
Because Ost2p and Stt3p have their C-termini located in the ER lumen (Yan et al., 2005
Identical interaction of Ost3p and Ost6p
We examined the in vivo interaction between Ost3p with all the other OT subunits and between Ost6p with all the other OT subunits. We introduced a series of plasmids which expressing NubG fused OT subunit proteins, Ost1-NubGp, NubG-Ost2p, Ost4-NubGp, Ost5-NubGp, Ost6-NubGp, Wbp1-NubGp, Swp1-NubGp or NubG-Stt3p (Yan et al., 2005
), into the strain that either expressed Ost3-Cub-PLVp or Ost6-Cub-PLVp and analyzed the ß-gal activity of the corresponding transformants. As demonstrated in Figure 3A and B, Ost3p interacted with Ost1p, Ost2p, Ost4p, Wbp1p, and Stt3p (lanes 3, 4, 5, 8, 10) in vivo. Strikingly, Ost6p also only interacted with these OT subunits (Figure 3C and D; lanes 3, 4, 6, 8, 10); like Ost3p (Figure 3A and B; lanes 6 and 9), Ost6p did not interact with Ost5p and Swp1p (Figure 3C and D; lanes 7 and 9). Interestingly, Ost3p and Ost6p did not interact with each other (Figure 3A and B, lane 7, and Figure 3C and D, lane 5), nor did they coimmunoprecipitate with each other in agreement with a previous study (Yan et al., 2003
), suggesting that they are not in the same protein complex. However, both Ost3p and Ost6p have been clearly shown to be involved in the catalytic process of protein N-glycosylation (Karaoglu et al., 1995a
; Knauer and Lehle, 1999a). Because they are not present in the same protein complex but behave similarly in terms of their interaction with all the other OT subunits, we speculate that probably two forms of OT complex exist in the ER membrane in yeast, and Ost3p and Ost6p might be involved in distinguishing these different isoforms of OT.
Coimmunoprecipitation with Ost6p
Karaoglu and coworkers (Karaoglu et al., 1997
) have shown that coimmunoprecipitation of the cell lysate of a strain where Ost3p is HA tagged results in precipitation of all other OT subunits except Ost6p, suggesting that Ost6p does not exist in the OT complex containing Ost3p. To test our idea that the other form of the OT complex distinguished by Ost6p exists, we carried out similar experiments on Ost6p. We performed coimmunoprecipitation on microsomes isolated from the strain OST6HA under the same conditions as Karaoglu and coworkers used. western blot analysis of the coprecipitated samples using anti-Ost1p, Wbp1p, Stt3p, and Swp1p respectively (Figure 4A, lanes 14) indicated that Ost6p coprecipitated with these four proteins. As for Ost2p, Ost3p, Ost4p, and Ost5p, for which antibodies are not available, we utilized previously described epitope-tagged strains (Yan et al., 2003
): OST6HA OST2myc, OST6myc OST3HA, OST6HA OST4myc as well as OST6myc OST5HA, and their corresponding antibodies as indicated in Figure 4B and C. As can be seen, Ost6p also coprecipitated with Ost2p, Ost4p, and Ost5p (lanes 5, 6, and 8). The only subunit which did not coprecipitate with Ost6HAp was Ost3p (lane 7). This result suggests that Ost3p does not exist in the same OT complex that contains Ost6p.
|
Ost3p and Ost6p share 20% sequence identity and 46% sequence similarity with each other and display strikingly similar hydropathy plots (Knauer and Lehle, 1999a). Previous genetic studies revealed that disruption of either ost3 or ost6 causes only a minor defect in N-glycosylation, whereas a
ost3
ost6 double mutant displays a very severe under-glycosylation phenotype for both soluble and membrane-bound glycoproteins (Knauer and Lehle, 1999a), suggesting that these two proteins play similar or redundant roles in the cell. Taken together, these findings as well as our observations described above strongly indicated that two isoforms of OT complex exist in the yeast, and Ost3p or Ost6p distinguishes each of them. In fact, in the accompanying study, the blue native gel electrophoresis analysis on OT complex using wild-type strain,
ost3
ost6 double deletion strain as well as the
ost3
ost6 double deletion strain transformed with pOST3 and the
ost3
ost6 double deletion strain transformed with pOST6 revealed that there are two distinct OT complexes existing in the ER (Spirig et al., 2005). One form contains Ost3p and lacks Ost6p (termed complex Ia), and a second form contains Ost6p but lacks Ost3p (termed complex Ib).
Coordination between two OT complexes and two translocon complexes
If indeed there are two isoforms of OT complex in the cell, what is the function of each of them? Two models can be proposed to explain the findings mentioned above. One model is that these two isoforms of OT complex exist in the ER membrane simultaneously, and they bear distinct functions. For instance, they may catalyze the N-glycosylation of different classes of substrates. The other possibility is that only one form of OT complex exists in the ER membrane at one time. Under this circumstance, Ost3p and Ost6p shuffle or compete with each other at the same position of the OT complex, and therefore the existence of two isoforms of OT is dynamically regulated.
To investigate which model might best represent the process in yeast cells, we examined the specific interactions between Ost3p or Ost6p with certain components of the translocon complexes. It has been established that protein translocation across the ER membrane can occur by two different pathways, a co- and a posttranslational pathway. In the cotranslational protein translocation pathway, a wealth of data has demonstrated that the trimeric Sec61 complex represents the core of the translocation machinery in the ER membrane. The complex is composed of Sec61p, Sbh1p, and Sss1p, which are homologous to the
-, ß- and
-subunits of the mammalian Sec61 complex, respectively (Walter and Johnson, 1994
; Rapoport et al., 1996
; Alder and Johnson, 2004
). In yeast, a second complex with high similarity to the trimeric Sec61p complex, the Ssh1p complex, has been described (Finke et al., 1996
). In this complex, Ssh1p shares 34% identity with Sec61p; Sbh2p shares sequence similarity with Sbh1p; and Sss1p is present in both trimeric complexes as the
-subunit (Finke et al., 1996
). The function of Ssh1p complex was not immediately evident, but it is distinct from the Sec61p complex. Recently, the Ssh1p trimeric complex was shown to be also involved in the cotranslational pathway of protein transport across the ER membrane and recognize proteins which bear a strong hydrophobic signal sequence (Wittke et al., 2002
). Because OT must be engaged in the process of cotranslational protein translocation to scan and glycosylate selective -Asn-X-Thr/Ser- consensus sequences in a nascent polypeptide chain, we asked whether the structurally similar but functionally different two translocons might specifically associate with different isoforms of OT complex.
To test this idea, we studied the possible specific interactions of the two translocons with Ost3p or Ost6p. Because the two translocons share the same
-subunit, Sss1p, it can not be used to define the specificity between two translocons and two isoforms of OT complex. We therefore focused on the
- and ß-subunits. In the case of the
-subunit in the two translocons: Sec61p or Ssh1p, it has been reported that they form the protein-conducting channel in their own translocon complex. Because all the membrane-bound proteins, including those proteins of the ER itself are initially delivered to the ER via the protein-conducting channel formed by either the Sec61p or Ssh1p, it is highly likely that these proteins transiently interact with the conducting channel during the process of translocation. As a consequence, even if there is specific interaction between Ost3p or Ost6p with Ssh1p or Sec61p, it would be difficult to define whether this interaction takes place transiently during the translocation of Ost3p and Ost6p or after their stable incorporation into the functional OT complex. In contrast, the ß-subunit of the two translocons, Sbh1p and Sbh2p, are known to be distinct and not replaceable by each other (Finke et al., 1996
). Therefore, we analyzed the interactions between Ost3p and Ost6p with Sbh1p or Sbh2p.
To accomplish this, we constructed yeast strains that express Sbh1-Cub-PLVp or Sbh2-Cub-PLVp and transformed each of them with plasmids expressing Ost3-NubGp or Ost6-NubGp. As shown in Figure 5A and B, Ost3p specifically interacts with Sbh1p (lane 2) but does not interact with Sbh2p (lane 5), whereas Ost6p specifically interacts with Sbh2p (lane 6), but not with Sbh1p in vivo (lane 3). To detect the specific interaction between Ost3p with Sbh1p and between Ost6p with Sbh2p, we also carried out a cross-linking study as previously described (Yan et al., 2003
) using microsomes isolated from the strains OST3HA and OST6HA. Consistent with our observations in the split-ubiquitin system, Ost3p could be cross-linked to Sbh1p (Figure 5C, lane 2), but not to Sbh2p (data not shown). The converse result was observed for Ost6p (Figure 5C, lane 4), that is, Ost6p is specifically cross-linked to Sbh2p but not to Sbh1p.
|
|
To further test the specificity of the interaction between Ost3p and Sbh1p and between Ost6p and Sbh2p, we examined the interaction between Sbh1p or Sbh2p with OT subunits other than Ost3p and Ost6p using the split-ubiquitin system. As can be seen in Figure 6A, Sbh1p interacts with Ost1p, Ost2p, Ost4p, and Wbp1p (lanes 3, 4, 5, and 7), but not Ost5p, Swp1p, and Stt3p (lanes 6, 8, and 9). Similarly, as shown in Figure 6B, Sbh2p was also found to interact with Ost1p, Ost2p, Ost4p, and Wbp1p (lanes 3, 4, 5, and 7), but not with Ost5p, Swp1p, and Stt3p (lanes 6, 8, and 9). Therefore, the only difference in the interaction pattern between Sbh1p or Sbh2p with OT subunits is that Sbh1p interacts with Ost3p but not Ost6p and, Sbh2p interacts with Ost6p but not Ost3p. These results together strongly suggest that the two isoforms of OT complex which are distinct by the presence of Ost3p or Ost6p specifically associate with the two translocon complexes involved in the cotranslational protein translocation into the ER membrane. The isoform of OT complex defined by the presence of Ost3p associates with the Sec61p translocon complex and the other isoform containing Ost6p associates with the Ssh1p translocon complex. Because the ß-subunit of these two translocons, Sbh1p and Sbh2p, are not replaceable by each other (Finke et al., 1996
|
| Discussion |
|---|
|
|
|---|
Using extensive genetic and biochemical approaches combined with accompanying study using blue native gel electrophoresis (see accompanying studies by Spirig et al.), we have clearly shown that there are indeed two distinct isoforms of OT complex existing in the yeast S. cerevisiae. One form contains Ost3p but lacks Ost6p, and the other form contains Ost6p but lacks Ost3p. We also demonstrated that these two OT complexes coordinate with two structurally similar but functionally different translocons. The Sec61 trimeric translocon is the primary protein-conducting channel in the ER membrane that participates in both co- and posttranslational protein translocation pathway. The Ssh1 complex was described as the second translocon complex which also binds ribosomes through its cytosolic loops (Finke et al., 1996
We developed a working model for the coordination between two translocons and two different forms of OT complex (Figure 7). However, it is noteworthy that these two translocons are not equivalent in their functioning. Sec61p is essential for the viability of yeast cells, whereas Ssh1p is not. The ssh1 deletion strain displayed only low growth rate compared with the wild-type cell but a combination of
ssh1 with a sec61-2 mutant which alone displayed temperature-sensitive phenotype results in lethality of the cell (Finke et al., 1996
; Ng et al., 1996
), suggesting that Ssh1p is structurally and functionally related with Sec61p but plays a more limited role in protein translocation than Sec61p does. A recent study to monitor the in vivo flux of a variety of signal sequences across the different translocation channels revealed that the Ssh1p recognizes only a subset of proteins bearing signal sequences of high hydrophobic character (Wittke et al., 2002
). Among the signal sequences analyzed: the N-terminal sequences of the
-factor, invertase, CPY and Kar2p, Ssh1p were found to interact with the signal sequences of invertase and Kar2p, whereas Sec61p interacts with all of them (Wittke et al., 2002
). These findings suggest that only a subclass of substrates utilizes the Ssh1-conducting channel when both complexes are present. Because the OT complex which contains Ost6p specifically coordinates with Ssh1p translocon, we assume that it involves in the N-glycosylation of these two proteins as well as others that utilize the Ssh1-conducting channel. In the accompanying study, it was demonstrated that the OT complex which contains Ost6p displays lower activity toward the peptide substrates than the one containing Ost3p in vitro (Spirig et al., 2005). It is not clear, however, why a second protein-conducting channel (Ssh1 trimeric complex) and a second OT complex (the one containing Ost6p) with relatively low activity exist in the cell. One possibility is that the Ssh1 translocon and accompanying OT complex may contribute to maintain a high influx capacity of ER under certain circumstances. Indeed, recently Ssh1p was found to be required to maintain normal translocation as well as dislocation capacities of the yeast endoplasmic reticulum (ER) (Wilkinson et al., 2001
). The
ssh1 cells rapidly adopt a respiratory-deficient phenotype, and this deficiency can be specifically suppressed by reducing or inhibiting the translation of the nascent polypeptides (Wilkinson et al., 2001
). Thus, it is highly likely that the second OT complex, which is defined by the presence of Ost6p, participates in the processing of those glycoproteins which are translocated through the Ssh1p complex.
In this article, we showed that two related gene products, Ost3p and Ost6p, which share 20% sequence identity and 46% similarity as well as a strikingly similar hydropathy plot with each other (Knauer and Lehle, 1999), behave similarly, and seem to play redundant roles in two isoforms of the OT complex. This phenomenon is not rare in yeast. Examples include the ß-subunit of two translocons, Sbh1p and Sbh2p, which share
50% sequence identity with each other and play similar roles in the Sec61 or Ssh1 complex (Finke et al., 1996
); and the SPC subunits Spc1p and Spc2p (Mullins et al., 1996
), as well as their mammalian homology SPC12 and SPC25 (Kalies and Hartmann, 1996
), which also share similar membrane topologies with each other but are functionally distinct. Moreover, this appearance of the related genes with similar functions might not be limited in S. cerevisiae. The Schizosaccharomyces pombe genome contains two SEC61-related sequences (Broughton et al., 1997
) and multiple SEC61-related genes were also found in higher eukaryotes (Wilkinson et al., 2001
). Similar examples include the mammalian homologs of Ost3p and Ost6p, N33 and IAP, respectively (MacGrogan et al., 1996
; Kelleher et al., 2003
).
Previous and current studies to address the interrelationship between OT complex and translocon complex have revealed that subunits of these two juxtaposed complexes interact with each other extensively (Chavan et al., 2005
). An intriguing question is whether they form a super enzyme cluster in the ER membrane? This seems unlikely. We have carried out extensive coimmunoprecipitation and cross-linking experiments between the pair of the OT subunits and between the OT subunits and some subunits of the translocon complex. They were found to display different patterns. Unlike the biochemical behavior of Ost3p or Ost6p with other partners within the OT complex which both coimmunoprecipitate and specifically cross-link with each other (Yan et al., 2003
), Ost3p can only be cross-linked to Sbh1p and can not coprecipitate Sbh1p under nondenaturing conditions. Similar results were observed in the case of Ost6p and Sbh2p, they can be cross-linked with each other by dithiobis-succinimidylpropionate (DSP), but do not coimmunoprecipitate with each other, suggesting that they are in close proximity with each other but not present in the same protein super complex.
Before the isolation and identification of Ost6p, Karaoglu and coworkers studied the composition and stoichiometry of the yeast OT complex by analyzing the relative intensity of radiolabeled polypeptides which were immunoprecipitated from a strain in which Ost3p was HA tagged. The results of this analysis suggested that the OT subunits (Ost1p, Ost2p, Ost3p, Ost4p, Ost5p, Wbp1p, Swp1p, and Stt3p) are present in equimolar amounts in the immunopurified complex (Karaoglu et al., 1997
). Here, our observation suggests that except for Ost3p and Ost6p, a second set of the other OT subunits exist and associate with Ost6p to form another isoform of OT complex. This finding is not completely in conflict with the proposal of Karaoglu and coworkers, because the OT subunits associated with Ost6p were not investigated by Karaoglu and colleagues. As a matter of fact, in this article, we showed that Ost3p and Ost6p do not coimmunoprecipitate with each other under nondenaturing conditions. Therefore, it is likely that the second set of other OT subunits which are associated with Ost6p were not present in the immunopurified complex either. However, at this stage the physiological significance of this dimerization or oligomerization found in the subunits of OT as well as in other complexes such as SR and RAMP4 (Wang and Dobberstein, 1999
) awaits elucidation.
| Materials and methods |
|---|
|
|
|---|
Materials
The cross-linking reagent DSP was purchased from Pierce (Rockford, IL). Antibodies to HA and myc epitopes were purchased from Santa-Cruz biotechnology Inc. (Santa Cruz, CA). Protein G agarose beads were supplied by Invitrogen (Carlsbad, CA).
Plasmids and strains
The plasmids utilized in the split-ubiquitin analysis.
pRS315-OST1-Cub-PLV, pRS315-OST3-Cub-PLV, pRS315-OST4-Cub-PLV, pRS315-OST5-Cub-PLV, pRS315-OST6-Cub-PLV, pRS315-WBP1-Cub-PLV, pRS315-SWP1-Cub-PLV, pRS315-SBH1-Cub-PLV, and pRS315-SBH2-Cub-PLV were generated as previously described. The procedures are described briefly here: the parental plasmid pRS315-Cub-PLV was linearized via the enzyme digestion of HinDIII. Genes of interest were amplified using the yeast genomic DNA as template and two primers, a 5'-end primer complementing 18 nucleotides following the start codon of the gene of interest with the homologous region sequence and a-3'-end primer complementing 18 nucleotides preceding the stop codon of the gene with the homologous segment of that region. The homologous sequences of 50 nucleotides used to construct various Cub-PLV-fused OT subunit genes were (5'CTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTAT-3' and 5'CTTACCGGCAAAGATCAATCTTTGTTGATCTGGAGGGATCCCCCCCGACAT). Genomic DNA was isolated from W3031a strain (MATa ade2 can1 His3 leu2 trp1 ura3). A yeast strain L40 (MATa trp1 leu2 His3 LYS2::lexA-HIS3 URA3::lexA-lacZ) was subsequently cotransformed with 300 ng polymerase chain reaction (PCR) product and 100 ng linearized pRS315-Cub-PLV. Transformants were selected on synthetic media lacking leucine. Plasmids were isolated using a Fast DNA kit (Q-Bio gene Co., Irvine, CA) and were transformed into Escherichia coli JBE181 (
lacX74 hsr rpsL pyrF::TN5[kan] leuB600 trpC 9830 gal E galK) cells via electroporation. Plasmids were isolated and verified by PCR analysis and DNA sequencing.
pRS314-OST1-NubG and pRS314-NubG-Alg5 were obtained from Stagljar et al. These two plasmids were subsequently used as the parental plasmids to construct pRS314-OST3-NubG, pRS314-OST3-NubG, pRS314-OST5-NubG, pRS314-OST6-NubG, pRS314-WBP1-NubG, pRS314-SWP1-NubG as well as pRS314-NubG-OST2, and pRS314-NubG-STT3 using the same approach of homologous recombination as described previously.
Plasmids pRS315-OST2-HA and pRS315-STT3-HA: The DNA fragment encoding OST2 or STT3 gene and flanked with the SalI and SacII restriction sites was generated by PCR amplification using yeast genomic DNA as the template. The fragment was digested with SalI and SacII and ligated into the plasmid pRS315-HA digested by the same enzymes to generate pRS315-OST2-HA or pRS315-STT3-HA. The plasmids were confirmed by colony PCR, and the expression of epitope-tagged proteins was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDSPAGE) and western blot analysis.
Strain MC50 (MATa STT3::myc-KanR. ade2 can1 His3 leu2 trp1 ura3) was obtained from Dr. Manasi Chavan (Chavan, unpublished data). Strain AYY 109 (MATa OST2::myc-KanR. ade2 can1 His3 leu2 trp1 ura3) was generated using the approach described previously. The parental strain was W3031a (MATa ade2 can1 His3 leu2 trp1 ura3).
Procedures
Yeast microsomes were prepared as described (Karaoglu et al., 1997
) except that dichlorodiphenyltrichloroethane (DTT) was excluded in the preparation. Lithium acetate transformation was utilized for all yeast transformations in this study; standard yeast media and genetic techniques were used. Cross-linking, ß-galactosidase activity assay and growth assay were performed as described previously (Yan et al. 2003; Yan et al. 2005) and also described briefly here.
Cross-linking.
Yeast microsomes were resuspended in phosphate buffered saline (PBS)/1 mM phenylmethylsulphonylfluoride and incubated on ice for 0.5 h followed by addition of the cross-linking reagent DSP to a final concentration of 2 mM. The cross-linking reaction was carried out at room temperature for 0.5 h followed by addition of 5 µL of 1 M TrisHCl pH 7.4 to quench the reaction. The resulting membrane proteins were then solubilized with harsh detergent buffer containing 10 mM Hepes (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 1% Triton X-100, 0.2% SDS and protease inhibitors. Immunoprecipitation was carried out using mouse anti-HA or anti-myc antibody followed by affinity purification using protein G agarose beads. After incubation with protein G agarose beads for 2 h at room temperature, the immunocomplex was washed 3 times with the solubilization buffer and once with 1 mL of Tris buffer saline (TBS). SDS sample buffer containing 50 mM DTT was used to cleave the cross-linking reagent and elute the proteins from protein G agarose beads. The protein samples were resolved by SDSPAGE followed by western blot analysis with defined antibodies.
ß-Galactosidase activity.
Transformants carrying two series of plasmids, pRS314 (X-NubG) or pRS314 (NubG-X) and pRS315 (OT subunit-Cub-PLV) were grown for two days at 30°C on dropout agar plates lacking tryptophan and leucine and were transferred to sterile Whatman filter paper. The cells were permeabilized by dipping the filters into liquid nitrogen for 30 sec. After thawing, the filters were overlaid with a piece of Whatman filter paper soaked by 3 mL Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl and 1 mM MgSO4) containing 9 µL ß-mercaptoethanol and 0.3 mg/mL 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal) and incubated at 30°C for 123 h.
Growth assay.
Equal numbers of cells were collected after the cells were grown to early log phase in liquid media lacking tryptophan and leucine. Seven µL of 1:10 serial dilutions of the cells was spotted on SD plates lacking tryptophan and leucine as well as SD plates lacking tryptophan, leucine, and histidine and incubated at 30°C for 3 days.
| Acknowledgments |
|---|
|
|
|---|
The authors thank Dr. Marcus Aebi (Swiss Federal Institute of Technology) for helpful discussion. We are grateful to Dr. Igor Stagljar for providing the plasmids of pRS314-OST1-Nub, pR S314-Nub-ALG5 and pRS305-Wbp1-Cub-PLV. We thank Dr. Thomas Sommer (Max-Delbruck Center, Germany) for providing anti-Sbh1p and anti-Sbh2p antibodies. We also appreciate Dr. Robert Noiva (University of South Dakota) and members in the Lennarz laboratory for their critical reading of the manuscript. We are grateful to Miss Jacqueline Ashe for her work on manuscript revision. This study was supported by National Institute of Health Grant GM33185 to W.J.L.
| Abbreviations |
|---|
Cub, C-terminal half of ubiquitin; DSP, dithiobis-succinimidylpropionate; ER, endoplasmic reticulum; NubG, N-terminal half of ubiquitin; OST, oligosaccharyl transferase; OT, oligosaccharyl transferase; RAMP4, ribosome-associated membrane protein 4; SR, signal recognition particle receptor
| References |
|---|
|
|
|---|
Albright, C.F. and Robbins, R.W. (1990) The sequence and transcript heterogeneity of the yeast gene ALG1, an essential mannosyltransferase involved in N-glycosylation. J. Biol. Chem., 265, 70427049.
Alder, N.N. and Johnson, A.E. (2004) Cotranslational membrane protein biogenesis at the endoplasmic reticulum. J. Biol. Chem., 279, 2278722790.
Broughton, J., Swennen, D., Wilkinson, B.M., Joyet, P., Gaillardin, C., and Stirling, C.J. (1997) Cloning of SEC61 homologues from Schizosaccharomyces pombe and Yarrowia lipolytica reveals the extent of functional conservation within this core component of the ER translocation machinery. J. Cell Sci., 110 (Pt 21), 27152727.[Abstract]
Chavan, M., Yan, A., and Lennarz, W.J. (2005) Subunits of the translocon interact with components of the oligosaccharyl transferase complex. J. Biol. Chem., 280, 2291722924.
Dempski, R.E. Jr. and Imperiali, B. (2002) Oligosaccharyl transferase: gatekeeper to the secretory pathway. Curr. Opin. Chem. Biol., 6, 844850.[CrossRef][ISI][Medline]
Finke, K., Plath, K., Panzner, S., Prehn, S., Rapoport, T.A., Hartmann, E., and Sommer, T. (1996) A second trimeric complex containing homologs of the Sec61p complex functions in protein transport across the ER membrane of S. Cerevisiae. EMBO J., 15, 14821494.[ISI][Medline]
Gao, X.D., Nishikawa, A., and Dean, N. (2004) Physical interactions between the Alg1, Alg2, and Alg11 mannosyltransferases of the endoplasmic reticulum. Glycobiology, 14, 559570.
Gorlich, D. and Rapoport, T.A. (1993) Protein translocation into proteoliposomes reconstituted from purified components of the endoplasmic reticulum membrane. Cell, 75, 615630.[CrossRef][ISI][Medline]
Hartmann, E., Gorlich, D., Kostka, S., Otto, A., Kraft, R., Knespel, S., Burger, E., Rapoport, T.A., and Prehn, S. (1993) A tetrameric complex of membrane proteins in the endoplasmic reticulum. Eur. J. Biochem., 214, 375381.[ISI][Medline]
Hegde, R.S., Voigt, S., Rapoport, T.A., and Lingappa, V.R. (1998) TRAM regulates the exposure of nascent secretory proteins to the cytosol during translocation into the endoplasmic reticulum. Cell, 92, 621631.[CrossRef][ISI][Medline]
Kalies, K.U. and Hartmann, E. (1996) Membrane topology of the 12- and the 25-kDa subunits of the mammalian signal peptidase complex. J. Biol. Chem., 271, 39253929.
Karaoglu, D., Kelleher, D.J., and Gilmore, R. (1995a) Functional characterization of Ost3p. Loss of the 34-kD subunit of the Saccharomyces cerevisiae oligosaccharyltransferase results in biased underglycosylation of acceptor substrates. J. Cell Biol., 130, 567577.
Karaoglu, D., Silberstein, S., Kelleher, D.J., and Gilmore, R. (1995b) The Saccharomyces cerevisiae oligosaccharyltransferase: a large hetero-oligomeric complex in the endoplasmic reticulum. Cold Spring Harb. Symp. Quant. Biol., 60, 8392.[ISI][Medline]
Karaoglu, D., Kelleher, D.J., and Gilmore, R. (1997) The highly conserved Stt3 protein is a subunit of the yeast oligosaccharyltransferase and forms a subcomplex with Ost3p and Ost4p. J. Biol. Chem., 272, 3251332520.
Kelleher, D.J. and Gilmore, R. (1994) The Saccharomyces cerevisiae oligosaccharyltransferase is a protein complex composed of Wbp1p, Swp1p, and four additional polypeptides. J. Biol. Chem., 269, 1290812917.
Kelleher, D.J., Kreibich, G., and Gilmore, R. (1992) Oligosaccharyltransferase activity is associated with a protein complex composed of ribophorins I and II and a 48 kd protein. Cell, 69, 5565.[CrossRef][ISI][Medline]
Kelleher, D.J., Karaoglu, D., Mandon, E.C., and Gilmore, R. (2003) Oligosaccharyltransferase isoforms that contain different catalytic STT3 subunits have distinct enzymatic properties. Mol. Cell, 12, 101111.[CrossRef][ISI][Medline]
Knauer, R. and Lehle, L. (1999a) The oligosaccharyltransferase complex from Saccharomyces cerevisiae. Isolation of the OST6 gene, its synthetic interaction with OST3, and analysis of the native complex. J. Biol. Chem., 274, 1724917256.
Knauer, R. and Lehle, L. (1999b) The oligosaccharyltransferase complex from yeast. Biochim. Biophys. Acta, 1426, 259273.[Medline]
Kumar, V., Heinemann, F.S., and Ozols, J. (1994) Purification and characterization of avian oligosaccharyltransferase. Complete amino acid sequence of the 50-kDa subunit. J. Biol. Chem., 269, 1345113457.
Kumar, V., Heinemann, F.S., and Ozols, J. (1995a) Purification and characterization of hepatic oligosaccharyltransferase. Biochem. Mol. Biol. Int., 36, 817826.[ISI][Medline]
Kumar, V., Korza, G., Heinemann, F.S., and Ozols, J. (1995b) Human oligosaccharyltransferase: isolation, characterization, and the complete amino acid sequence of 50-kDa subunit. Arch. Biochem. Biophys., 320, 217223.[CrossRef][ISI][Medline]
MacGrogan, D., Levy, A., Bova, G.S., Isaacs, W.B., and Bookstein, R. (1996) Structure and methylation-associated silencing of a gene within a homozygously deleted region of human chromosome band 8p22. Genomics, 35, 5565.[CrossRef][ISI][Medline]
Mullins, C., Meyer, H.A., Hartmann, E., Green, N., and Fang, H. (1996) Structurally related Spc1p and Spc2p of yeast signal peptidase complex are functionally distinct. J. Biol. Chem., 271, 2909429099.
Ng, D.T., Brown, J.D., and Walter, P. (1996) Signal sequences specify the targeting route to the endoplasmic reticulum membrane. J. Cell Biol., 134, 269278.
Pathak, R. and Imperiali, B. (1997) A dual affinity tag on the 64-kDa Nlt1p subunit allows the rapid characterization of mutant yeast oligosaccharyl transferase complexes. Arch. Biochem. Biophys., 338, 16.[CrossRef][ISI][Medline]
Rapoport, T.A., Jungnickel, B., and Kutay, U. (1996) Protein transport across the eukaryotic endoplasmic reticulum and bacterial inner membranes. Annu. Rev. Biochem., 65, 271303.[CrossRef][ISI][Medline]
Shibatani, T., David, L.L., McCormack, A.L., Frueh, K., and Skach, W.R. (2005) Proteomic analysis of mammalian oligosaccharyltransferase reveals multiple subcomplexes that contain Sec61, TRAP, and two potential new subunits. Biochemistry, 44, 59825992.[CrossRef][Medline]
Spirig, U., Bodmer, D., Wacker, M., Burda, P., Aebi, M. (2005) The 3.4-kDa Ost4 protein is required for the assmbly of two distinct oligosaccharyltransferase complexes in yeast. Glycobiology, 15.
Stagljar, I., Korostensky, C., Johnsson, N., and te Heesen, S. (1998) A genetic system based on split-ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc. Natl. Acad. Sci. U. S. A., 95, 51875192.
Walter, P. and Johnson, A.E. (1994) Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annu. Rev. Cell Biol., 10, 87119.[CrossRef][ISI][Medline]
Wang, L. and Dobberstein, B. (1999) Oligomeric complexes involved in translocation of proteins across the membrane of the endoplasmic reticulum. FEBS Lett., 457, 316322.[CrossRef][ISI][Medline]
Wilkinson, B.M., Tyson, J.R., and Stirling, C.J. (2001) Ssh1p determines the translocation and dislocation capacities of the yeast endoplasmic reticulum. Dev. Cell, 1, 401409.[CrossRef][ISI][Medline]
Wittke, S., Dunnwald, M., Albertsen, M., and Johnsson, N. (2002) Recognition of a subset of signal sequences by Ssh1p, a Sec61p-related protein in the membrane of endoplasmic reticulum of yeast Saccharomyces cerevisiae. Mol. Biol. Cell, 13, 22232232.
Yan, A. and Lennarz, W.J. (2005) Unraveling the mechanism of protein N-glycosylation. J. Biol. Chem., 280, 31213124.
Yan, A., Ahmed, E., Yan, Q., and Lennarz, W.J. (2003) New findings on interactions among the yeast oligosaccharyl transferase subunits using a chemical cross-linker. J. Biol. Chem., 278, 3307833087.
Yan, A., Wu, E., and Lennarz, W.J. (2005) Studies of yeast oligosaccharyl transferase subunits using the split-ubiquitin system: topological features and in vivo interactions. Proc. Natl. Acad. Sci. U. S. A., 102, 71217126.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Yan, Z. Guan, and C. R. H. Raetz An Undecaprenyl Phosphate-Aminoarabinose Flippase Required for Polymyxin Resistance in Escherichia coli J. Biol. Chem., December 7, 2007; 282(49): 36077 - 36089. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kaji, J.-i. Kamiie, H. Kawakami, K. Kido, Y. Yamauchi, T. Shinkawa, M. Taoka, N. Takahashi, and T. Isobe Proteomics Reveals N-Linked Glycoprotein Diversity in Caenorhabditis elegans and Suggests an Atypical Translocation Mechanism for Integral Membrane Proteins Mol. Cell. Proteomics, December 1, 2007; 6(12): 2100 - 2109. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chavan, Z. Chen, G. Li, H. Schindelin, W. J. Lennarz, and H. Li Dimeric organization of the yeast oligosaccharyl transferase complex PNAS, June 13, 2006; 103(24): 8947 - 8952. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||








