Skip Navigation


Glycobiology Advance Access originally published online on July 21, 2005
Glycobiology 2005 15(12):1359-1367; doi:10.1093/glycob/cwj023
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/12/1359    most recent
cwj023v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Penha, L. L.
Right arrow Articles by Lima, A. P. C. d. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Penha, L. L.
Right arrow Articles by Lima, A. P. C. d. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oupjournals.org

Cloning and characterization of the phosphoglucomutase of Trypanosoma cruzi and functional complementation of a Saccharomyces cerevisiae PGM null mutant

Luciana L. Penha, Lucia Mendonça-Previato2, Jose O. Previato, Julio Scharfstein, Norton Heise1 and Ana Paula C. de A. Lima1

Instituto de Biofísica Carlos Chagas Filho, Centro de Ciências da Saúde – Bloco G, Universidade Federal do Rio de Janeiro, 21944-970, Cidade Universitária, Ilha do Fundão, Rio de Janeiro, Brazil


1 They are equal senior authors.

2 To whom correspondence should be addressed; e-mail: luciamp{at}biof.ufrj.br

Received on May 2, 2005; revised on July 18, 2005; accepted on July 20, 2005


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Trypanosoma cruzi is the etiological agent of Chagas’ disease, a chronic illness characterized by progressive cardiomyopathy and/or denervation of the digestive tract. The parasite surface is covered with glycoconjugates, such as mucin-type glycoproteins and glycoinositolphospholipids (GIPLs), whose glycans are rich in galactopyranose (Galp) and/or galactofuranose (Galf) residues. These molecules have been implicated in attachment of the parasite to and invasion of mammalian cells and in modulation of the host immune responses during infection. In T. cruzi, galactose (Gal) biosynthesis depends on the conversion of uridine diphosphate (UDP)-glucose (UDP-Glc) into UDP-Gal by an NAD-dependent reduction catalyzed by UDP-Gal 4-epimerase. Phosphoglucomutase (PGM) is a key enzyme in this metabolic pathway catalyzing the interconversion of Glc-6-phosphate (Glc-6-P) and Glc-1-P which is then converted into UDP-Glc. We here report the cloning of T. cruzi PGM, encoding T. cruzi PGM, and the heterologous expression of a functional enzyme in Saccharomyces cerevisiae. T. cruzi PGM is a single copy gene encoding a predicted protein sharing 61% amino acid identity with Leishmania major PGM and 43% with the yeast enzyme. The 59-trans-splicing site of PGM RNA was mapped to a region located at 18 base pairs upstream of the start codon. Expression of T. cruzi PGM in a S. cerevisiae null mutant-lacking genes encoding both isoforms of PGM (pgm1{nu}/pgm2{nu}) rescued the lethal phenotype induced upon cell growth on Gal as sole carbon source.

Key words: Chagas’ / disease / phosphoglucomutase / Saccharomyces cerevisiae / Trypanosoma cruzi


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Chagas’ disease, a human infection caused by the protozoan parasite Trypanosoma cruzi is a chronic illness characterized by progressive cardiomyopathy and/or degeneration of the smooth muscle and neurons of the digestive tract (Tyler and Miles, 2003Go). T. cruzi is a dixenic parasite alternating between two major life stages in each host: in the insect vector, epimastigotes (Es) (replicative and noninfective) differentiate into metacyclic trypomastigotes (Ts) (nonreplicative and infective), which are transmitted to mammals upon their release in the skin after the blood meal. Subsequently, metacyclics may invade diverse cell types in the mammalian host and transform into amastigotes that undergo several cycles of binary division in the cell cytoplasm. After 3–5 days, amastigotes differentiate into Ts, which may be released into the blood or adjacent tissues (Brenner, 1973Go).

The surface of T. cruzi is covered by a dense coat of antigenic, highly O-glycosylated sialoglycoproteins of the mucin-type (DiNoia et al., 1996), in which, uniquely, the glycan chains are linked to, principally, threonine (Thr) residues in the peptide through an {alpha}-linked N-acetylglucosamine (GlcNAc) unit (rather than N-acetylgalactosamine [GalNAc]) (Previato et al., 1994Go, 1998Go). The GlcNAc unit can be substituted by galactose (Gal) residues in either their pyranoside or furanoside forms (Previato et al., 1994Go, 1995Go; Todeschini et al., 2001Go; Agrellos et al., 2003Go; Jones et al., 2004Go). Galactopyranose (Galp) residues can be sialylated through the direct transfer of sialic acid from host sialoglycoconjugates to the parasite mucins, a reaction catalyzed by a trans-sialidase activity on the parasite cell surface (Previato et al., 1985Go, 1990Go; Schenkman et al., 1991Go).

There is strong evidence pointing to a role of T mucins in host cell attachment, signaling, and invasion (Burleigh and Andrews, 1995Go). Antibodies to the carbohydrate moiety of mucins and the purified glycoprotein itself can inhibit host cell invasion by metacyclics (Acosta-Serrano et al., 2001Go), whereas removal of sialic acid by treatment of these parasite forms with neuraminidase improves their Ca2+ signaling capability and the ability to enter HeLa cells (Yoshida et al., 1997Go). In addition, the dense negatively charged coat provided by the sialylation of mucins is apparently important in protecting Ts from killing mediated by the human anti {alpha}-Gal antibodies (Pereira-Chioccola et al., 2000Go). Besides mucins, other Gal-containing molecules, such as free glycoinositolphospholipid (GIPL) and the main parasite cysteine protease (cruzipain), have also been implicated in infection and/or immunomodulation in the mammalian host (DosReis et al., 2002Go; Scharfstein, 2003Go; Previato et al., 2004Go).

The biosynthesis of galactosylated molecules in T. cruzi relies exclusively on the utilization of glucose (Glc) as the starting point for the generation of UDP-Gal. This unique characteristic arises from the fact that the T. cruzi hexose transporter (TcrHT1) of trypanosomes does not transport D-Gal (Tetaud et al., 1997Go), so the parasite is unable to take up Gal from the extracellular environment and metabolize it through the Leloir pathway (Leloir, 1951Go). Of the four enzymes that constitute the Leloir pathway, only the UDP-Gal-4-epimerase, encoded by GALE gene, has been characterized in T. cruzi (Roper and Ferguson, 2003Go). In Trypanosoma brucei, the removal of tetracycline from a tetracycline-inducible conditional GALE null mutant was lethal, providing evidence that Gal metabolism is essential for the African trypanosomes (Roper et al., 2002Go, 2005Go). Phosphoglucomutase (PGM, EC 5.4.2.2 [EC] ) is a key enzyme in carbohydrate metabolism interconverting Glc-6-phosphate (Glc-6-P) and Glc-1-P. Reaction of Glc-1-P with uridine triphosphate forms the UDP-Glc, which is the substrate for the generation of UDP-Gal. PGM is ubiquitous in nature and highly conserved between species (Whitehouse et al., 1998Go; Shackelford et al., 2004Go). The activity of PGM can be attributed to that of at least two closely related isoforms (PGM1 and PGM2) encoded by different genes (Tsoi and Douglas, 1964Go; Bevan and Douglas, 1969Go; Oh and Hopper, 1990Go). A Saccharomyces cerevisiae null mutant strain lacking both PGM genes (pgm1{Delta}/pgm2{Delta}) is not viable when the cells are exposed to Gal as the sole carbon source (Daran et al., 1997Go), whereas a yeast pgm2{Delta} strain display retarded growth and a large increase in Ca2+ uptake and accumulation (Fu et al., 2000Go). It was latter shown that PGM activity is important to maintain intracellular Ca2+ homeostasis in yeast because the relative levels of Glc-6-P and of Glc-1-P are directly coupled to the processes of Ca2+ uptake and storage (Aiello et al., 2002Go).

Because the early studies aiming at the characterization of different T. cruzi stocks through isoenzyme patterns, PGM was a marker to differentiate populations belonging to three distinct parasite subgroups or Zymodemes (Miles et al., 1980Go). Recently, the use of additional molecular markers allowed T. cruzi strains to be divided into two major groups standardized as T. cruzi I, containing strains which are associated with the sylvatic cycle, and T. cruzi II, strains which are associated with the domestic cycle and are mainly involved in the human infection (Souto et al., 1996Go; Luquetti et al., 1999Go). However, T. cruzi PGM has never been characterized at the molecular and functional level.

In this study, we describe the cloning and molecular characterization of the PGM gene that encodes the T. cruzi PGM and shows its activity by functional heterologous complementation of a S. cerevisiae pgm1{Delta}/pgm2{Delta} mutant. We show that T. cruzi PGM rescues the yeast pgm1{Delta}/pgm2{Delta} lethal phenotype induced by growth in the presence of Gal.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Cloning and characterization of the PGM gene of T. cruzi
Considering that PGM may be essential for Gal metabolism in T. cruzi, we decided to clone its PGM gene and undertake functional studies of the enzyme. As the complete sequence of the T. cruzi genome was not available when we started this study, we used a combination of complementary and degenerate oligonucleotides as primers in polymerase chain reactions (PCRs) to obtain the partial sequence of the PGM gene. An oligonucleotide (LP7) complementary to the 3' end of T. cruzi PGM was designed based on the available partial cDNA sequence of T. cruzi CL Brener PGM gene (443 bp of the coding sequence) (Accession number AI066127 [GenBank] ), and the degenerate oligonucleotide (AA14) that was designed based on a region conserved among the PGM genes of different organisms, such as the human, Arabidopsis thaliana, S. cerevisiae, and Leishmania major. Both primers (Figure 1) were used in a PCR that resulted in a single product of the expected size (~1.7 kb). The PCR product exhibited ~70% sequence identity to the PGM gene from L. major, and a new complementary primer (AA160) was designed based on this sequence, for the isolation of the 5' end of the T. cruzi PGM gene. In parallel, a Southern blot of T. cruzi genomic DNA probed with the partial cDNA encoding PGM revealed hybridization with an EcoRI restriction fragment of ~4.0 kb (data not shown). Because there were no restriction sites for EcoRI in the partial 1.7 kb PGM sequence we had identified so far (Figure 1, nt 52–1764), we predicted that the full-length gene might be contained within the conveniently sized (~4.0 kb) EcoRI fragment. Therefore, T. cruzi genomic DNA was treated with EcoRI, and the resulting fragments ranging from 3.5 to 4.5 kb excised from an agarose gel and ligated to an EcoRI-digested pTZ19R plasmid. The ligation reaction was subsequently used as a template in a PCR experiment, performed with the complementary primer AA160 and the M13 forward or reverse primers. The sequence of a resulting 800-bp fragment confirmed that it spanned the 5' end of the PGM gene and part of the upstream flanking intergenic region (Figure 1). The predicted amino acid sequence of this fragment revealed two putative start codons at the N-terminus of PGM (Figure 1, nt –39 and nt 1, respectively). To isolate the full-length PGM gene, we used the complementary primers LP5 and LP7 in a gene amplification reaction of genomic DNA that resulted in a single 1.8-kb fragment (Figure 1). The genomic organization of the PGM gene was evaluated by Southern blot using probes directed to the 5' (515 bp) and 3' (360 bp) ends of the PGM open reading frame (ORF), and the results are presented in Figure 2A and B, respectively. A single hybridization fragment was detected when endonucleases that do not cut in the PGM gene were used, and the size of each fragment was used to build up a physical map of the T. cruzi PGM gene genomic organization (Figure 2D). These results suggest that the PGM gene is present as a single copy per haploid genome. Northern-blotting analysis of two life stages of T. cruzi revealed that PGM RNA of the expected size (~1.8 kb) is present at similar levels in both E and T forms (Figure 2C, arrow).



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 1. Predicted sequence of the Trypanosoma cruzi Dm28c phosphoglucomutase (PGM) gene. The genomic DNA sequence from positions –204 (relative to the start codon) through 1800 is shown, and nucleotides predicted to be translated are in uppercase. The nucleotides comprised within positions 1322–1764 corresponds to the partial cDNA sequence of T. cruzi CL Brener PGM-coding region (GenBank AI066127 [GenBank] ), sharing 98% identity. The residues corresponding to nonconservative amino acid substitutions between the Dm28c PGM and the Tc00.1047053508637.90 and Tc00.1047053511911.130 found in the CL Brener T. cruzi GeneDB database are, respectively, shown beneath underlined and boxed amino acid residues. Potential trans-splicing acceptor sites ("ag") are shown in italics underlined. Arrows indicate sequences corresponding to forward and reverse primers, used for cloning and sequencing. The deduced amino acid sequence was aligned with sequences of PGM of Leishmania major (CAC14526), Arabidopsis thaliana (AC002311 [GenBank] ), Saccharomyces cerevisiae (X72016 [GenBank] and X74823 [GenBank] ), and Homo sapiens (CAB92086 [GenBank] ) using Clustal W, and identical residues are in reverse type. Important regions of the active site containing the catalytic phosphoserine (P-Ser), the metal-binding loop that coordinates the Mg2+ ion (Mg2+-binding loop), the sugar-binding loop (Sugar-binding loop), and the phosphate-binding site (PO4-binding loop) are indicated below the amino acid sequence.

 


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. Genomic organization and expression of Trypanosoma cruzi phosphoglucomutase (PGM). (A) Southern blot of T. cruzi genomic DNA treated with HindIII (lane 1), EcoRI (lane 2), BamHI (lane 3), and AccI (lane 4) and probed with HindIII/AccI fragment spanning the 3'-coding sequence of PGM as indicated by the solid horizontal bar located on the right hand side of PGM in panel D. (B) Southern blot of genomic DNA digested with BamHI (lane 1), EcoRI (lane 2), HindIII (lane 3), PstI (lane 4), XbaI (lane 5), and SmaI (lane 6) and probed with the fragment obtained by polymerase chain reaction (PCR) using the primers LP5 and AA160 as indicated by the solid horizontal bar located on the left hand side of PGM in panel D. (C) Northern blot of T. cruzi total RNA of logarithmic growing epimastigotes (Es) and of tissue culture trypomastigotes (Ts) hybridized with the L18 probe, which is directed to the ribosomal protein L18. The membrane was stripped and subsequently probed with the fragment used in panel B. Arrow indicates the relative position of the expected (~1.8kb) major PGM transcript. (D) Genomic restriction map of the PGM (grey-shadowed box) gene.

 

In contrast to other eukaryotes, the 5' end of fully processed mRNA of protein encoding genes of trypanosomatids such as T. cruzi contain an identical 39-nucleotide named the mini-exon sequence which derives from a larger RNA and is transferred to the 5' end of each mRNA by trans-splicing (Boothroyd and Cross, 1982Go; Bergmeyer, 1986Go). At the 5' end of the PGM gene, we identified several putative trans-splicing "ag" acceptor sites preceding the first predicted start codon, and two of them preceding the second predicted start codon (Figure 1, italics underlined). Therefore, both start codons could possibly be used for the translation of PGM.

To identify the trans-splicing site in the mRNA of T. cruzi PGM, we used total RNA isolated from Es of Dm28c T. cruzi for the synthesis of cDNA, which was subsequently submitted to PCR with a primer directed to the mini-exon sequence as forward and the PGM AA160 primer as reverse (Figure 3A). The sequence of the resulting fragment (520 bp) revealed a single product containing part of the mini-exon sequence (Figure 3A, bold) fused to PGM, indicating that the trans-splicing site was located at 18 nucleotides’ upstream from the second predicted start codon (Figure 3A, arrowhead). We assumed that if small amounts of cDNA corresponding to RNA molecules processed at the first putative trans-splicing acceptor site were present, they might not be detected in the agarose gel of the reverse transcription–PCR) (RT–PCR). However, these minor products might be identified by a more sensitive technique, such as hybridization with radio-labeled probes. To confirm that the other predicted trans-splicing acceptor sites were not used to generate a processed RNA, we submitted the resulting fragments of the RT–PCR to hybridization with radio-labeled oligonucleotides LP5 and LP6 directed to both start codons (Figure 1). Positive hybridization was only observed with LP6, and cDNA containing the region between the first two putative trans-splicing acceptor sites could not be detected (Figure 3B). Collectively, these results suggest that the second putative start codon is the main site used for the synthesis of PGM.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3. Identification of the trans-splicing site in Trypanosoma cruzi phosphoglucomutase (PGM) RNA. (A) Ethidium bromide-stained 0.8% agarose gel of 1-kb ladder size markers (left) and T. cruzi Dm28c PGM reverse transcription–polymerase chain reaction) (RT–PCR) products generated using AA160 and ME21 as primers and total RNA isolated from epimastigotes (right). The 520-bp amplified fragment (arrow) was gel purified, and the 5' end of its sequence contained part of the mini-exon sequence (boldface) fused to the second putative trans-splicing acceptor site (arrowhead) close to the second putative translation start codon (underlined) of the predicted PGM gene. (B) The purified 520-bp product of the RT–PCR described in (A) was resolved in a 0.8% agarose gel, transferred to a nylon membrane, and probed with radio-labeled oligonucleotides LP5 or LP6.

 

Two PGM sequences showing low polymorphism were found in the sequence data of the T. cruzi (CL Brener) GeneDB, corresponding to Tc00.1047053508637.90 and Tc00.1047053511911.130. This indicates that the alleles encoding PGM are not identical in this strain, supporting the conclusion from Southern blots that PGM is a single copy gene (Figure 2). Dm28c PGM sequence differs by 23 and 25 nucleotides from Tc00.1047053508637.90 and Tc00.1047053511911.130, respectively, yielding four and six conservative and two and five nonconservative amino acid substitutions mostly outside the predicted catalytic domain (Figure 1). The predicted amino acid sequence of the entire PGM gene of Dm28c T. cruzi shows ~60% sequence identity with that of L. major; ~50% sequence identity with the PGM1 genes from humans, mice, A. thaliana; and only 42–43% with those of S. cerevisiae (Table I). The multiple alignment of T. cruzi PGM-predicted amino acid sequence with that of different organisms revealed that the amino acids that compose the enzyme’s active site were conserved, as expected (Figure 1, amino acids in reverse type).


View this table:
[in this window]
[in a new window]
 
Table I. Comparison of amino acid identity among phosphoglucomutase (PGM) from different organisms and Trypanosoma cruzi enzyme

 

Functional complementation of pgm1{Delta}/pgm2{Delta} S. cerevisiae with T. cruzi PGM
To verify whether the T. cruzi PGM gene encodes a functional enzyme, we analyzed its ability to complement the phenotype of a S. cerevisiae PGM null mutant. The complete coding sequence of T. cruzi PGM was expressed in both wild-type (WT) yeast (JM245) and in a pgm1{Delta}/pgm2{Delta} mutant (JM645) using the pYES 2.0 expression vector that uses the GAL1-promoter to drive insert expression which is induced by shifting the transformed cells to Gal-containing medium. The mutant strain is incapable of metabolizing Gal and presents a lethal phenotype when Gal is used as the sole carbon source (Daran et al., 1997Go). As expected, WT S. cerevisiae bearing the plasmid alone or T. cruzi PGM grew normally in the presence of Gal (Figure 4, left panel), whereas the double mutant was unable to grow in Gal-containing plates when transformed with empty vector (Figure 4, right panel pYES). However, the S. cerevisiae double mutant, bearing T. cruzi PGM grew normally on Gal (Figure 4, right panel pYES/Tc-PGM), indicating that the parasite PGM restored their ability to metabolize Gal.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4. Functional complementation of Saccharomyces cerevisiae pgm1{Delta}/pgm2{Delta} by Trypanosoma cruzi phosphoglucomutase (PGM). Wild-type (WT) S. cerevisiae or S. cerevisiae pgm1{Delta}/pgm2{Delta} mutant (pgm{Delta}) was transformed with pYES expression vector alone (pYES) or pYES containing the full-length of T. cruzi phosphoglucomutase (PGM) gene (pYES/Tc-PGM), as indicated. The cells were selected in synthetic medium-URA containing 2% glucose, and then plated onto synthetic medium-URA supplemented with 2% (w/v) galactose (Gal) as the only carbon source.

 

T. cruzi PGM activity in S. cerevisiae
The activity of T. cruzi PGM was assayed in the homogenates of S. cerevisiae cells expressing the parasite enzyme, at different induction time intervals (Figure 5). Maximum activity was detected after 12 h of induction, and we observed higher activity in homogenates of yeast pgm1{Delta}/pgm2{Delta} mutant expressing T. cruzi PGM than in WT yeast expressing T. cruzi PGM. Thus, we have demonstrated that the PGM gene of T. cruzi encodes a functional enzyme that is able to compensate for the loss of endogenous PGM function in S. cerevisiae.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. Induction of Trypanosoma cruzi phosphoglucomutase (PGM) activity in Saccharomyces cerevisiae transformed with pYES/Tc-PGM. pYES or pYES/Tc-PGM transformed wild-type (WT) or pgm1{Delta}/pgm2{Delta} mutant (pgm{Delta}) yeast cells were inoculated in liquid medium and grown overnight at 28°C. The cultures were diluted, grown to mid-log phase, and transferred into synthetic medium containing 2% (w/v) galactose (Gal) and 1% (w/v) raffinose. Aliquots of each culture were taken at indicated time intervals, and the PGM activity (nmol·min–1·mg of protein–1) in the homogenates determined as described in Materials and methods. Results shown are as means ± SD of two sets of independent experiments done in triplicate.

 


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
We cloned the PGM gene of T. cruzi Dm28c by PCR using a combination of degenerate and specific primers. PGM is encoded by a single copy gene that is transcribed in at least two parasite life stages, E and T. In S. cerevisiae, there are two genes encoding PGM isoenzymes, PGM1 and PGM2 (Tsoi and Douglas, 1964Go; Bevan and Douglas, 1969Go; Oh and Hopper, 1990Go). The PGM2 gene is slightly larger than PGM1, due to additional coding sequence at the 5' end. The T. cruzi PGM gene we cloned contained two putative translation start codons (ATG) at 36 nucleotides distance from each other, and each preceded by potential trans-splicing acceptor sites. The predicted proteins initiated at either translation initiation site would bear the approximate sizes of yeast PGM2 and PGM1 proteins, respectively. Since PGM is single copy in T. cruzi, the use of alternative trans-splicing sites could possibly enable the parasite to express two PGM isoenzymes. However, we were only able to detect PGM RNA processed at a single trans-splicing site, located immediately upstream of the second translation start codon. These results suggest that, at least in Es, a protein of the approximate size of yeast PGM1 represents most PGM in T. cruzi.

The T. cruzi PGM gene encodes a predicted protein sharing 61% amino acid identity with the PGM gene of L. major and 43 and 42% identity to yeast PGM isoforms 1 and 2, respectively. Comparison of the Dm28c parasite strain PGM gene and the two CL Brener strain PGM sequences deposited in the GenBank revealed very few nonconservative amino acid changes (Figure 1). Molecular typing of these strains has assigned Dm28c to T. cruzi group II, whereas CL Brener represents a hybrid strain, possibly bearing alleles typical of both groups I and II (Souto et al., 1996Go; Luquetti et al., 1999Go). PGM has been used in the past in multiple loci isoenzyme electrophoresis (MLEE) as a criterion to separate T. cruzi strains into different groups (Miles et al., 1980Go). It is noteworthy that two and five amino acid substitutions found between Dm28 and the Tc00.1047053508637.90 and Tc00.1047053511911.130 CL Brener PGM sequences would introduce changes in charge that could contribute to the difference in the enzyme electrophoretic mobility observed by MLEE.

As expected, most amino acid substitutions encountered between S. cerevisiae and T. cruzi PGM lie outside the regions that compose the active site, suggesting that these changes should not significantly affect enzyme activity. In agreement with that, T. cruzi PGM, when overexpressed from a high copy number episome, was able to complement the lethal phenotype displayed by S. cerevisiae pgm1{Delta}/pgm2{Delta} mutant when grown in the presence of D-Gal.

S. cerevisiae pgm2{Delta} mutant displays numerous phenotypes related to altered Ca2+ homeostasis when D-Gal is used as the carbon source (Fu et al., 2000Go). These alterations, for example, a large increase in Ca2+ uptake and accumulation, were attributed specifically to the increased level of Glc-1-P in these cells. It was also suggested that slow growth of S. cerevisiae pgm2{Delta} mutant is partially due to Ca+ stress rather than to a limitation in the rate of conversion of Glc-1-P to Glc-6-P (Fu et al., 2000Go). Increased Ca2+ uptake and accumulation are not observed when the relative ratio of Glc-6-P and Glc-1-P is restored by deleting the phosphofructokinase ß-subunit to increase Glc-6-P levels (Aiello et al., 2002Go). More recently, however, it was verified that the increase of Ca2+ uptake and accumulation observed in the S. cerevisiae pgm2{Delta} mutant is suppressed by disruption of the PMC1 gene which encodes the vacuolar Ca2+-ATPase, suggesting that phenotypic modifications observed when the yeast pgm2{Delta} strain is grown with Gal as the carbon and energy source are because of an imbalance in the distribution of Ca2+ into different intracellular compartments, resulting to the relative levels of Glc-1-P and Glc-6-P (Aiello et al., 2004Go). In T. cruzi, PGM may also play an important role in regulating Ca2+ homeostasis. As in other eukaryotes, T. cruzi mobilizes intracellular Ca2+ stores when interacting with certain types of mammalian cells in vitro and is a requisite for host cell invasion by these parasites (Neira et al., 2002Go).


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Parasite cultures
Es of T. cruzi Dm28c were cultivated in liver-infusion tryptose (LIT) medium supplemented with 10% fetal bovine serum at 28°C (Previato et al., 1998Go). Tissue culture Ts were obtained from the supernatant of infected LLC-MK2 cells cultivated in Dulbeco’s modified Eagle’s medium, supplemented with 2% fetal calf serum in a 5% CO2 humidified atmosphere at 37°C (Previato et al., 1998Go).

Cloning of the T. cruzi PGM gene
A partial sequence of the T. cruzi PGM gene was amplified by PCR using oligonucleotides (Figure 1) LP7 (5'-CGctcgag TCAAGTGATGACTGTGGGGGCG containing a XhoI restriction site in lowercase), directed to the 3' end of the 443 bp cDNA sequence of the PGM gene of CL Brener strain of T. cruzi (Accession number AI066127 [GenBank] ), and AA14 (5'-GGNACNNNNGGNCTNCG, where N means the mix of all four bases), a degenerate oligonucleotide directed to part of a conserved region (QKPGTSGLRKK) found at the N-terminus of the PGM sequences from the human (Accession number CAB92086 [GenBank] ), A. thaliana (AC002311 [GenBank] ), S. cerevisiae (Accession numbers X72016 [GenBank] and X74823 [GenBank] ), and L. major (CAC14526). The PCR was carried out in 50 µL containing 20 mM Tris–HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.3 µM of each oligonucleotide, 1 U of Taq DNA polymerase (Biotools, Madrid, Spain), and 1 µg of T. cruzi Dm28c strain genomic DNA as template. Unless stated elsewhere, the PCR conditions were denaturation at 94°C for 10 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 50°C for 1 min, and extension at 72°C followed by a final extension at 72°C for 10 min. The resulting 1725-bp fragment was cloned into Invitrogen (Carlsbad, CA) TOPO TA cloning kit and sequenced, expanding 97.8% of the T. cruzi PGM gene sequence. The 5' end of the gene was obtained by PCR. First, a Southern blot of T. cruzi genomic DNA treated with EcoRI showed hybridization with a single 4.0-kb fragment using the [32P]-labeled 443-bp coding sequence of T. cruzi CL Brener PGM as a probe. Subsequently, a size-selected library (3.5–4.5 kb) was constructed in pTZ19R plasmid with T. cruzi Dm28c strain genomic DNA digested with EcoRI. This library was then used as a template in PCRs that followed the conditions mentioned above but using annealing temperature of 52°C and the oligonucleotide AA160 (5'-CAATTTTCAA GTCTCTTCG), a reverse primer directed to an internal sequence of the T. cruzi Dm28c strain PGM gene, and either the reverse or forward M13 primers. Two amplified fragments (0.8 and 1.4 kb when using the forward M13 primer) were purified from the agarose gel and submitted to sequencing in an Applied Biosystems-automated sequencer (Foster City, CA). Both fragment sequences corresponded to the 5' extremity of the T. cruzi Dm28c strain PGM gene plus part of the upstream intergenic region. Based on these sequences, the oligonucleotide LP5 (5'-CGgaattcatgaatctgggcgaaaccc containing an EcoRI site in lowercase) was synthesized and used together with the reverse primer LP7 to amplify the full-length PGM gene by PCR using the proof reading Pfx DNA polymerase (Invitrogen) and T. cruzi Dm28c strain genomic DNA as a template. The PCR conditions were the same as before but by using an extension temperature of 68°C. The 1.76-kb PCR product was gel purified using GenecleanII kit (BIO 101), ligated into the pCR2.1 TOPO vector (Invitrogen) and sequenced in a Perkin-Elmer ABI PRISM 3100 automated sequencer. The predicted amino acid sequence was compared with the translated PGM sequences from different organisms using the BLAST program, and the sequences were aligned using Clustal W (Thompson et al., 1994Go) with default parameters. The PGM ORF was subcloned into the EcoRI/XhoI sites of the Invitrogen S. cerevisiae expression vector pYES2.0.

Southern blot
Genomic DNA from T. cruzi Dm28c was extracted according to the proteinase K method (Blaxter et al., 1988Go), and 15 µg were digested with selected restriction endonucleases (AccI, BamHI, EcoRI, HindIII, PstI, SmaI, and XbaI) at 37°C for 18 h. The DNA was precipitated with ethanol acetate, resolved in an 0.8% (w/v) agarose gel, and transferred to a positively charged nylon membrane (Hybond N+, Amersham Biosciences) in 0.4 N NaOH, 1 M NaCl overnight. After neutralization with 500 mM Tris–HCl, pH 7.5, 1 M NaCl, and baking at 80°C, the membrane was blocked in 6 x standard saline phosphate/ethylenediamine tetracetic acid (EDTA) (900 mM NaCl, 60 mM NaH2PO4, 6 mM EDTA), 5 x Denhardt’s solution (Sigma St. Louis, MO), 1% (w/v) sarcosyl, and 100 µg·mL–1 salmon sperm DNA (Sigma) (blocking buffer), for 1 h at 55°C. The probe corresponding to a 360-bp fragment containing part of the 3' end of the coding sequence of T. cruzi CL Brenner strain PGM gene (clone TENU2518, kindly provided by Dr. Lena Aslund, University of Uppsala, Sweden) was isolated after digestion with HindIII/AccI, gel purified, radio-labeled using [{alpha}-32P]dCTP and the Rad Prime DNA-labeling system (Invitrogen), and used as a probe overnight, in blocking buffer at 55°C. A separate membrane was probed in the same conditions using a radio-labeled 515-bp fragment corresponding to the 5'-coding sequence of PGM, obtained by PCR using primers LP5 and AA160. PCR conditions were the same as before, except the annealing temperature that was at 55°C. After hybridization, the membranes were washed twice in 0.1 x standard saline citrate (SSC) (15 mM NaCl, 1.5 mM sodium citrate), 0.1% (w/v) sodium dodecyl sulfate (SDS) at 55°C for 15 min, dried and exposed to X-ray films (X-OMAT LS, Kodak, Rochester, NY) with intensifying screens at –70°C for 24 h.

Northern blot
Total T. cruzi RNA from 108 cells was extracted using TRIzol® (Invitrogen), according to manufacturer’s instructions. Samples of RNA (15 µg) were separated in 1.2% (w/v) formaldehyde agarose gel and transferred to Hybond N+ nylon membrane in 10 x SSC overnight. After baking, the membrane was submitted to blocking in 50 mM phosphate buffer, pH 7.0, 5 x SSC, 50% (v/v) formamide, containing 100 µg·mL–1 sperm salmon DNA, 50 x Denhardt’s solution at 42°C, followed by hybridization with [32P]-labeled probes as above. The loading control was monitored using a probe directed to T. cruzi ribosomal protein L18 (Porcile et al., 2003Go), kindly provided by Dr. Edson Rondinelli (Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil). After stripping following the manufacturer’s instructions, the same membrane was probed with the [32P]-labeled 360-bp fragment containing part of the 3' end of the PGM-coding sequence.

Identification of the trans-splicing site in the mRNA of PGM
Total T. cruzi RNA (1 µg) isolated from Es was reverse transcribed using the Retro-tools kit (BioTools) and oligonucleotide AA160. The cDNA was then submitted to PCR with oligonucleotide ME21 (5'-GGCAGTTTCTGTAC ATATTG) directed to the mini-exon sequence as forward and the AA160 oligonucleotide as reverse primers. The PCR conditions were the same as above, except for the annealing temperature that was at 52°C. The resulting products were resolved in a 0.8% (w/v) agarose gel, transferred to a nylon membrane, and hybridized with radio-labeled oligonucleotide LP5 or LP6 (5'-CGGAATTCAT GCTCGACGTGAAAAAAGTGCCAACAAGGCCC), directed to the first and the second predicted start codons, respectively (Figure 1). In addition, the amplified fragments were gel purified and submitted to automated sequencing.

Functional complementation of S. cerevisiae
The complete coding sequence of the T. cruzi PGM gene cloned in the EcoRI/XhoI sites of pYES2.0 vector or the pYES 2.0 vector alone were introduced into WT S. cerevisiae (JM245) or into a PGM-deficient yeast mutant (pgm1{Delta}/pgm2{Delta}) (JM645) (a generous gift from Dr. Monica Montero-Lomelí, Universidade Federal do Rio de Janeiro), by the lithium acetate method (Ito et al., 1983Go). The pYES 2.0 expression vector uses the GAL1-promoter to drive insert expression which is induced by shifting the transformed cells to Gal-containing medium. The transformants were plated in synthetic medium-uracyl (URA) supplemented with 2% (w/v) Glc and subsequently re-plated in synthetic medium-URA supplemented with 2% (w/v) Gal and 1% (w/v) raffinose. Plates were incubated at 28°C for 2 days and photographed. S. cerevisiae cells were grown in liquid synthetic medium-URA supplemented with 2% (w/v) Glc to mid-log phase. Growth was monitored by measuring OD560.

Cell extracts and enzyme assays
S. cerevisiae cells were grown in liquid synthetic medium-URA overnight at 28°C and diluted 10 times in this medium the next day. When the cultures reached an OD560 of 0.4, the yeast cells were collected by centrifugation at 3000 x g and transferred to fresh medium containing 2% (w/v) Gal and 1% (w/v) raffinose. After different time intervals, the cells were harvested by centrifugation at 3000 x g, washed with an equal volume of distilled water and resuspended in lysis buffer (50 mM Tris–HCl, pH 7.5, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride). Acid-washed glass beads (0.5 mm, Sigma) were added to the cell suspension at 1:1 (w/v), and cells were lysed by performing six cycles of 1-min vortexing and 1-min incubation on ice. The lysates were submitted to centrifugation at 20,000 x g for 20 min at 4°C, and the supernatant was collected and supplemented with glycerol to a final concentration of 20% (v/v). The protein concentration was determined using the Dc-bioassay kit (BioRad, Richmond, CA). Aliquots were stored at –70°C until use. The enzymatic activity of PGM in S. cerevisiae extracts was assessed, as previously described (Blaxter et al., 1988Go). Briefly, the extracts (50 µg·mL–1) were incubated in 50 mM Tris–HCl, pH 7.5, 1 mM MgCl2, 0.5 mM NADP+ supplemented with 5 U·mL–1 of Glc-6-P dehydrogenase (Sigma) and 4 mM Glc-1-P. Initial rates of product formation were determined by measuring the formation of nicotinamide adenine dinucleotide, reduced form, as assessed by the change in absorbance at 340 nm over time.


    Acknowledgements
 
We thank Leila Faustino and Angela Alves for excellent technical assistance. We are grateful to Dr. Amilcar Tanuri, Dr. Edson Rondinelli, and Dr. Monica Montero-Lomeli (Universidade Federal do Rio de Janeiro, Brazil) for access to the Perkin-Elmer ABI PRISM 3100 automated sequencer, for the donation of the L18 T. cruzi ribosomal protein probe, and for the donation of the S. cerevisiae strains, respectively; and to Dr. Lena Aslund (University of Uppsala, Sweden) for the donation of T. cruzi CL Brener PGM EST clone TENU2518. This work was supported in part by grants from the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), the Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), and the Programa Núcleo de Excelência (PRONEX). The nucleotide sequence reported in this article has been submitted to the GenBank/EBI Data Bank with accession number AY695273 [GenBank] .


    Abbreviations
 
EDTA, ethylenediamine tetracetic acid; Es, epimastigotes; Gal, galactose; Glc, glucose; ORF, open reading frame; P, phosphate; PCR, polymerase chain reaction; PGM, phosphoglucomutase; RT, reverse transcription; SSC, standard saline citrate; Ts, trypomastigotes; UDP, uridine diphosphate; URA, uracyl; WT, wild-type


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Acosta-Serrano, A., Almeida, I.C., Freitas-Junior, L.H., Yoshida, N.Y., and Schenkman, S. (2001) The mucin-like glycoprotein super-family of Trypanosoma cruzi: structure and biological roles. Mol. Biochem. Parasitol., 114, 143–150.[CrossRef][Web of Science][Medline]

Agrellos, O.A., Jones, C., Todeschini, A.R., Previato, J.O., and Mendonça-Previato, L. (2003) A novel sialylated and galactofuranose-containing O-linked glycan, Neu5Ac{alpha}->3Galpß1->6(Galfß1->4)GlcNAc, is expressed on the sialoglycoprotein of Trypanosoma cruzi Dm28c. Mol. Biochem. Parasitol., 126, 93–96.[CrossRef][Web of Science][Medline]

Aiello, D., Fu, L., Miseta, A., and Bedwell, D.M. (2002) Intracellular glucose 1-phosphate and glucose 6-phosphate levels modulate Ca2+ homeotasis in Saccharomyces cerevisiae. J. Biol. Chem., 277, 45751–45758.[Abstract/Free Full Text]

Aiello, D.P., Fu, L., Miseta, A., Sipos, K., and Bedwell, D.M. (2004) The Ca2+ homeostasis defects in a pgm2Delta strain of Saccharomyces cerevisiae are caused by excessive vacuolar Ca2+ uptake mediated by the Ca2+-ATPase Pmc1p. J. Biol. Chem., 279, 38495–38502.[Abstract/Free Full Text]

Bergmeyer, H.U. (1986) Methods in Enzymatic Analysis, 3rd ed. John Wiley & Sons, Inc., Weinheim, Germany.

Bevan, P. and Douglas, H.C. (1969) Genetic control of phosphoglucomutase variants in Saccharomyces cerevisiae. J. Bacteriol., 98, 532–535.[Abstract/Free Full Text]

Blaxter, M.L., Miles, M.A., and Kelly, J.M. (1988) Specific serodiagnosis of visceral leishmaniasis using a Leishmania donovani antigen identified by expression cloning. Mol. Biochem. Parasitol., 30, 259–270.[CrossRef][Web of Science][Medline]

Boothroyd, J.C. and Cross, G.A. (1982) Transcripts coding for variant surface glycoproteins of Trypanosoma brucei have a short identical exon at their 5' end. Gene, 20, 281–289.[CrossRef][Web of Science][Medline]

Brenner, Z. (1973) Biology of Trypanosoma cruzi. Annu. Rev. Microbiol., 27, 347–382.[CrossRef][Web of Science][Medline]

Burleigh, B.A. and Andrews, N.W. (1995) Mechanisms of Trypanosoma cruzi invasion of mammalian cells. The mechanism of Trypanosoma cruzi invasion of mammalians cells. Annu. Rev. Microbiol., 49, 175–200.[CrossRef][Web of Science][Medline]

Daran, J.M., Bell, W., and François, J. (1997) Physiological and morphological effects of genetic alterations leading to a reduced synthesis of UDP-glucose in Saccharomyces cerevisiae. FEMS Microbiol. Lett., 153, 89–96.[CrossRef][Web of Science][Medline]

DiNoia, J.M., Pollevick, G.D., Xavier, M.T., Previato, J.O., Mendonça-Previato, L., Sanchez, D.O., and Frasch, A.C. (1996) High diversity in mucin genes and mucin molecules in Trypanosoma cruzi. J. Biol. Chem., 271, 32078–32083.[Abstract/Free Full Text]

DosReis, G.A., Peçanha, L.M., Bellio, M., Previato, J.O., and Mendonça-Previato, L. (2002) Glycoinositol phospholipids from Trypanosoma cruzi transmit signals to the cells of the host immune system through both ceramide and glycan chains. Microbes Infect., 4, 1007–1013.[CrossRef][Web of Science][Medline]

Fu, L., Miseta, A., Hunton, D., Marchase, R.B., and Bedwell, D.M. (2000) Loss of the major isoform of phosphoglucomutase results in altered calcium homeostasis in Saccharomyces cerevisiae. J. Biol. Chem., 27, 5431–5440.

Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) Transformation of intact yeast cells treated with alkali cations. J. Bacteriol., 153, 163–168.[Abstract/Free Full Text]

Jones, C., Todeschini, A.R., Agrellos, O.A., Previato, J.O., and Mendonça-Previato, L. (2004) Heterogeneity in the biosynthesis of mucin O-glycans from Trypanosoma cruzi Tulahuen strain with the expression of novel galactofuranosyl-containing oligosaccharides. Biochemistry, 43, 11889–11897.[CrossRef][Medline]

Leloir, L.F. (1951) The enzymatic transformation of uridine diphosphate glucose into a galactose derivative. Arch. Biochem., 33, 186–190.[CrossRef][Medline]

Luquetti, A., Prata, A., Moncayo, A., Romanha, A., Jansen, A., Zingales, B., Morel, M., Ponce, C., Chiari, E., Cupolillo, E., and others. (1999) Recommendations from a satellite meeting. Mem. Inst. Oswaldo Cruz, 94, 429–432.[Medline]

Miles, M.A., Lanham, S.M., de Souza, A.A., and Póvoa, M. (1980) Further enzymic characters of Trypanosoma cruzi and their evaluation for strain identification. Trans. R. Soc. Trop. Med. Hyg., 74, 221–237.[CrossRef][Web of Science][Medline]

Neira, I., Ferreira, A.T., and Yoshida, N. (2002) Activation of distinct signal transduction pathways in Trypanosoma cruzi isolates with differential capacity to invade host cells. Int. J. Parasitol., 32, 405–414.[CrossRef][Web of Science][Medline]

Oh, D. and Hopper, J.E. (1990) Transcription of a yeast phosphoglucomutase isozyme gene is galactose inducible and glucose repressible. Mol. Cell Biol., 10, 1415–1422.[Abstract/Free Full Text]

Pereira-Chioccola, V.L., Acosta-Serrano, A., Almeida, I.C., Ferguson, M.A., Souto-Padron, T., Rodrigues, M.M., Travassos, L.R., and Schenkman, S. (2000) Mucin-like molecules form a negatively charged coat that protects Trypanosoma cruzi trypomastigotes from killing by human anti-alpha-galactosyl antibodies. J. Cell Sci., 113, 1299–1307.[Abstract]

Porcile, P.E., Santos, M.R.M., Souza, R.T., Verbisck, N.V., Brandão, A., Urmenyi, T., Silva, R., Rondinelli, E., Lorenzi, H., Levin, M.J., and others. (2003) A refined molecular karyotype for the reference strain of the Trypanosoma cruzi genome project (clone CL Brener) by assignment of chromosome markers. Gene, 308, 53–65.[CrossRef][Web of Science][Medline]

Previato, J.O., Andrade, A.F.B., Pessolani, M.C.V., and Mendonça-Previato, L. (1985) Incorporation of sialic acid into Trypanosoma cruzi macromolecules. A proposal for a new metabolic route. Mol. Biochem. Parasitol., 16, 85–96.[CrossRef][Web of Science][Medline]

Previato, J.O., Andrade, A.F.B., Vermelho, A., Firmino, J.C., and Mendonça-Previato, L. (1990) Evidence for N-glycolylneuraminic acid incorporation by Trypanosoma cruzi from infected animal. Mem. Inst. Oswaldo Cruz, 85, 38.

Previato, J.O., Jones, C., Gonçalves, L.P., Wait, R., Travassos, L.R., and Mendonça-Previato, L. (1994) O-glycosidically linked N-acetylglucosamine-bound oligosaccharides from glycoproteins of Trypanosoma cruzi. J. Biol. Chem., 269, 7970–7975.[Abstract/Free Full Text]

Previato, J.O., Jones, C., Xavier, M.T., Wait, R., Travassos, L.R., Parodi, A.J., and Mendonça-Previato, L. (1995) Structural characterization of the major glycosylphosphatidylinositol membrane-anchored glycoprotein from epimastigote forms of Trypanosoma cruzi Y-strain. J. Biol. Chem., 270, 7241–7250.[Abstract/Free Full Text]

Previato, J.O., Sola-Penna, M., Agrellos, O.A., Jones, C., Oeltmann, T., Travassos, L.R., and Mendonça-Previato, L. (1998) Biosynthesis of O-N-acetylglucosamine-linked glycans in Trypanosoma cruzi. Characterization of the novel uridine diphospho-N-acetylglucosamine:polypeptide N-acetylglucosaminyltransferase-catalyzing formation of N-acetylglucosamine {alpha}1->O-threonine. J. Biol. Chem., 273, 14982–14988.[Abstract/Free Full Text]

Previato, J.O., Wait, R., Jones, C., Reis, G.A., Todeschini, A.R., Heise, N., and Mendonça-Previato, L. (2004) Glycoinositolphospholipid (GIPL) from Trypanosoma cruzi: structure, biosynthesis and Immunology. Adv. Parasitol., 56, 1–41.[Web of Science][Medline]

Roper, J.R. and Ferguson, A.J.M. (2003) Cloning and characterisation of the UDP-glucose 4'-epimerase of Trypanosoma cruzi. Mol. Biochem. Parasitol., 132, 47–53.[CrossRef][Web of Science][Medline]

Roper, J.R., Guther, M.L.S., Milne, K.G., and Ferguson, M.J. (2002) Galactose metabolism is essential for the African sleeping sickness parasite Trypanosoma brucei. Proc. Natl. Acad. Sci. U. S. A., 99, 5884–5889.[Abstract/Free Full Text]

Roper, J.R., Guther, M.L.S., MacRae, J.I., Prescott, A.R., Hallyburton, I., Acosta-Serrano, A., and Ferguson, M.A.J. (2005) The suppression of galactose metabolism in procyclic form Trypanosoma brucei causes cessation of cell growth and alters procyclin glycoprotein structure and copy numbers. J. Biol. Chem., 280, 19728–19766.[Abstract/Free Full Text]

Scharfstein, J. (2003) Activation of bradykinin receptors by Trypanosoma cruzi: a role for cruzipain in microvascular pathology. In Kelly, J. M. (ed.), Molecular Pathogenesis of Chagas’ Disease. Landes Bioscience, Austin, Texas, pp. 111–137.

Schenkman, S., Jiane, M.S., Harth, G.W., and Nussensweig, V. (1991) A novel cell surface trans-sialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell, 65, 1117–1125.[CrossRef][Web of Science][Medline]

Shackelford, G.S., Regni, C.A., and Beamer, L.J. (2004) Evolutionary trace analysis of the alpha-D-phosphohexomutase superfamily. Protein Sci., 13, 2130–2138.[CrossRef][Web of Science][Medline]

Souto, R.P., Fernandes, O., Macedo, A.M., Campbell, D.A., and Zingales, B. (1996) DNA markers define two major phylogenetic lineages of Trypanosoma cruzi. Mol. Biochem. Parasitol., 83, 141–152.[CrossRef][Web of Science][Medline]

Tetaud, E., Barrett, M.P., Bringaud, F., and Baltz, T. (1997) Kinetoplastid glucose transporters. Biochem. J., 325, 569–580.[Medline]

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22, 4673–4680.[Abstract/Free Full Text]

Todeschini, A.R., da Silveira, E.X., Jones, C., Wait, R., Previato, J.O., and Mendonça-Previato, L. (2001) Structure of O-glycosidically linked oligosaccharides from glycoproteins of Trypanosoma cruzi CL-Brener strain: evidence for the presence of O-linked sialyl-oligosaccharides. Glycobiology, 11, 47–55.[Abstract/Free Full Text]

Tsoi, A. and Douglas, H.C. (1964) The effect of mutation of two forms of phosphoglucomutase in Saccharomyces. Biochim. Biophys. Acta, 92, 513–520.[Medline]

Tyler, K. and Miles, M.A. (2003) American trypanosomiasis. In Kluwer. Academic Publishers, UK, Vol. 7, pp. 81–96.

Whitehouse, D.B., Tomkins, J., Lovegrove, J.U., Hopkinson, D.A., and McMillan, W.O. (1998) A phylogenetic approach to the identification of phosphoglucomutase genes. Mol. Biol. Evol., 15, 456–462.[Abstract]

Yoshida, N., Dorta, M.L., Ferreira, A.T., Oshiro, M.E., Mortara, R.A., Acosta-Serrano, A., and Favoreto, S. (1997) Removal of sialic acid from mucin-like surface molecules of Trypanosoma cruzi metacyclic trypamastigotes enhances parasite-host cell interaction. Mol. Biochem. Parasitol., 84, 57–67.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/12/1359    most recent
cwj023v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Penha, L. L.
Right arrow Articles by Lima, A. P. C. d. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Penha, L. L.
Right arrow Articles by Lima, A. P. C. d. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?