Glycobiology Advance Access originally published online on August 25, 2004
Glycobiology 2005 15(1):43-53; doi:10.1093/glycob/cwh136
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology vol. 15 no. 1 © Oxford University Press 2005; all rights reserved.
Molecular analysis of three gain-of-function CHO mutants that add the bisecting GlcNAc to N-glycans
Department of Cell Biology, Albert Einstein College of Medicine, 1300 Morris Park Ave., New York, NY 10461
1 To whom correspondence should be addressed; e-mail: stanley{at}aecom.yu.edu
Received on May 28, 2004; revised on August 9, 2004; accepted on August 18, 2004
| Abstract |
|---|
|
|
|---|
LEC10 Chinese hamster ovary (CHO) cells are gain-of-function mutants that express N-acetylglucosaminyltransferase III (GlcNAc-TIII), the glycosyltransferase that adds the bisecting GlcNAc to complex N-glycans. LEC10 cells are useful for glycosylation engineering of recombinant glycoproteins, including antibody therapeutics, for defining lectin recognition specificities and for determining biological functions of the bisecting GlcNAc. We show that three CHO mutants, LEC10, LEC10A, and LEC10B, arose due to transcriptional activation of the quiescent CHO Mgat3 gene. They each express Mgat3 gene transcripts of
4.7 kb at different levels (LEC10B > LEC10 > LEC10A). Southern analyses gave a single band in LEC10, LEC10A, and parent CHO DNA with four restriction enzymes but an additional band with three of them in LEC10B genomic DNA, indicative of a duplication event in LEC10B. The deduced amino acid sequence of the Mgat3 gene expressed in each CHO mutant and in parent CHO genomic DNA is identical. However, 5' UTR sequences differ with LEC10 and LEC10B containing a 5' UTR segment of the Atf4 gene downstream of the Mgat3 gene in human and mouse. Somatic cell hybrid analysis indicated that the LEC10B Mgat3 gene was induced by a cis mechanism. LEC10B glycoproteins bound more erythroagglutinin lectin (E-PHA) than LEC10 glycoproteins and MALDI-TOF MS revealed a broad spectrum of complex, bisected N-glycans expressed by the LEC10B mutant. LEC10B is therefore the cell line of choice for producing recombinant glycoproteins carrying bisected N-glycans and for investigating biological functions of the bisecting GlcNAc. Key words: complex bisected N-glycans / N-acetylglucosaminyltransferase III / LEC10 mutants / MALDI-TOF MS
| Introduction |
|---|
|
|
|---|
LEC10 Chinese hamster ovary (CHO) mutants were originally isolated as ricin-resistant CHO cells known as RicRII (Stanley et al., 1975
Recent studies have shown that the presence of the bisecting GlcNAc reduces the binding of galectin 1 to complex N-glycans (Andre et al., 2004
; Patnaik et al., unpublished data). There are several galectins with various biological functions (Rabinovich et al., 2002
) that may be modulated by the presence of the bisecting GlcNAc on cell surface glycoproteins. In addition, the presence of the bisecting GlcNAc has long been known to affect the access of certain enzymes to N-glycans during their synthesis (reviewed in Schachter, 1991
). There are numerous examples of Mgat3 cDNA overexpression altering cellular functions related to growth control (see Gu et al., 2004
, and references therein). In addition, GlcNAc-TIII promotes liver tumor progression in rats (Narasimhan et al., 1988
; Nishikawa et al., 1988
) and mice (Bhaumik et al., 1998
; Stanley, 2002
; Yang et al., 2000
, 2003
) although overexpressed GlcNAc-TIII may act as a tumor suppressor under certain circumstances (Ekuni et al., 2002
). IgG1 with the bisecting GlcNAc has been reported to have enhanced antigen-dependent cellular cytotoxicity (ADCC) activity (Davies et al., 2001
; Lifely et al., 1995
; Shinkawa et al., 2003
; Umana et al., 1999
). Thus it is important to understand the molecular basis of gain-of-function LEC10 mutants that may be used to identify functions of the bisecting GlcNAc and for glycosylation engineering of recombinant therapeutic glycoproteins (Stanley, 1992
). Molecular analysis could also provide insight into transcriptional and posttranscriptional mechanisms controlling GlcNAc-TIII levels.
In this article, the molecular origins of three independent LEC10 mutants are described. These isolates vary markedly in GlcNAc-TIII enzyme activity. The mutant ProLEC10.39.3 (now called LEC10A) has very low GlcNAc-TIII activity (
0.2 nmol/mg protein/h) whereas ProLEC10.200.38 (now called LEC10B) has the highest level of GlcNAc-TIII activity (
20 nmol/mg protein/h) compared to the original LEC10 isolate that has GlcNAc-TIII of
8 nmol/mg protein/h (Sallustio and Stanley, 1989
). Here we show that the Mgat3 gene is transcriptionally silent in CHO cells and is expressed de novo in all three LEC10 mutants. LEC10B has the highest level of Mgat3 gene transcripts and the highest GlcNAc-TIII activity.
| Results |
|---|
|
|
|---|
The Mgat3 gene is expressed in LEC10, LEC10A, and LEC10B mutants but not parent CHO cells
Previous data showed that LEC10 mutants express GlcNAc-TIII enzyme activity, whereas parent CHO cells do not (Campbell and Stanley, 1984
4.7 kb were present in LEC10, LEC10A, and LEC10B cells but were absent from parental CHO cells. The relative expression of the Mgat3 gene was LEC10B > LEC10 > LEC10A. To determine if Mgat3 gene transcripts could be detected in CHO cells by reverse transcription polymerase chain reaction (RT-PCR), first-strand cDNA was synthesized using oligo d(T) primer PS131, and coding sequence primers were used to amplify a portion of the Mgat3 gene open reading frame (ORF). After gel electrophoresis, PCR products were transferred to membrane and probed with a mouse 0.58-kb Mgat3 gene coding region probe. PCR products corresponding to the coding sequence of
1.2 kb were detected in LEC10, LEC10A, and LEC10B mutants but not in CHO cells (data not shown). Therefore the Mgat3 gene is transcribed in each LEC10 mutant but is transcriptionally silent in parent CHO cells.
|
Increased levels of bisecting GlcNAc on LEC10B glycoproteins
The lectin E-PHA binds significantly better to complex N-glycans with a bisecting GlcNAc than to those without (Cummings and Kornfeld, 1982
twofold higher GlcNAc-TIII activity (Sallustio and Stanley, 1989
|
Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) in the positive ion mode of N-glycans released by PNGase F (N-glycanase) from LEC10 and LEC10B glycoproteins showed that most complex N-glycans in LEC10 and LEC10B carry the bisecting GlcNAc (Figure 3B, 3C; Table I). Similar results were previously obtained with N-glycans released from CHO cells expressing an Mgat3 cDNA (Lee et al., 2003a
|
|
Southern analysis of the Mgat3 gene in LEC10, LEC10A, and LEC10B cells
The different levels of Mgat3 gene transcripts in LEC10 mutants might reflect differences in transcriptional control or in gene dosage between LEC10 cell lines. To address this question, genomic DNA from parental CHO cells and the LEC10 CHO mutants was subjected to Southern analysis. Genomic DNA from CHO, LEC10, and LEC10A cells gave a single band after digestion with EcoR1 and Sph1 (Figure 4). LEC10 and LEC10A genomic DNA also gave a single band with HindIII (
12 kb) and BglII (
3.3 kb). However, genomic DNA from LEC10B gave a band corresponding to the wild-type Mgat3 gene and an extra band on digestion with EcoR1 and Sph1 (Figure 4) as well as HindIII (
8.2 kb), although not with BglII. This suggests that LEC10B cells may possess an additional copy of the Mgat3 gene coding region. This might be responsible for the increased Mgat3 gene transcripts in LEC10B cells (Figure 1), leading to its high GlcNAc-TIII activity (Sallustio and Stanley, 1989
|
The Mgat3 gene is activated by a cis mechanism in LEC10B cells
The Mgat3 gene is active in all LEC10 mutants but is silent in parental CHO cells (Figure 1). Mgat3 gene activation could be due to either a cis- or trans-regulated mechanism at the transcriptional level. Cis mechanisms include a promoter mutation, gene rearrangement, or mutation affecting transcription of the Mgat3 gene. Trans mechanisms include activation of a positive or negative regulator of gene transcription or RNA stability as observed previously with the LEC11B CHO mutant (Zhang et al., 1999
60% GlcNAc-TIII activity compared with unfused LEC10 cells, suggesting the Mgat3 gene is cis-regulated in LEC10 cells (Sallustio and Stanley, 1989
|
Amino acid sequences of the Mgat3 gene from CHO genomic DNA and LEC10 cDNAs are identical
The coding region of the Mgat3 gene was sequenced following RT-PCR of poly(A+) RNA from LEC10, LEC10A, and LEC10B cells using a 3' untranslated region (UTR) degenerate primer derived from conserved mouse, rat, and human sequences and a 5' primer spanning the ATG derived from 5' rapid amplification of cDNA ends (RACE). The Mgat3 gene coding region has no introns (Bhaumik et al., 1995
The ORF of Mgat3 cDNAs from LEC10, LEC10A, and LEC10B and the Mgat3 gene in genomic DNA from CHO is 1608 nt. There were only two nucleotide variations observed: At nucleotide 172, CHO, LEC10A, and LEC10B has a G, whereas LEC10 has an A; at nucleotide 1200 there was an A in all sequences, but some clones had a C. Each variation was in the wobble position of the codon and did not affect the amino acid sequence. The CHO ORF nucleotide sequence is 90% identical to mouse and rat and 88% identical to human. It is 9295% identical to mouse, rat, and human sequences at the amino acid level. CHO GlcNAc-TIII is a type II transmembrane protein, with a cytoplasmic domain, a signal anchor (aa
624 depending on the algorithm used) and a catalytic domain (aa
25535). It has three N-glycan sites at aa 242, 260, and 398 and several protein motifs that might be modified by phosphorylation (Eukaryotic Linear Motif Resource; http://elm.eu.org). Amino acids 33 to 84 include a proline-rich sequence present in all GlcNAc-TIII sequences. Multiple alignment of CHO, mouse, rat, and human GlcNAc-TIII (Figure 6A) revealed significant variations specific to the CHO sequence (Table I). For example, at position 99 Ser is present in GlcNAc-TIII of CHO, whereas Pro is present in GlcNAc-TIII of mouse, rat, and human. Such nonconservative differences are of interest from a structural perspective because they are clearly compatible with good levels of GlcNAc-TIII transferase activity.
|
Different Mgat3 5' UTR in LEC10A compared to LEC10 and LEC10B
Multiple promoters and different splicing sites are used in generating human MGAT3 gene transcripts (Koyama et al., 1996
The hamster LEC10A 5' UTR sequence is
60% identical to the 5' UTR sequence immediately upstream of the human MGAT3 gene. By contrast, the LEC10 and LEC10B 5' UTR has a stretch of sequence from nt 49 to 180 that is 97% identical to a segment of the 5' UTR of the mouse Atf4 (activating transcription factor 4) gene and 93% identical to the corresponding 5' UTR segment of the human ATF4 gene. Human ATF4 is located 28.4 kb, and mouse Atf4 is located 49 kb downstream of the respective MGAT3 or Mgat3 genes. There is a hypothetical gene in between Mgat3 and Atf4 in human and mouse, and all three genes are transcribed in the same direction. This indicates that a rearrangement event occurred in LEC10 and LEC10B to place a small portion of the 5' UTR of the Atf4 gene upstream of the CHO Mgat3 gene.
| Discussion |
|---|
|
|
|---|
Gain-of-function CHO glycosylation mutants that express a glycosyltransferase absent from parent CHO provide many opportunities for fundamental studies in glycobiology and for the production of glycoproteins specifically modified with a particular sugar residue. The LEC10 mutants described here are a valuable alternative to cells overexpressing an Mgat3 cDNA from an exogenous promoter. LEC10 mutants are stable in the absence of selection and the activated gene is not silenced with time as is common for cDNAs expressed from foreign vector sequences. LEC10 revertants may be selected but they occur at low frequency (Sallustio and Stanley, 1989
Interestingly, the Mgat3 ORF from each mutant is an identical amino acid sequence with only two nucleotide variations that do not affect sequence. The same sequence is encoded in the CHO genome, another testament to the very low frequency of mutation in cultured CHO cells (Chen and Stanley, 2003
; Chen et al., 2001
; Lee et al., 2003b
). It is noteworthy, however, that hamster GlcNAc-TIII has several amino acid differences from mouse, rat and human GlcNAc-TIII (Table II). These differences span the CHO GlcNAc-TIII sequence and include changes to amino acids with very distinct properties. This information may be useful for future investigations of GlcNAc-TIII catalysis by site-directed mutagenesis. A DXD motif, Asp321Val322Asp323, is present in human GlcNAc-TIII and the mutations D321A or D323A inactivate GlcNAc-TIII activity, whereas the D329A mutation does not (Ihara et al., 2002
). Overexpression of D323A GlcNAc-TIII in HuH-6 cells inhibits endogenous GlcNAc-TIII enzyme activity, apparently by a dominant negative mechanism. Truncated murine GlcNAc-TIII with 371 N-terminal amino acids is also inactive but does not behave in a dominant negative manner (Bhattacharyya et al., 2002
).
|
The LEC10 mutants also provide cells with which to identify conserved positive regulators of transcription of the Mgat3 gene and mechanisms of translational control of Mgat3 mRNA. For example, the 5' UTR of LEC10A Mgat3 transcripts that differs from LEC10 and LEC10B Mgat3 5' UTR sequences may be the reason for its very low GlcNAc-TIII activity (Sallustio and Stanley, 1989
LEC10 CHO mutants have been used to generate virus and cellular glycoproteins with N-glycans that possess the bisecting GlcNAc (Bhattacharyya et al., 2002
; Campbell and Stanley, 1984
; Lee et al., 2003a
). LEC10 CHO cells should therefore be particularly useful for synthesizing humanized IgG1 monoclonal antibodies that are being generated for recombinant therapeutics for treatment of a wide variety of human diseases (Jolliffe, 1993
; Yoo et al., 2002
). For maximum expression of the bisecting GlcNAc, the LEC10B mutant would be the cell line of choice. LEC10A should give a low level of bisecting GlcNAc and LEC10 cells an intermediate level. Transfection of an Mgat3 cDNA into cells may achieve the same goal. However, high levels of GlcNAc-TIII may be toxic (Umana et al., 1999
). The Fc region of IgG1 has a biantennary complex N-glycan at Asn 297 and the composition of this N-glycan is important for the overall structure of the Fc region as well as for different functions mediated by the Fc (Jefferis et al., 1998
; Saphire et al., 2003
). Natural human IgG1 has small amounts of N-glycans with the bisecting GlcNAc at Asn 297 (Grey et al., 1982
; Takahashi et al., 1987
). Increasing the content of bisecting GlcNAc on the N-glycans of human IgG1 has been shown to significantly enhance ADCC (Lifely et al., 1995
; Shinkawa et al., 2003
; Umana et al., 1999
). However, a high content of core fucose in the biantennary N-glycan at Asn 297 correlates with reduced ADCC activity (Shinkawa et al., 2003
). Therefore the optimal cell line for producing humanized IgG1 with good ADCC activity is predicted to be the LEC10B CHO mutant with an inactivating mutation in the Fut8 gene that encodes the N-glycan core
(1,6)fucosyltransferase. IgG1 from such a cell would have biantennary N-glycans at Asn 297 that lack the core fucose but carry the bisecting GlcNAc.
| Materials and methods |
|---|
|
|
|---|
Cell lines and cell culture
Pro5 and ProLEC10.3C CHO cells (Stanley et al., 1975
medium (Invitrogen, Carlsbad, CA) containing 10% fetal calf serum (Gemini, Woodland, CA). Hybrids between CHO and LEC10B cells were generated by somatic cell hybridization using polyethylene glycol as described (Sallustio and Stanley, 1989
RNA isolation and northern analysis
TRIzol reagent (1 ml) was added to 107 cells on ice, samples were homogenized, and RNA was extracted with 0.2 ml chloroform and 0.5 ml isopropanol. After washing with 75% ethanol, RNA was dissolved in diethylpyrocarbonate-treated water. Poly (A)+ RNA was affinity purified from an oligo-dT column and stored at 80°C. For northern analysis, poly (A)+ RNA (5 µg) was electrophoresed on a 1.2% agarose gel containing formaldehyde and transferred to a nylon membrane (Amersham, Little Chalfont, UK). After cross-linking, the membrane was prehybridized overnight at 60°C in 50 mM piperazine-N,N'-bis(2-ethane sulfonic acid, pH 6.5, 0.1 M NaCl, 50 mM sodium phosphate buffer, 0.5 mM ethylenediamine tetra-acetic acid, 5% SDS, and 60 µg/ml herring sperm DNA. Probes were labeled using the Prime-it kit (Stratagene, La Jolla, CA). Mgat3 gene probes were either a 0.58 kb BglI/PstI Mgat3 gene coding region fragment (Bhaumik et al., 1998
) or cDNA generated by PCR using primers PS82 (5' GCACTAGGCGCAAGTGGGTTGAG 3') and PS211 (5' TGGCCGGTGCGGTTCTCATACT 3'). Hybridization was performed in the same buffer at 60°C overnight. The membrane was washed in 2x SSC (1x SSC is 150 mM sodium chloride, 15 mM sodium citrate, pH 7), 0.1% SDS for 20 min at room temperature and subsequently for 30 min at 60°C. Blots were stripped and reprobed for GAPDH. Membrane was exposed to Kodak X-OMAT film at 80°C and developed.
Lectin blot analysis
Cell extracts (
50 µg protein) were electrophoresed in a 10% SDSPAGE reducing gel. Proteins were transferred to membrane rinsed with Tris-buffered saline (TBS, pH 7.2) and incubated in 5% nonfat milk in TBS with 0.01% Thimerasol for 1 h at 37°C. The membrane was treated with mild acid to remove sialic acid (0.025 M H2SO4 at 80°C for 1 h and neutralized with TBS) incubated with 1 µg/ml biotinylated E-PHA (Vector Labs, Burlingame, CA) in TBS containing 0.05% NP-40 (TBS/N) and 5% nonfat milk for 1 min at room temperature. After washing for 30 min with several changes of TBS/N, membrane was incubated in 0.2 µg/ml horseradish peroxidasestreptavidin (Vector) in TBS/N containing 5% nonfat milk for 1 h at room temperature. The blot was washed six times with TBS/N and twice with TBS before exposure to ECL reagent (Dupont/NEN, Boston, MA) for 1 min and to X-ray film. Proteins were stained with Ponceau S.
MALDI-TOF MS
Glycoproteins were extracted from CHO and LEC10B cells in 1.5% Triton X-100 containing protease inhibitors and treated with PNGase F (New England BioLabs, Beverly, MA) as described (Lee et al., 2003a
). MALDI-TOF MS was performed on a Voyager DE Biospectrometry Work Station (Perseptive Biosystem) equipped with delayed extraction as described. Oligosaccharide standards of known structure were used for external calibration for mass assignment of ions and D-arabinosazone (Chen et al., 1997
) was used as the matrix in the positive ion mode for the analysis of neutral oligosaccharides.
Southern analysis
Genomic DNA (20 µg) was digested with restriction enzymes overnight at 37°C. After electrophoresis on a 0.8% agarose gel and transfer to nylon membrane, blots were probed with a 0.58 kb BglI/PstI Mgat3 gene coding region fragment (Bhaumik et al., 1998
), labeled with the Prime-It RmT random radioactive labeling kit (Stratagene). Prehybridization and hybridization were carried out at 65°C for 2 h in rapid hybridization buffer (Amersham). Washing conditions were 0.1x SSC and 0.1% SDS for 20 min at room temperature and subsequently for 30 min at 65°C.
RT-PCR
Total or polyA+ RNA from LEC10, LEC10A and LEC10B was digested with RNase-free DNaseI and cDNA synthesis was carried out for 50 min at 42°C in first-strand buffer containing 25 mM TrisHCl (pH 8.3), 75 mM KCl, and 3 mM MgCl2, 1030 pmol primer PS131 (5' TTTTGTACAAGCT21 3'), 10 mM dithiothreitol, 0.5 mM dNTPs, 1 µl RNase inhibitor, and 2 µl Superscript II reverse transcriptase. After heating for 15 min at 70°C, 1 ml RNAse H was added for 20 min at 37°C. The products were stored at 20°C or 5 µl was used for PCR amplification. The PCR reaction in 50 µl contained 2.5 U Taq polymerase (Perkin Elmer, Boston, MA), 2030 pmol degenerate 3' UTR primer PS227 (5' CACCTCNTNNCCACNGCANTCNTGG 3') and primer PS210 (5' GGATGAAGATGAGACGCTACAA 3') determined from sequencing of 5' RACE products, 2.0 mM Mg2+, 0.25 mM dNTPs, PCR reaction buffer (Perkin Elmer), and first-strand cDNA. PCR was performed through 3440 cycles at 94°C for 1 min, at 5760°C for 1 min, and 72°C for 2 min, followed by elongation for 15 min at 72°C. The same PCR conditions and gene-specific primers determined from cDNA sequencing were used to amplify the Mgat3 gene coding region from genomic DNA. DNA was sequenced from both strands by the Sequencing Facility at the Albert Einstein College of Medicine.
5' RACE
Poly (A)+ RNA (2 µg) was used to synthesize cDNA from 15 pmol CHO Mgat3 gene-specific primer PS224 (5' TACTCGAAGGTGCCATTGGTCA 3') in 50 µl containing 25 mM TrisHCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 0.5 mM dNTPs, 40 U of RNase inhibitor, and 2 µl of Superscript II reverse transcriptase. The reaction was carried out at 42°C for 50 min before treatment at 70°C for 15 min, followed by the addition of 1 µl of RNase H (2.5 U/µl, Gibco BRL, Grand Island, NY) and incubation at 37°C for 20 min. Purified cDNA products (30 µl) were denatured at 94°C for 5 min and chilled on ice, and 3 µl terminal deoxynucleotidyltransferase (TdT, 15 U/µl, Gibco/Invitrogen), 10 µl 5x TdT buffer and 4 µl of 2.5 mM dATP were added in 50 µl and incubated at 37°C for 15 min followed by 70°C for 15 min. Poly Atailed first-strand cDNA products (10 µl) were used for first-round PCR with primers PS207 (anchored oligodT; 5' GATCAGAATTCAGCGGCCGCACCT19 3') and PS192 Mgat3 gene-specific primer (5' TACCTGGTTTGAAGCACACACC 3'). For second-round PCR, 5 µl of 1:25 diluted first round PCR products, together with primers PS208 (anchor; 5' GATCAGAATTCAGCGGCCGCACC 3') and PS250 (5' GACAGGGGCATTGTTCCAGAAG 3'). PCR reactions were performed with the PCRx Enhancer System (Gibco BRL) that contained 0.25 mM dNTPs, 2x PCRx Enhancer, and 0.5 U/µl Taq polymerase in 50 µl. To confirm 5' RACE products from Mgat3 cDNAs, PCR products were separated on a 0.8% agarose gel, transferred to membrane and probed with the nested primer PS210 (5' GGATGAAGATGAGACGCTACAA 3'). 5' RACE products were excised from the gel, purified through a gel-extraction kit (Qiagen, Valencia, CA) and cloned into the TA cloning vector pCR2.1 (Invitrogen) to sequence.
| Acknowledgements |
|---|
The authors thank Xiaoping Yang for northern analysis, RT-PCR, sequence analysis, and helpful comments and Joseph Chang for Southern analysis. This work was supported by a grant from the National Cancer Institute (RO1 30645) to P.S. and by partial support from Albert Einstein Cancer Center grant PO1 13330. Accession numbers: CHO Mgat3 gene coding sequence AY598727; partial 5' UTR sequences of LEC10 (AY598728), LEC10B (AY598729), and LEC10A (AY598730).
| Footnotes |
|---|
2 Present address: Department of Medicine, Beth Israel Deaconness Medical Center, 330 Brookline Ave. RW563, Boston, MA 02215
| Abbreviations |
|---|
ADCC, antigen-dependent cellular cytotoxicity; CHO, Chinese hamster ovary; GAPDH, glyceraldehyde 3' phosphate dehydrogenase; MALDI-TOF MS, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry; ORF, open reading frame; RACE, rapid amplification of cDNA ends; RT-PCR, reverse transcription polymerase chain reaction; SDSPAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis; TBS, Tris-buffered saline; UTR, untranslated region
| References |
|---|
|
|
|---|
Andre, S., Unverzagt, C., Kojima, S., Frank, M., Seifert, J., Fink, C., Kayser, K., von der Lieth, C.W., and Gabius, H.J. (2004) Determination of modulation of ligand properties of synthetic complex-type biantennary N-glycans by introduction of bisecting GlcNAc in silico, in vitro and in vivo. Eur. J. Biochem., 271, 118134.[Web of Science][Medline]
Bhattacharyya, R., Bhaumik, M., Raju, T.S., and Stanley, P. (2002) Truncated, inactive N-acetylglucosaminyltransferase III (GlcNAc-TIII) induces neurological and other traits absent in mice that lack GlcNAc-TIII. J. Biol. Chem., 277, 2630026309.
Bhaumik, M., Seldin, M.F., and Stanley, P. (1995) Cloning and chromosomal mapping of the mouse Mgat3 gene encoding N-acetylglucosaminyltransferase III. Gene, 164, 295300.[CrossRef][Web of Science][Medline]
Bhaumik, M., Harris, T., Sundaram, S., Johnson, L., Guttenplan, J., Rogler, C., and Stanley, P. (1998) Progression of hepatic neoplasms is severely retarded in mice lacking the bisecting N-acetylglucosamine on N-glycans: evidence for a glycoprotein factor that facilitates hepatic tumor progression. Cancer Res., 58, 28812887.
Campbell, C. and Stanley, P. (1984) A dominant mutation to ricin resistance in Chinese hamster ovary cells induces UDP-GlcNAc:glycopeptide beta-4-N-acetylglucosaminyltransferase III activity. J. Biol. Chem., 259, 1337013378.
Chen, P., Baker, A.G., and Novotny, M.V. (1997) The use of osazones as matrices for the matrix-assisted laser desorption/ionization mass spectrometry of carbohydrates. Anal. Biochem., 244, 144151.[CrossRef][Web of Science][Medline]
Chen, W. and Stanley, P. (2003) Five Lec1 CHO cell mutants have distinct Mgat1 gene mutations that encode truncated N-acetylglucosaminyltransferase I. Glycobiology, 13, 4350.
Chen, W., Unligil, U.M., Rini, J.M., and Stanley, P. (2001) Independent Lec1A CHO glycosylation mutants arise from point mutations in N-acetylglucosaminyltransferase I that reduce affinity for both substrates. Molecular consequences based on the crystal structure of GlcNAc-TI(,). Biochemistry, 40, 87658772.[CrossRef][Medline]
Cummings, R.D. and Kornfeld, S. (1982) Characterization of the structural determinants required for the high affinity interaction of asparagine-linked oligosaccharides with immobilized Phaseolus vulgaris leukoagglutinating and erythroagglutinating lectins. J. Biol. Chem., 257, 1123011234.
Davies, J., Jiang, L., Pan, I.Z., LaBarre, M.J., Anderson, D., and Reff, M. (2001) Expression of GnTIII in a recombinant anti-CD20 CHO production cell line: expression of antibodies with altered glycoforms leads to an increase in ADCC through higher affinity for FC gamma RIII. Biotechnol. Bioeng., 74, 288294.[CrossRef][Web of Science][Medline]
Ekuni, A., Myoshi, E., Ko, J.H., Noda, K., Kitada, T., Ihara, S., Endo, T., Hino, A., Honke, K., and Taniguchi, N. (2002) A glycomic approach to hepatic tumors in N-acetylglucosaminyltransferase III (GnT-III) transgenic mice induced by dithylnitrosamine (DEN): identification of haptoglobin as a taget molecule of GnT-III. Free Radic. Res., 36, 827833.[CrossRef][Web of Science][Medline]
Green, E.D., and Baenziger, J.U. (1987) Oligosaccharide specificities of Phaseolus vulgaris leukoagglutinating and erythroagglutinating phytohemagglutinins. Interactions with N-glycanase-released oligosaccharides. J. Biol. Chem., 262, 1201812029.
Grey, A.A., Narasimhan, S., Brisson, J.R., Schachter, H., and Carver, J.P. (1982) Structure of the glycopeptides of a human gamma 1-immunoglobulin G (Tem) myeloma protein as determined by 360-megahertz nuclear magnetic resonance spectroscopy. Can. J. Biochem., 60, 11231131.[Web of Science][Medline]
Gu, J., Zhao, Y., Isaji, T., Shibukawa, Y., Ihara, H., Takahashi, M., Ikeda, Y., Miyoshi, E., Honke, K., and Taniguchi, N. (2004) Beta1,4-N-acetylglucosaminyltransferase III down-regulates neurite outgrowth induced by costimulation of epidermal growth factor and integrins through the Ras/ERK signaling pathway in PC12 cells. Glycobiology, 14, 177186.
Ihara, Y., Nishikawa, A., Tohma, T., Soejima, H., Niikawa, N., and Taniguchi, N. (1993) cDNA cloning, expression, and chromosomal localization of human N-acetylglucosaminyltransferase III (GnT-III). J. Biochem. (Tokyo), 113, 692698.
Ihara, H., Ikeda, Y., Koyota, S., Endo, T., Honke, K., and Taniguchi. (2002) A catalytically inactive b1,4-N-acetylglucosaminyltransferase III (GnT-III) behaves as a dominant negative GnT-III inhibitor. Eur. J. Biochem., 269, 193201.[Web of Science][Medline]
Jefferis, R., Lund, J., and Pound, J.D. (1998) IgG-Fc-mediated effector functions; molecular definition of interaction sites for effector ligands and the role of glycosylation. Immunol. Rev., 163, 5976.[CrossRef][Web of Science][Medline]
Joliffe, L.K. (1993) Humanized antibodies: enhancing therapeutic utility through antibody engineering. Int. Rev. Immunol., 10, 241250.[Medline]
Koyama, N., Miyoshi, E., Ihara, Y., Kang, R., Nishikawa, A., and Taniguchi, N. (1996) Human N-acetylglucosaminyltransferase III gene is transcribed from multiple promoters. Eur. J. Biochem., 238, 853861.[Web of Science][Medline]
Lee, J., Sundaram, S., Shaper, N.L., Raju, T.S., and Stanley, P. (2001) Chinese hamster ovary (CHO) cells may express six ß4-galactosyltransferases (ß4GalTs). Consequences of the loss of functional ß4GalT-1, ß4GalT-6, or both in CHO glycosylation mutants. J. Biol. Chem., 276, 1392413934.
Lee, J., Park, S.H., and Stanley, P. (2003a) Antibodies that recognize bisected complex N-glycans on cell surface glycoproteins can be made in mice lacking N-acetylglucosaminyltransferase III. Glycoconj. J., 19, 211219.[CrossRef]
Lee, J., Park, S.H., Sundaram, S., Raju, T.S., Shaper, N.L., and Stanley, P. (2003b) A mutation causing a reduced level of expression of six ß4-Galactosyltransferase genes is the basis of the Lec19 CHO glycosylation mutant. Biochemistry, 42, 1234912357.[CrossRef][Medline]
Lifely, M.R., Hale, C., Boyce, S., Keen, M.J., and Phillips, J. (1995) Glycosylation and biological activity of CAMPATH-1H expressed in different cell lines and grown under different culture conditions. Glycobiology, 5, 813822.
Narasimhan, S. (1982) Control of glycoprotein synthesis. UDP-GlcNAc:glycopeptide ß4-N-acetylglucosaminyltransferase III, an enzyme in hen oviduct which adds GlcNAc in ß1-4 linkage to the ß-linked mannose of the trimannosyl core of N-glycosyl oligosaccharides. J. Biol. Chem., 257, 1023510242.
Narasimhan, S., Schachter, H., and Rajalakshmi, S. (1988) Expression of N-acetylglucosaminyltransferase III in hepatic nodules during rat liver carcinogenesis promoted by orotic acid. J. Biol. Chem., 263, 12731281.
Nishikawa, A., Fujii, S., Sugiyama, T., Hayashi, N., and Taniguchi, N. (1988) High expression of an N-acetylglucosaminyltransferase III in 3'-methyl DAB-induced hepatoma and ascites hepatoma. Biochem. Biophys. Res. Commun., 152, 107112.[CrossRef][Web of Science][Medline]
Nishikawa, A., Ihara, Y., Hatakeyama, M., Kangawa, K. and Taniguchi, N. (1992) Purification, cDNA cloning, and expression of UDP-N-acetylglucosamine: ß-D-mannoside ß-1,4N-acetylglucosaminyltransferase III from rat kidney. J. Biol. Chem., 267, 1819918204.
Priatel, J.J., Sarkar, M., Schachter, H., and Marth, J.D. (1997) Isolation, characterization and inactivation of the mouse Mgat3 gene: the bisecting N-acetylglucosamine in asparagine-linked oligosaccharides appears dispensable for viability and reproduction. Glycobiology, 7, 4556.
Rabinovich, G.A., Baum, L.G., Tinari, N., Paganelli, R., Natoli, C., Liu, F.T., and Iacobelli, S. (2002) Galectins and their ligands: amplifiers, silencers or tuners of the inflammatory response? Trends Immunol., 23, 313320.[CrossRef][Web of Science][Medline]
Sallustio, S. and Stanley, P. (1989) Novel genetic instability associated with a developmentally regulated glycosyltransferase locus in Chinese hamster ovary cells. Som. Cell Mol. Genet., 15, 387400.[CrossRef][Web of Science][Medline]
Saphire, E.O., Stanfield, R.I., Crispin, M.D., Morris, G., Zwick, M.B., Pantophlet, R.A., Patten, P.W., Rudd, P.M., Dwek, R.A., Burton, D.R., and Wilson, I.A. (2003) Crystal structure of an intact human IgG: antibody assymetry, flexibility, and a guide for HIV-1 vaccine design. Adv. Exp. Med. Biol., 535, 5566.[Web of Science][Medline]
Schachter, H. (1991) The "yellow brick road" to branched complex N-glycans. Glycobiology, 1, 453461.
Shinkawa, T., Nakamura, K., Yamane, N., Shoji-Hosaka, E., Kanda, Y., Sakurada, M., Uchida, K., Anazawa, H., Satoh, M., Yamasaki, M., and others. (2003) The absence of fucose but not the presence of galactose or bisecting N-acetylglucosamine of human IgG1 complex-type oligosaccharides shows the critical role of enhancing antibody-dependent cellular cytotoxicity. J. Biol. Chem., 278, 34663473.
Stanley, P. (1992) Glycosylation engineering. Glycobiology, 2, 99107.
Stanley, P. (2002) Biological consequences of overexpressing or eliminating N-acetylglucosaminyltransferase-TIII in the mouse. Biochim. Biophys. Acta, 1573, 363368.[Medline]
Stanley, P. and Siminovitch, L. (1977) Complementation between mutants of CHO cells resistant to a variety of plant lectins. Som. Cell Genet., 3, 391405.
Stanley, P., Caillibot, V., and Siminovitch, L. (1975) Selection and characterization of eight phenotypically distinct lines of lectin-resistant Chinese hamster ovary cell. Cell, 6, 121128.[CrossRef][Web of Science][Medline]
Takahashi, N., Ishii, I., Ishihara, H., Mori. M., Tejima, S., Jefferis, R., Endo, S., and Arata, Y. (1987) Comparative structural study of the N-linked oligosaccharides of human normal and pathological immunoglobulin G. Biochemistry, 26, 11371144.[CrossRef][Medline]
Umana, P., Jean-Mairet, J., Moudry, R., Amstutz, H., and Bailey, J.E. (1999) Engineered glycoforms of an antineuroblastoma IgG1 with optimized antibody-dependent cellular cytotoxic activity. Nat. Biotechnol., 17, 176180.[CrossRef][Web of Science][Medline]
Yang, X., Bhaumik, M., Bhattacharyya, R, Gong, S., Rogler, C., and Stanley, P. (2000) New evidence for an extra-hepatic role of N- acetylglucosaminyltransferase III in the progression of diethylnitrosamine-induced liver tumors in mice. Cancer Res., 60, 33133319.
Yang, X., Tang, J., Rogler, C., and Stanley, P. (2003) Reduced hepatocyte proliferation is the basis of retarded liver tumor progression and liver regeneration in mice lacking N-acetylglucosaminyltransferase III. Cancer Res., 63, 77537759.
Yoo, E.M., Chintalacharuvu, K.R., Penichet, M.I., and Morrison, S.L. (2002) Myelome expression systems. J. Immunol. Methods, 261, 120.[Web of Science][Medline]
Zhang, A., Potvin, B., Zaiman, A., Chen, W., Kumar, R., Phillips, L., and Stanley, P. (1999) The gain-of-function Chinese hamster ovary mutant LEC11B expresses one of two Chinese hamster FUT6 genes due to the loss of a negative regulatory factor. J. Biol. Chem., 274, 1043910450.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. K. Patnaik, B. Potvin, S. Carlsson, D. Sturm, H. Leffler, and P. Stanley Complex N-glycans are the major ligands for galectin-1, -3, and -8 on Chinese hamster ovary cells Glycobiology, April 1, 2006; 16(4): 305 - 317. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







