Skip Navigation


Glycobiology Advance Access originally published online on May 12, 2004
Glycobiology 2004 14(9):783-792; doi:10.1093/glycob/cwh092
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/9/783    most recent
cwh092v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Citing Articles
Right arrowScopus Links
Google Scholar
Right arrow Articles by Greco, C.
Right arrow Articles by Malorni, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Greco, C.
Right arrow Articles by Malorni, W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology vol. 14 no. 9 © Oxford University Press 2004; all rights reserved.

Cell surface overexpression of galectin-3 and the presence of its ligand 90k in the blood plasma as determinants in colon neoplastic lesions

Claudia Greco2, Rosa Vona2,3, Maurizio Cosimelli4, Paola Matarrese3,5, Elisabetta Straface3,5, Patrizia Scordati6, Diana Giannarelli7, Vincenzo Casale8, Daniela Assisi8, Marcella Mottolese6, Anna Moles9 and Walter Malorni1,2,3

2 Clinical Pathology Service, Polo Oncologico Regina Elena, Rome, Italy; 3 Laboratory of Ultrastructures, Istituto Superiore di Sanitá, Viale Regina Elena 299, 00161 Rome, Italy; 4 Surgical Department, Polo Oncologico Regina Elena, Rome, Italy; 5 Department of Drug Research and Evaluation, Istituto Superiore di Sanitá, Viale Regina Elena 299, 00161 Rome, Italy; 6 Pathological Anatomy Service, Polo Oncologico Regina Elena, Rome, Italy; 7 Service of Statistics, Polo Oncologico Regina Elena, Rome, Italy; 8 Digestive Endoscopy Service, Polo Oncologico Regina Elena, Rome, Italy; and 9 Institute of Neuroscience, National Research Council, Rome, Italy

Received on March 5, 2004; revised on April 23, 2004; accepted on April 27, 2004


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Galectins are a family of beta-galactoside binding molecules involved in cell–extracellular matrix adhesion processes. Specifically, Galectin-3 (Gal-3), one of the members of this family of molecules plays a role in cell adhesion processes as well as in cell survival or apoptosis. Gal-3 was also hypothesized to represent a useful tool in tumor characterization, for example, in thyroid tumors. We report herein the results obtained by evaluating Gal-3 expression of colon cells from human adenomas and adenocarcinomas with two different methodologies: immunohistochemistry and flow cytometry of living dispersed cells. We found that (1) the expression of Gal-3 was significantly increased on the surface of cells from adenomas with respect to normal mucosa from the same patient; (2) Gal-3 ligand, 90k molecule, was increased in the blood plasma from patients with both adenomatous and adenocarcinomatous lesions; and (3) Gal-3 overexpression was not related with the presence of K-ras mutation. Altogether these results clearly indicate that the evaluation of Gal-3 expression (and of its ligand, 90k) can be of interest in the characterization of nonmalignant and malignant colon cancers.

Key words: galectin-3 / CD44v6 / colon / adenoma / carcinoma / K-ras


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Several lines of evidence indicate that different cell adhesion molecules (CAMs) can play a role in cancer progression (Gorelik et al., 2001Go; Ohene-Abuakwa and Pignatelli, 2000Go). Galectin-3 (Gal-3) is a member of the family of beta-galactoside binding molecules called galectins (Liu et al., 2002Go; Matarrese et al., 2000Go; Nakamura et al., 1999Go). A considerable number of human tumors have been investigated so far to identify specific adhesion molecules relevant as diagnostic and prognostic factors as well as progression markers (Bartolazzi et al., 2001Go; Chritofori, 2003Go; Danguy et al., 2002Go; Okamoto et al., 2002Go). In this context, colorectal cancer, one of the most characterized tumors in terms of dysplastic to malignant progression, has been heavily investigated (Abbasi et al., 1993Go; Herrlich et al., 1995Go; Nagy et al., 2003Go; Sanjuan et al., 1997Go; Schoppner et al., 1995Go). Parallel studies have also focused on the key role played by apoptosis in tumor growth. In fact, an impairment of apoptotic cell death program can provide a further impulse for the growth of both a neoplastic mass and its malignant and metastatic potential (Reed, 1999Go). It has been suggested that the loss of homotypic (cell–cell) as well as heterotypic (cell–extracellular matrix) interactions could lead per se to apoptotic cell death (Frisch and Screaton, 2001Go; Grossmann, 2002Go). This kind of apoptosis is called anoikis because of the homeless condition that may give rise to the process. Hence, CAM expression changes can be a relevant factor in determining the fate of a cell. Among different CAMs, Gal-3 has been associated, in in vitro systems, with apoptotic proneness and anoikis resistance (Kim et al., 1999Go; Matarrese et al., 2000Go). Importantly, recent evidence has also implicated galectins and their ligands as master regulators of immune cell homeostasis, including the inflammatory cascade (Rabinovich et al., 2002Go; Rubistein et al., 2004Go).

Interestingly, transformation of intestinal epithelial cells by the K-ras oncogene family is required for the full manifestation of the malignant phenotype and also leads to the so-called anoikis resistance (Pajkos et al., 2000Go; Rosen et al., 2000Go; Zauber et al., 2001Go). Moreover, human colorectal tumors bearing a codon 12 mutation (K12) are aggressive, invasive, and highly metastatic (Guerrero et al., 2000Go). This mutation may increase aggressiveness by the differential regulation of K-ras downstream pathways that lead to inhibition of apoptosis, enhanced loss of contact inhibition, and increased predisposition to anchorage-independent growth, that is, anoikis resistance (Guerrero et al., 2000Go). Accordingly, K-ras codon 12 mutations are much more frequent in carcinomas than in adenomas (ADs; Capella et al., 1991Go) and in metastatic than in nonmetastatic lesions (Finkelstein et al., 1993Go). Altogether these findings suggest a relationship between K12 ras codon mutation with both adhesion processes of colorectal epithelial cells and cancer progression.

The aim of the present study was to investigate whether the surface expression of the galectin-related molecules Gal-3 and CD44 v6, whose expression was found altered during deregulated cell growth and malignant transformation, could be a reliable immunocytochemical markers for improving the diagnostic accuracy of conventional histology in both colon AD and adenocarcinoma (ADK). There is not enough knowledge about the function of CD44 molecules, but the expression of CD44 v6 variant was found to be necessary and sufficient factor to confer metastatic potential to some carcinoma cell lines (Gunthert et al., 1991Go; Jothy, 2003Go). In the present article, the evaluation of the expression of both adhesion molecules was conducted in ex vivo samples from AD and ADK in comparison with healthy mucosal samples from the same patients. More important, together with the "conventional" immune-histological approach, our analyses were carried out by using for the first time in this kind of studies tumor "cellularization" methodology (Cerra et al., 1990Go) and subsequent flow cytometry (FC) evaluations of dispersed cells. In fact, in consideration of the importance of cell surface expression of CAMs in cell fate, the FC technique seems to represent the most suitable approach. The results obtained clearly indicated that Gal-3 overexpression on the surface of nonmalignant colon cancer cells, with respect to cells from normal mucosa, was paralleled by an increase of its ligand (90k) in blood plasma of the patients.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Gal-3 and CD44 v6 expression evaluated by immunohistochemical analysis and FC
A qualitative and semiquantitative analysis of AD and ADK samples was first conducted by means of immunohistochemical (IH) methodology. In particular, 42 out of 46 AD samples and 55 out of 58 ADK samples were analyzed for Gal-3 expression. As positive control, the expression of the immunoglobulin-like CAM CD44 v6 was also evaluated in 33 AD and 47 ADK. Evaluation of the expression levels of these two CAMs was carried out by an arbitrary semiquantitative analysis of paraffin-embedded tissues as previously described (Riss et al., 2003Go). Representative results are reported in Figure 1 (Gal-3) and in Figure 2 (CD44 v6), where samples with low (A and E) or high (B and F) expression level of Gal-3 and CD44 v6 are shown. On this basis, a quantitative analysis by FC was conducted comparing normal and neoplastic frozen tissues from the same patients. Notably, only living propidium iodide–negative cells (see Materials and methods) were considered as valuable for this FC study. Representative results are shown in Figure 1 (Gal-3, C, D and G, H for AD and ADK, respectively) and Figure 2 (CD44 v6, C, D and G, H for AD and ADK, respectively).



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 1. Gal-3 expression in AD and ADK. IH micrographs of AD (A and B) and ADK (E and F) after staining with antibody to Gal-3. Magnification 400x. FC quantitative analysis of Gal-3 in AD (C and D) and ADK (G and H). Hatched curves: negative controls; black curves: NM; green curves: neoplastic lesion. Numbers reported are the median values of the fluorescence intensity histograms and can be considered an expression level index. Representative samples with low (A, C, E, and G) or high (B, D, F, and H) Gal-3 expression are shown.

 


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 2. CD44 v6 expression in AD and ADK. IH micrographs of AD (A and B) and ADK (E and F) after staining with antibody to CD44 v6. Magnification 400x. FC quantitative analysis of CD44 v6 in AD (C and D) and ADK (G and H). Hatched curves: negative controls; black curves: NM; green curves: neoplastic lesion. Numbers reported are the median values of the fluorescence intensity histograms and can be considered an expression level index. Representative samples with low (A, C, E, and G) and high (B, D, F, and H) CD44 V6 expression are shown.

 
Importantly, we found an easily detectable expression of both the antigens on the surface of cells obtained from frozen tissues (both normal and pathological). We took as expression level index of these molecules the median value of fluorescence intensity histogram of a population of at least 20,000 cells (Matarrese et al., 2000Go). A specific evaluation of concordance of the results obtained with these two different methodological approaches was then carried out. Interestingly, these analyses confirmed that in the great majority of tissue samples analyzed, a high expression of the antigen revealed by FC analyses clearly corresponded to a high positivity as observed by IH. For instance, concordance ranged from 62% for Gal-3 expression up to 85% for CD44 v6 expression in AD samples, and it was of 79% for Gal-3 and 82% for CD44v6 in ADK samples.

Quantitative evaluation of Gal-3 and CD44 v6 surface expression in AD and ADK
FC studies allowed us to quantify the surface expression of molecules on isolated living cells from 46 AD and 58 ADK together with their normal counterparts, that is, the normal mucosa (NM) obtained as specified in Materials and methods section. Results obtained are summarized in Figure 3A and 3B, where the distribution of Gal-3 and CD44 v6 expression levels in NM, AD, and ADK are shown. These distributions were statistically analyzed by Wilcoxon tests as reported in Figure 3C (Gal-3) and 3D (CD44 v6), where median values of these distributions are reported. The analysis revealed (1) for AD: A significant increase with respect to NM for Gal-3 surface antigenic expression (z = 2.61, p = 0.009, Fig. 3C), but no significant difference was detected for CD44 v6, Fig. 3D). (2) Conversely for ADK: A significant increase of CD44 v6 surface expression in ADK with respect to NM (z = 2.47, p = 0.001, Fig. 3D), but no significant difference was detected for Gal-3 (Fig. 3C). Finally, regarding Gal-3 expression, Mann-Whitney tests failed to reveal any significant difference between AD and ADK samples. By contrast, regarding CD44 v6, a significant difference (p < 0.01) was detected between the same samples. Hence Gal-3 seems to represent an earlier cell surface marker with respect to CD44 v6 in colon cancer cells, that is, Gal-3 was overexpressed in cells from AD, whereas CD44 v6 was overexpressed on the surface of malignant adenocarcinomatous lesions in comparison with the NM of the same patient.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Evaluation of Gal-3 and CD44 v6 expression in AD and ADK. Distribution of Gal-3 (A) and CD44 v6 (B) expression levels (median values of fluorescence intensity histograms) in NM versus AD and NM versus ADK from patients considered here as revealed by FC analyses. In (C) and (D) the median values ± semi-interquartile of the distribution (A, B) are reported. Numbers represent p values.

 
Gal-3 ligand
On the basis of the studies describing the clinical importance of a specific ligand of Gal-3 (i.e., 90k) in human pathology (Marchetti et al., 2002Go; Ozaki et al., 2002Go), we quantified circulating 90k/Mac-2 ligand (by enzyme-linked immunosorbent assay) on blood samples obtained from AD (n = 20) and ADK (n = 20) patients, as well as from healthy donors (n = 15). The average plasma concentrations of the ligand in the three groups were the following: 10.7 ± 4.1 ng/ml (healthy donors), 18.8 ± 10.6 ng/ml (AD), and 19.5 ± 8.7 ng/ml (ADK). No significant difference was detected between AD and ADK patients regarding 90k plasma levels. On the contrary, samples obtained from both AD and ADK patients showed significantly higher levels of 90k protein with respect to healthy donors (AD: p = 0.009; ADK: p = 0.0001). Interestingly, specific statistical analyses revealed a positive correlation between plasmatic values of 90k molecule with respect to Gal-3 expression on the cell surface either in AD (r = 0.73, p = 0.027) or in ADK (r = 0.89, p = 0.005), that is, this positive correlation was independent from the type of neoplastic lesion considered (AD or ADK).

Gal-3 and CD44 v6 protein expression in relation to clinicopathological features
The variation of Gal-3 or CD44 v6 expression in neoplastic lesions (both AD and ADK) versus NM was analyzed. Results obtained from 46 AD and 58 ADK (Tables I and II, respectively) indicated a positive trend between the protein expression and some of the variables known to be linked to a risk of transformation in AD patients. In particular (Table I), an increase of Gal-3 expression was found in a high percentage of pathological lesions obtained from severely dysplastic tissue (67.0%) in left colon (82.7%), but it was also largely detected in cells from moderately dysplastic lesions (55.5%). Furthermore, increased expression of Gal-3 was preferentially associated with tubulo-villous/villous lesions (61.3%) features. However, statistical analyses failed to reveal any significant difference between right colon and left colon as well as between mild–moderate lesions and severe dysplastic lesions (Table I). By contrast, regarding CD44 v6, a significant difference (p < 0.01) was detected. Interestingly, regarding ADK, an increased expression of Gal-3 in a high percentage (54.5%) of smaller size tumors (T1–T2) was found (Table II).


View this table:
[in this window]
[in a new window]
 
Table I. Expression of Gal-3 and CD44 v6 in relation to clinicopathological features (quantification of increased expression in AD samples with respect to healthy mucosa)

 

View this table:
[in this window]
[in a new window]
 
Table II. Expression of Gal-3 and CD44 v6 in relation to clinicopathological features (quantification of increased expression in ADK samples with respect to healthy mucosa)

 
K-ras gene status and Gal-3 expression
As a general rule, several data hypothesizing a key role for K-ras mutation in colon cancer progression were already available in literature (Zhu et al., 1997Go). Furthermore, it has been shown that cell adhesion ability can be regulated by this gene (Guerrero et al., 2000Go). In the same vein, Gal-3 was generally recognized to be involved in cell adhesion properties (Matarrese et al., 2000Go); in the present work we essentially measured cell surface expression of this antigen. On this basis, DNA from 39 ADs, 55 ADKs, and corresponding NM was analyzed to evaluate the status of K-ras gene by mean of a highly sensitive restriction fragment length polymorphism–polymerase chain reaction (RFLP-PCR) assay (a representative example is shown in Figure 4A). The results obtained clearly indicated that wild type K-ras was detectable in all samples of NM, whereas the mutated gene was found in a significant percentage of both AD (28.2 %) and ADK (25.4%). Notably, both in AD and ADK pathological lesions a prevalence of heterozygous mutations was found (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4. K-ras gene status and Gal-3 expression. (A) Representative example of enriched RFLP-PCR. Assay on agarose gel 4% of restriction pattern by BstNI enzyme. M, marker of molecular weight; NM, normal mucosa; AD(1,2), adenomas; ADK(1,2), adenocarcinomas; SW480, positive control; Uk, uncut DNA. 157 base pairs correspond to uncut DNA, 143 base pairs correspond to mutation homozygote, and 114 base pairs correspond to DNA wild type. Expression of Gal-3 (B) or CD 44 v6 (C) in cells with wild-type and mutated K-ras gene status. Median values of the expression level of CAMs ± semi-interquartile as detected in wild-type (empty columns) or K-ras-mutated (filled columns) cell samples. Note that (1) no significant difference was detected in Gal-3 surface expression in different samples; (2) by contrast, in AD patients, a significantly higher expression of CD44 v6 was detected in K-ras mutated cells from AD patients with respect to the corresponding wild-type counterpart (u = 46, z = 2.6, p < 0.01).

 
We then analyzed the relationships between Gal-3 or CD44 v6 expression level and K-ras status either in AD or ADK. Results obtained, shown in Figure 4B and 4C, can be summarized as follows: (1) no significant variation was found in mutated K-ras cell samples with respect to wild-type counterpart regarding the expression of both Gal-3 and CD44 v6 (Figure 4B and 4C, respectively); and (2) CD44 v6 was significantly down-regulated in K-ras-mutated AD samples with respect to wild-type counterpart (u = 46, z = 2.6, p < 0.01, Fig. 4C).


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Gal-3 was described as a versatile multifunctional protein involved in multiple biological processes, including cell growth, cell cycle progression, cell migration, or negative regulation of apoptotic mechanisms (Hittelet et al., 2003Go; Liu et al., 2002Go). Several studies also pointed out the possibility that Gal-3 expression could represent a useful marker of tumor progression (Sanjuan et al., 1997Go; Schoppner et al., 1995Go). In particular, by means of IH or fingerprinting studies, some authors hypothesized the prognostic value of Gal-3 intracellular presence in colon cancer in terms of progression marker or metastatic potential (Bresalier et al., 1998Go; Nagy et al., 2003Go; Nakamura et al., 1999Go; Nangia-Makker et al., 2002Go). However, conflicting results were reported in the literature, and several concerns regarding the prognostic value of Gal-3 are still a matter of debate (Lahm et al., 2001Go; Nagy et al., 2003Go; Sanjuan et al., 1997Go). By contrast, CD44 v6 was generally accepted as a CAM of great importance in tumor growth features in cancers of different histotype, including colorectal cancers (Yamane et al., 1999Go). Accordingly, significant differences between NM and ADK samples (but not between NM and AD samples) were found regarding CD44 v6 surface expression.

Interestingly, Gasbarri and co-workers (1999)Go have provided evidence that coexpression of CD44 v6 and Gal-3 can help distinguish between benign and malignant thyroid lesions, especially between well-differentiated follicular carcinomas versus benign follicular proliferation of the thyroid gland. Our results on this matter seem to depict a different scenario as far as colon cancers are concerned. In fact, Gal-3 expression was found significantly higher on the surface of cells from AD samples with respect to the corresponding healthy mucosal cells. Thus on the basis of FC quantitative results, we propose to ascribe to Gal-3 overexpression an important role in the first steps of colon cell transformation. These results were paralleled by the increase of the Gal-3 ligand 90k in the plasma of those patients with an increased Gal-3 cell surface expression. This is in accordance with the fact that circulating 90k has been reported to up-regulate the expression of CAMs in tumor cells. It was also found at high levels in plasma of patients with various types of cancers, such as breast, colon, stomac, ovary, and lung (Natoli et al., 1996Go). This increase strongly suggested a role for 90k as a possible progression marker in neoplastic disorders (Nakamura et al., 1999Go; Scambia et al., 1988Go).

FC analyses seem to provide an intriguing approach in terms of valuable quantitative analysis of cell surface antigenic expression. In fact, although the bulk of studies reported in the literature are generally carried out by using qualitative analyses, such as IH, our studies, carried out on isolated cells from bioptic samples, were instead a valuable quantification thanks to a procedure preserving the bioavailability of molecule antigenic expression. The results obtained by analytical cytology appear, however, to be strongly correlated to those detected by conventional histopathology analysis. Importantly, this correlation was even more evident for CD44 v6 (82%) than for Gal-3 (60%) expression. This could be due to the fact that Gal-3 is present both into the cell cytoplasm and on the cell surface, whereas CD44 v6 is solely expressed on the cell surface, where it plays its function. In fact, IH analysis revealed both intracytoplasmic as well as cell surface molecules, whereas FC, performed in living (propidium iodide–negative), nonpermeabilized cells, was able to identify cell surface molecules only. Data reported in the literature suggested that such a biological effect of Gal-3 was mainly related with its surface expression rather than to its intracellular presence. In addition, apoptotic proneness and anoikis resistance associated to the surface expression of certain CAMs, including Gal-3, have also been evidenced (Kim et al., 1999Go; Matarrese et al., 2000Go). Hence, our results are consistent with the key role played by Gal-3 surface expression as cell growth regulatory molecule (Danguy et al., 2002Go; Matarrese et al., 2000Go). Another clue suggesting a role for Gal-3 in suppressing apoptosis has been provided by studies performed in nonadhering cells (i.e., Jurkat cells), where, thanks to a sequence similarity between Gal-3 and Bcl-2, the intracytoplasmic Gal-3 could directly interact with Bcl-2 by a NWGR motif to form heterodimers, thus interfering with apoptotic pathway (Yang et al., 1996Go).

Recent lines of evidence have also implicated Gal-3 as a regulator of immune cell homeostasis (Fukumori et al., 2003Go; Rabinovich et al., 2002Go). In fact, soluble Gal-3 (e.g., secreted by tumor cells) was found to represent a powerful apoptotic inducer in human T cells. Thus Gal-3 might also contribute to the immune escape strategy exerted by cancer cells (Fukumori et al., 2003Go).

Finally, K12 ras gene mutation in colorectal cancer has been hypothesized to represent a risk factor per se in colon cancer progression (Guerrero et al., 2000Go; Zhu et al., 1997Go). Accordingly, our results seem to indicate that changes in CD44 v6 molecule expression were associated with K12 gene mutation, whereas Gal-3 molecule overexpression was not. These results differ from those recently reported on thyroid tumors where follicular carcinoma with K-ras mutations very often dispalyed a Gal-3-negative phenotype and were either minimally or overtly invasive (Nikiforova et al., 2003Go). However, on the basis of the results obtained, the possibility that Gal-3 overexpression could represent an early event preceding K-ras gene mutation in adenomatous nonmalignant lesions cannot be ruled out. In fact, a higher expression of Gal-3 was found in AD from wild-type K-ras patients with respect to patients with mutated K-ras. In same vein, according to literature data (Kim et al., 1994Go), the expression of CD44 v6 molecule was significantly higher (p < 0.01) in wild-type K-ras samples.

Altogether these results indicate that Gal-3 overexpression might represent per se a useful marker of colon adenoma and, together with the evaluation of its ligand in the blood plasma (90k molecule), it could contribute to the characterization of both malignant and nonmalignant colon cancers.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Patients and tissue samples
AD and ADK samples were removed together with adjacent mucosa from 104 patients consecutively admitted to the Endoscopy Digestive Service (46 ADs) or to the 2nd Surgical Division (58 ADKs) of the Regina Elena Cancer Institute (Rome) after giving written informed consent. None of the tumor-bearing patients had undergone chemotherapy prior to surgical resection of the malignant lesion. AD patients (28 males [60.8%] and 18 females [39.1%]) ranged in age from 33 to 79 years with a median age of 63 years at the time of lesion removal. Tissue samples were removed from ADs and ADKs together with adjacent NM (more than 10 cm away from the tumor lesions) and fixed by formalin (for histological analyses) or immediately frozen in liquid nitrogen and maintained at –80°C until processing (for FC and genetic analyses, see later description). Different specimens of the same sample were assigned randomly to genetic and FC analyses. IH analysis of Gal-3 (clone 9C4, Novocastra Lab, U.K., dilution 1:100) and CD44 v6 (clone VFF7, UCS Diagnostics, Rome, dilution 1:50) was carried out on formalin-fixed, paraffin-embedded tissues as previously described (Mottolese et al., 2000Go). The staining assessment of the two proteins was performed using a semiquantitative method as stated elsewhere (Riss et al., 2003Go). Cell nuclei counterstaining with Mayer hematoxylin (Sigma, St. Louis, MO) was also performed. Histological analyses indicated that the percentage of tubular and tubulo-villous/villous AD were 26.1 and 73.9, respectively; dysplasia was mild/moderate in the majority of histologic samples (65.2%); and the side of neoplastic lesions was mainly in the left colon (93.5%). Collected AD samples were from lesions below 10 mm in size in 43.5% of cases, whereas 55.5% of collected samples came from AD larger than 10 mm. ADK patients) 33 males [56.9%] and 25 females [43.1%]) ranged in age from 29 to 88 years with a median age of 67 years at the time of ADK removal. Histological TNM (an acronym referred to tumor dimension [T], presence/absence of metastases in regional lymph nodes [N], and presence/absence of metastases in lymph nodes far from the primary tumor [M]) analyses of ADK indicated that the percentage of T3 samples was higher (63.8%) with respect to T1–T2 (15.5%) and T4 (20.7%); the majority of samples was N0 (56.9%), and 43.1% were N1–N2; and the great majority was M0 (79.3%). Grading was mainly G2 (65.5%) and, importantly, Duke's values were found balanced between A–B (51.8%) and C–D (48.2%). Notably, 87.9% of ADK were obtained from left colon (87.9%). All these features are reported in Table III.


View this table:
[in this window]
[in a new window]
 
Table III. Clinicopathological features

 
Cell isolation and FC
Biopsies from normal and pathological mucosa were washed twice with phosphate buffered saline (PBS, pH7.4) containing 3.8% (w/v) D-glucose and cut on a watch glass using a sterile scalpel. Isolated cells were harvested and washed with cold PBS and then stained with specific antibodies. For Gal-3 and CD44 v6 detection, cells were incubated with fluorescein isothiocyanate–conjugated mouse monoclonal antibodies to Gal-3 (Chemicon, Temecula, CA) or to CD44 v6 (NovoCastra, Newcastle, U.K.) on ice for 30 min. Appropriate fluorescein isothiocyanate–conjugated immunoglobulins were used as negative controls. After two washings in PBS, all the samples were incubated for 5 min with propidium iodide (40 µg/ml, Molecular Probes, Eugene, OR) to spot dead cells and then they were analyzed with a FACScan cytometer (Becton Dickinson, San Jose, CA) equipped with a 488 argon laser. For quantitative evaluation of these surface molecules, only electronically gated living cells (propidium iodide–negative) were considered. The amount of Gal-3 and CD44 v6 on the cell surface was expressed as median value of the fluorescence intensity histogram. For each patient considered, the median values of fluorescence emission curve of the NM was set to 100% (either for Gal-3 or CD44 v6), and the expression levels in AD or ADK was reported as relative to this.

Assay for Gal-3 ligand
The 90k molecule is a secreted glycoprotein that binds galectins, in particular Gal-3 (Inohara et al., 1996Go). The concentration of 90k molecule in the plasma of the patients considered herein was evaluated using a commercial enzyme-linked immunosorbent assay kit (R&D Systems, Minneapolis, MN). Plasma aliquots were assayed for 90k content according to the manufacturer's instructions. The light emission can be quantified using a microtiter plate reader at 405 nm, and 90k concentration was expressed as ng/ml.

DNA isolation
DNA isolation was performed using the MICRO-GENO DNA kit according to the manufacturer's recommendations (AB Analytica, Padoa, Italy). Tissue samples weighing <100 mg were cut using a sterile scalpel and transferred to a 2-ml Eppendorf tube containing 200 µl lysis buffer. Twenty microliters of proteinase K (20 mg/ml) were then added and the suspension left to incubate at 45°C overnight. The quantity of isolated DNA was measured spectrophotometrically and the quality analyzed through a 1% agarose gel electrophoresis. Due to the presence of low-molecular-weight fragments of isolated DNA, 42 out of a total of 47 AD samples and 55 out of a total of 58 ADK samples were considered suitable for genetic analyses.

RFLP-PCR assay
Mutations at K-ras codon 12 were detected from all samples by an "enriched" RFLP-PCR assay according to Kahn et al. (1991)Go. The oligonucleotide primers used for the enzymatic amplification of K-ras sequences were as follows:

  • K-ras 5' ACTGAATATAAACTTGTGGTAGTTGGACCT 3'
  • K-ras 3' wild type 5' TCAAAGAATGGTCCTGCACC 3'
  • K-ras 3' TCAAAGAATGGTCCTGGACC 3'
Primers were synthesized and purified by polyacrylamide gel electrophoresis by Invitrogen (Paisley, Scotland).

The first step amplification was performed on 500–1000 ng genomic DNA in a final reaction volume of 100 µl containing amplification buffer (50 mM KCl, 10 mM Tris–HCl pH 8.3, 1.5 mM MgCl2, 200 mM dNTPs (Roche Diagnostics, Germany), 2.5 U Taq DNA polymerase (Roche Diagnostics). Primer concentrations were 10 ng each of K-ras 5' and K-ras 3' wild type. For amplification a programmable Progene thermocycler (TECHNE, Cambridge, UK) was used. The amplification parameters were 48'' at 94°C, 90'' at 56°C, and 2'35'' at 72°C for a total of 15 cycles. Five-microliter aliquots of the first amplicon were digested with 20 U enzyme BstNI (Stratagene, La Jolla, CA) in a final volume of 20 µl at 60°C for 3 h. Ten-microliter aliquots of the intermediate digests were used in the second amplification step. These aliquots were diluted to a final volume of 50 µl as described. Primer concentrations were 150 ng each of K-ras 5' and K-ras 3', and amplifications were performed for 30 cycles as described.

Twenty-five-microliter aliquots of the second amplicon were digested with 10 U BstNI restriction enzyme at 60°C for 2 h in a final volume of 35 µl. Products were processed by electrophoresis through a 4% high-resolution agarose gel in TAE buffer. Gels were photographed on a UV light transilluminator.

The positive control was DNA prepared from the SW480 cell line (homozygous for the codon 12 K-ras valine mutation, GTT), whereas a DNA derived from the lymphocytes of healthy donors was used as a wild-type control in each run of the PCR.

Statistical analyses
Cytofluorimetric comparison of Gal-3 and CD44 v6 expression in NM versus neoplastic lesions (AD or ADK) for each single patient was conducted by CellQuest Software using the parametric Kolmogorov-Smirnov test on a population of at least 20,000 cells. Only p values of less than 0.01 were considered as significant. Statistical analyses of the distribution of CAM expression level in paired samples of NM and AD or NM and ADK (all patients) were conducted by using a Wilcoxon nonparametric test. Only p values of less than 0.05 were considered as significant. Chi-square tests were used to evaluate K-ras status experiments. Statistical analyses between Gal-3 expression in neoplastic lesions and 90k in the plasma of patients were carried out using regression analysis. CAM expression (Gal-3 or CD44 v6) and K-ras status in AD or ADK were compared by using the Mann-Whitney nonparametric test. All analyses were carried out by using Statview 5.1 (software for Macintosh).


    Footnotes
 
1 To whom correspondence should be addressed; e-mail: malorni{at}iss.it


    Abbreviations
 
AD, adenoma; ADK, adenocarcinoma; CAM, cell adhesion molecule; FC, flow cytometry; IH, immunohistochemical; NM, normal mucosa; PBS, phosphate buffered saline; RFLP-PCR, restriction fragment length polymorphism–polymerase chain reaction


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Abbasi, A.M., Chester, K.A., Talbot, I.C., Macpherson, A.S., Boxer, G., Forbes, A., Malcolm, A.D., and Begent, R.H. (1993) CD44 is associated with proliferation in normal and neoplastic human colorectal epithelial cells. Eur. J. Cancer, 29, 1995–2002.[CrossRef]

Bartolazzi, A., Gasbarri, A., Papotti, M., Bussolati, G., Lucante, T., Khan, A., Inohara, H., Marandino, F., Orlandi, F., Nardi, F., and others. (2001) Application of an immunodiagnostic method for improving preoperative diagnosis of nodular thyroid lesions. Lancet, 26, 1644–1650.

Bresalier, R.S., Mazurek, N., Sternberg, L.R., Byrd, J.C., Yunker, C.K., Nangia-Makker, P., and Raz, A. (1998) Metastasis of human colon cancer is altered by modifying expression of the beta-galactoside-binding protein galectin 3. Gastroenterology, 115, 287–296.[CrossRef][Web of Science][Medline]

Capella, G., Cronauer-Mitra, S., Pienado, M.A., and Perucho, M. (1991) Frequency and spectrum of mutations at codons 12 and 13 of the c-K-ras gene in human tumors. Environ. Health Perspect., 93, 125–131.[Web of Science][Medline]

Cerra, R., Zarbo, R.J., and Crissman, J.D. (1990) Dissociation of cells from solid tumors. Meth. Cell. Biol., 33, 1–12.

Chritofori, G. (2003) Changing neighbours, changing behaviour: cell adhesion molecule-mediated signalling during tumour progression. EMBO J., 15, 2318–2323.[CrossRef]

Danguy, A., Camby, I., and Kiss, R. (2002) Galectins and cancer. Biochim. Biophys. Acta, 1572, 285–293.[Medline]

Finkelstein, S.D., Sayegh, R., Christensen, S., and Swalsky, P.A. (1993) Genotypic classification of colorectal adenocarcinoma. Biologic behavior correlates with K-ras-2 mutation type. Cancer, 71, 3827–3838.[CrossRef][Web of Science][Medline]

Frisch, S.M., and Screaton, R.A. (2001) Anoikis mechanisms. Curr. Opin. Cell Biol., 13, 555–562.[CrossRef][Web of Science][Medline]

Fukumori, T., Takenaka, Y., Yoshii, T., Kim, H.R., Hogan, V., Inohara, H., Kagawa, S., and Raz, A. (2003) CD29 and CD7 mediate galectin-3-induced type II T-cell apoptosis. Cancer Res., 63, 8302–8311.[Abstract/Free Full Text]

Gasbarri, A., Martegani, M.P., Del Prete, F., Lucante, T., Natali, P.G., and Bartolazzi, A. (1999) Galectin-3 and CD44 v6 isofroms in the preoperative evaluation of thyroid nodules. J. Clin. Oncol., 17, 3494–3502.[Abstract/Free Full Text]

Gorelik, E., Galili, U., and Raz, A. (2001) On the role of cell surface carbohydrates and their binding proteins (lectins) in tumor metastasis. Cancer Metast. Rev., 20, 245–277.[CrossRef][Web of Science][Medline]

Grossmann, J. (2002) Molecular mechanisms of "detachment-induced apoptosis—anoikis." Apoptosis, 7, 247–260.[CrossRef][Web of Science][Medline]

Guerrero, S., Casanova, I., Farre, I., Mazo, A., Capella, G., and Mangues, R. (2000) K-ras codon 12 mutation induces higher level of resistance to apoptosis and predisposition to anchorage-independent growth than codon 13 mutation or proto-oncogene overexpression. Cancer Res., 60, 6750–6756.[Abstract/Free Full Text]

Gunthert, U., Hofmann, M., Rudy, W., Reber, S., Zoller, M., Haussmann, I., Matzku, S., Wenzel, A., Ponta, H., and Herrlich, P. (1991) A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell, 65, 13–24.[CrossRef][Web of Science][Medline]

Herrlich, P., Pals, S., and Ponta, H. (1995) CD44 in colon cancer. Eur. J. Cancer, 31, 1110–1112.

Hittelet, A., Legendre, H., Nagy, N., Bronckart, Y., Pector, J.C., Salmon, I., Yeaton, P., Gabius, H.J., Kiss, R., and Camby, I. (2003) Upregulation of galectins-1 and -3 in human colon cancer and their role in regulating cell migration. Int. J. Cancer, 20, 370–379.

Inohara, H., Akahani, S., Koths, K., and Raz, A. (1996) Interactions between galectin-3 and Mac-2-binding protein mediate cell–cell adhesion. Cancer Res., 56, 4530–4534.[Abstract/Free Full Text]

Jothy, S. (2003) CD44 and its partners in metastasis. Clin. Exp. Metast., 20, 195–201.[CrossRef][Web of Science][Medline]

Kahn, S.M., Jiang, W., Culbertson, T.A., Weinstein, I.B., Williams, G.M., Tomita, N., and Ronai, Z. (1991) Rapid and sensitive nonradioactive detection of mutant K-ras genes via "enriched" PCR amplification. Oncogene, 6, 1079–1083.[Web of Science][Medline]

Kim, H., Yang, X.L., Rosada, C., Hamilton, S.H., and August, J.T. (1994) CD44 expression in colorectal adenomas is an early event occurring prior to K-ras and p53 gene mutation. Arch. Biochem. Biophys., 310, 504–507.[CrossRef][Web of Science][Medline]

Kim, H.R., Lin, H.M., Biliran, H., and Raz, A. (1999) Cell cycle arrest and inhibition of anoikis by galectin-3 in human breast epithelial cells. Cancer Res., 59, 4148–4154.[Abstract/Free Full Text]

Lahm, H., Andre, S., Hoeflich, A., Fischer, J.R., Sordat, B., Kaltner, H., Wolf, E., and Gabius, H.J. (2001) Comprehensive galectin fingerprinting in a panel 61 human tumor cell lines by RT-PCR and its implications for diagnostic and therapeutic procedures. J. Cancer Res. Clin. Oncol., 127, 375–386.[CrossRef][Web of Science][Medline]

Liu, F.T., Patterson, R.J., and Wang, J.L. (2002) Intracellular funcion of galectins. Biochim. Biophis. Acta, 1572, 263–273.[Medline]

Marchetti, A., Tinari, N., Buttitta, F., Chella, A., Angeletti, C.A., Sacco, R., Mucilli, F., Ullrich, A., and Iacobelli, S. (2002) Expression of 90K (Mac-2 BP) correlates with distant metastasis and predicts survival in stage I non-small cell lung cancer patients. Cancer Res., 62, 2535–2539.[Abstract/Free Full Text]

Matarrese, P., Fusco, O., Tinari, N., Natoli, C., Liu, F.T., Semeraro, M.L., Malorni, W., and Iacobelli, S. (2000) Galectin-3 overexpression protects from apoptosis by improving cell adhesion properties. Int. J. Cancer, 85, 545–554.[CrossRef][Web of Science][Medline]

Mottolese, M., Buglioni, S., Bracalenti, C., Cardarelli, M.A., Ciabocco, L., Giannarelli, D., Botti, C., Natali, P.G., Concetti, A., and Venanzi, F.M. (2000) Prognostic relevance of altered Fas (CD95)-system in human breast cancer. Int. J. Cancer, 89, 127–132.[CrossRef][Web of Science][Medline]

Nagy, N., Legendre, H., Engels, O., Andre, S., Kaltner, H., Wasano, K., Zick, Y., Pector, J.C., Decaestecker, C., Gabius, H.J., and others. (2003) Refined prognostic evaluation in colon carcinoma using immunohistochemical galectin fingerprinting. Cancer, 97, 1849–1858.[CrossRef][Web of Science][Medline]

Nakamura, M., Inufusa, H., Adachi, T., Aga, M., Kurimoto, M., Nakatani, Y., Wakano, T., Nakajima, A., Hida, J.I., Miyake, M., and others. (1999) Involvement of galectin-3 expression in colorectal cancer progression and metastasis. Int. J. Oncol., 15, 143–148.[Web of Science][Medline]

Nangia-Makker, P., Conklin, J., Hogan, V., and Raz, A. (2002) Carbohydrate-binding proteins in cancer, and their ligands as therapeutic agents. Trends Mol. Med., 8, 187–192.[CrossRef][Web of Science][Medline]

Natoli, C., Iacobelli, S., and Kohn, L. (1996) The immune stimulatory protein 90K increases major histocompatibility complex class I expression in a human breast cancer cell line. Biochem. Biophys. Res. Commun., 225, 617–620.[CrossRef][Web of Science][Medline]

Nikiforova, M.N., Lynch, R.A. Biddinger, P.W., Alexander, E.K., Dorn, G.W. II, Tallini, G., Kroll, T.G., and Nikiforov, Y.E. (2003) RAS point mutations and PAX8-PARP gamma rearrangement in tyroid tumors: evidence for distinct molecular pathways in tyroid follicular carcinoma. J. Clin. Endocrinol. Metab., 88, 2318–2326.[Abstract/Free Full Text]

Ohene-Abuakwa, Y., and Pignatelli, M. (2000) Adhesion molecules in cancer biology. Adv. Exp. Med. Biol., 465, 115–126.[Web of Science][Medline]

Okamoto, I., Tsuikj, H., Kenyon, L.C., Godwin, A.K., Emlet, D.R., Holgado-Madruga, M., Lanham, I.S., Joynes, C.J., Vo, A.J., Guha, A., and others. (2002) Proteolytic cleavage of the CD44 adhesion molecule in multiple human tumors. Am J. Pathol., 160, 441–447.[Abstract/Free Full Text]

Ozaki, Y., Kontani, K., Hanaoka, J., Chano, T., Teramoto, K., Tezuka, N., Sawai, S., Fujino, S., Yoshiki, T., Okabe, H., and Ohkubo, I. (2002) Expression and immunogenicity of a tumor-associated antigen, 90K/Mac-2 binding protein, in lung carcinoma. Cancer, 95, 1954–1962.[CrossRef][Web of Science][Medline]

Pajkos, G., Kiss, I., Sandor, J., Ember, I., and Kishazi, P. (2000) The prognostic value of the presence of mutations at the codons 12, 13, 61 of K-ras oncogene in colorectal cancer. Anticancer Res., 20, 1695–1701.[Web of Science][Medline]

Rabinovich, G.A., Baum, L.G., Tinari, N., Paganelli, R., Natoli, C., Liu, F.T., and Iacobelli, S. (2002) Galectins and their ligands: amplifiers, silencers or turners of the inflammatory response? Trends Immunol., 23, 313–320.[CrossRef][Web of Science][Medline]

Reed, J.C. (1999) Dysregulation of apoptosis in cancer. J. Clin. Oncol., 17, 2941–2953.[Abstract/Free Full Text]

Riss, D., Jin, L., Qian, X., Bayliss, J., Scheithauer, B.W., Young, W.F. Jr., Vidal, S., Kovacs, K., Raz, A., and Lloyd, R.V. (2003) Differential expression of galectin-3 in pituitary tumors. Cancer Res., 63, 2251–2255.[Abstract/Free Full Text]

Rosen, K., Rak, J., Leung, T., Dean, N.M., Kerbel, R.S., and Filmus, J. (2000) Activated Ras prevents downregulation of Bcl-X(L) triggered by detachment from the extracellular matrix. A mechanism of Ras-induced resistance to anoikis in intestinal epithelial cells. J. Cell Biol., 17, 447–456.

Rubistein, N., Alvarez, M., Zwirner, N.W., Toscano, M.A. Llaregui, J.M., Bravo, A., Mardoh, J., Fainboim, L., Podhajcer, O.L., and Rabinovich, G.A. (2004) Targeted inhibition of galectin-1 gene expression in tumor cells results in heightened T cell-mediated rejection: a potential mechanism of tumor-immune privilege. Cancer Cell, 5, 241–250.[CrossRef][Web of Science][Medline]

Sanjuan, X., Fernandez, P.L., Castells, A., Castronovo, V., van den Brule, F., Liu, F.T., Cardesa, A., and Campo, E. (1997) Differential expression of galectin 3 and galectin 1 in colorectal cancer progression. Gastroenterology, 113, 1906–1915.[CrossRef][Web of Science][Medline]

Scambia, G., Panici, P.B., Baiocchi, G., Perrone, L., Iacobelli, S., and Mancuso, S. (1988) Measurement of a monoclonal-antibody-defined antigen (90K) in the sera of patients with ovarian cancer. Anticancer Res., 8, 761–764.[Web of Science][Medline]

Schoppner, H.L., Raz, A., Ho, S.B., and Bresalier, R.S. (1995) Expression of an endogenus galactose-binding lectin correlates with neoplastic progression in the colon. Cancer, 75, 2818–2826.[CrossRef][Web of Science][Medline]

Yamane, N., Tsujitani, S., Makino, M., Maeta, M., and Kaibara, N. (1999) Soluble CD44 variant 6 as a prognostic indicator in patients with colorectal cancer. Oncology, 56, 232–238.[CrossRef][Web of Science][Medline]

Yang, R.Y., Hsu, D.K., and Liu, F.T. (1996) Expression of galectin-3 modulates T-cell growth and apoptosis. Proc. Natl Acad. Sci. USA, 93, 6737–6742.[Abstract/Free Full Text]

Zauber, N.P., Sabbath-Solitare, M., Marotta, S.P., Zauber, A.G., and Bishop, D.T. (2001) Molecular changes in the Ki-ras and APC genes in colorectal adenomas and carcinomas arising in the same patient. J. Pathol., 193, 303–309.[CrossRef][Web of Science][Medline]

Zhu, D., Keohavong, P., Finkelstein, S.D., Swalsky, P., Bakker, A., Weissfeld, J., Srivastava, S., and Whiteside, T.L. (1997) K-ras gene mutations in normal colorectal tissues from K-ras mutation-positive colorectal cancer patients. Cancer Res., 57, 2485–2489.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Clin. Chem.Home page
G. Sardana, J. Marshall, and E. P. Diamandis
Discovery of Candidate Tumor Markers for Prostate Cancer via Proteomic Analysis of Cell Culture-Conditioned Medium
Clin. Chem., March 1, 2007; 53(3): 429 - 437.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
G. A. Rabinovich, A. Cumashi, G. A. Bianco, D. Ciavardelli, I. Iurisci, M. D'Egidio, E. Piccolo, N. Tinari, N. Nifantiev, and S. Iacobelli
Synthetic lactulose amines: novel class of anticancer agents that induce tumor-cell apoptosis and inhibit galectin-mediated homotypic cell aggregation and endothelial cell morphogenesis
Glycobiology, March 1, 2006; 16(3): 210 - 220.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/9/783    most recent
cwh092v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Right arrowScopus Links
Google Scholar
Right arrow Articles by Greco, C.
Right arrow Articles by Malorni, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Greco, C.
Right arrow Articles by Malorni, W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?