Skip Navigation


Glycobiology Advance Access originally published online on March 24, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/6/537    most recent
cwh074v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wakarchuk, W.
Right arrow Articles by Whitfield, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wakarchuk, W.
Right arrow Articles by Whitfield, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology vol 14 no 6 pp. 537-546, 2004
Glycobiology vol. 14 no. 6 © Oxford University Press 2004; all rights reserved.

Characterization of the {alpha}-1,2-N-acetylglucosaminyltransferase of Neisseria gonorrhoeae, a key control point in lipooligosaccharride biosynthesis

Warren Wakarchuk1, Melissa J. Schur, Frank St. Michael, Jinjuan Li, Eva Eichler and Dennis Whitfield

National Research Council of Canada, Institute for Biological Sciences, 100 Sussex Drive, Ottawa, Ontario, K1A 0R6 Canada

Received on January 8, 2004; revised on February 19, 2004; accepted on March 4, 2004


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The biosynthesis of the lipooligosaccharide (LOS) in Neisseria meningitidis has a control point that regulates the extension of the alpha-chain on heptose (I) of the LOS. The gene that encodes the protein responsible for this control had been identified elsewhere, but the enzyme encoded by the gene was not characterized. We have now shown that this same control mechanism operates in the related species, Neisseria gonorrhoeae, using a gene knockout and subsequent characterization of the LOS species produced. We also cloned and expressed the enzyme from both of these pathogens. Using a synthetic acceptor substrate, we have shown unequivocally that the enzyme is an {alpha}-1,2-N-acetylglucosaminyltransferase. Experiments with both the core oligosaccharide and the synthetic acceptors suggests that the addition of the {alpha}-1,2-N-acetylglucosamine moiety on the heptose (II) residue precedes the addition of the ethanolamine phosphate at the O3 position on this heptose (II), and that in the absence of the {alpha}-1,2-N-acetylglucosamine moiety leads to the addition of an extra ethanolamine phosphate on the heptose (II) residue. Our data do not support the hypothesis that ethanolamine phosphate at O3 of heptose (II) is added and is then required for the addition of the N-acetylglucosamine at O2 by the LgtK enzyme. This enzyme represents a control point in the biosynthesis of the LOS of this pathogen and is a potential target for therapeutic intervention.

Key words: glycosyltransferase / lipooligosaccharide / Neisseria


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The mucosal pathogens Neisseria gonorrhoeae and Neisseria meningitidis contain a short-chain lipooligosaccharide (LOS) that has been shown to be a virulence factor for both species (Mandrell and Apicella, 1993Go; Unkmeir et al., 2002Go). As a critical virulence factor, the biosynthesis of LOS represents a potential target pathway for anti-infective compounds, which could be used in the treatment of diseases caused by these bacteria. This strategy would rely on a detailed knowledge of the enzymology of the biosynthesis and the identification of control points in the synthesis of the LOS.

The biosynthesis of bacterial lipopolysaccharides (LPSs) has been extensively investigated over the past 10 years by genetic approaches (Raetz and Whitfield, 2002Go, and references within). Genetic analysis has identified a large number of genes, and various mutations or strain comparisons have been made to clarify the functions of these genes (Gilbert et al., 2000Go; Kahler et al., 1996Go; Wakarchuk et al., 1996Go). The enzymology of the biosynthesis of the lipid A portion has been investigated for Escherichia coli LPS (Raetz and Whitfield, 2002Go, and references within). The enzymes involved in the biosynthesis of the inner core structures have been examined only in a selection of organisms (Noah et al., 2001Go). The outer core enzymes from a variety of species have been examined as recombinant enzymes (Gilbert et al., 1997Go, 2000Go; Wakarchuk et al., 1998Go).

The study of the enzymology of glycosyltransferases involved in the biosynthesis of the LOS in N. meningitidis and N. gonorrhoeae so far has been limited to the outer core enzymes, which make the sialyl-lacto-N-neotetraose mimic (Blixt et al., 1999Go; Gilbert et al., 1997Go; Wakarchuk et al., 1998Go), or the Pk epitope mimic (Persson et al., 2001Go), but the enzymes that add residues directly onto the inner core heptose residues have not been characterized to date. The studies of one of the enzymes involved (LgtK), which adds the {alpha}-1,2-linked GlcNAc to heptose (II) (Hep II) (Figure 1) has so far been limited to genetic approaches in N. meningitidis in which the gene has been inactivated by insertional mutagenesis (Kahler et al., 1996Go). Although the genetic studies have suggested a function for this gene, no characterization of the enzyme's biochemical properties has been reported.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1. Reaction of the LgtK enzyme of Neisseria. The reaction catalyzed by LgtK is shown with the acceptor LPS shown as the inner core intermediate, which has the terminal heptose acceptor for LgtK.

 
This protein makes a relatively rare linkage in bacterial LPS, that of an {alpha}-linked GlcNAc. This enzyme is a member of the glycosyltransferase family GT-4 (Coutinho and Henrissat, 1999Go), which is a large family, and it has been mistakenly called RfaK by virtue of its weak sequence homology to the E. coli and S. typhimurium enzyme of that name. Even though both of these enzymes perform the same glycosyltransfer reaction, they have very different acceptors. In the case of the enteric bacteria the acceptor is an {alpha}-Glc residue, and not {alpha}-Hep, as it is in Neisseria. The genetic studies have suggested that this {alpha}-1,2-N-acetylglucosaminyltransferase represents a control point for the biosynthesis of the LPS. The inactivation of this gene leads to a truncation of the LPS at the first heptose residue in N. meningitidis, making this protein a potential therapeutic target. In this article, we report a biochemical examination of the recombinant enzyme LgtK from both N. meningitidis and N. gonorrhoeae.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
LOS structure from the knockout mutant
The deacylated LOS structure of the N. gonorrhoeae lgtK mutant was probed by capillary electrophoresis (CE) mass spectrometry (MS) revealing two major structures with masses of 2023.1 and 1939.0 (Figure 2a). The structure of these species was then further probed by CE-MS/MS analysis. MS/MS-based analysis is dependent on the fact that the fragmentation of cationic oligosaccharides typically proceeds by cleavage at the glycosidic bonds, thus enabling the acquisition of information about oligosaccharide branching. The CE-MS/MS analysis of m/z 2023.1 is illustrated in Figure 2b. The fragment ion at m/z 851.0 in Figure 2b arises from the loss of lipid A and one 2-keto-3deoxy-octulosonic acid (KDO) residue. Then the core oligosaccharide subsequently loses another KDO giving the fragment ion at m/z 631.0. The fragment ions at m/z 856.0, 468.0, and 388.0 were associated with the lipid A (MW 952.0 Da). Further information was obtained by conducting an online MS/MS experiment of the selected precursor ion at m/z 631.0. This ion corresponds to the singly charged fragment ion [Hep2PEtn2]+ formed in the orifice/skimmer region of the mass spectrometer by raising the orifice voltage to 180 V (Figure 2c). As illustrated in Figure 2c, the presence of a PEtn-Hep-PEtn fragment ion (m/z 439.0) was observed, arising from the loss of one Hep. The location of the two PEtn groups was thus assigned to Hep II. Another fragmentation pathway was observed from the loss of -CH2-CH2-NH2 to form an ion m/z 588.0 and loss of Hep to yield m/z 396.0. Thus the major species of the core OS structure of the N. gonorrhoeae lgtK mutant was found to be the same truncated form as that observed for N. meningitidis rfaK as previously described (Rahman et al., 2001Go). Similar CE-MS/MS analysis of m/z 1939.0 revealed that this minor structure contained a Hexose rather than two PEtn on HepII (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2. MS analysis of LOS from the LgtK knockout mutant of N. gonorrhoeae FA1090. Panel a shows the CE-MS analysis of de-O-acylated LOS from FA1090. Panel b shows the CE-MS/MS analysis of m/z 2023.1. Panel c shows an online MS/MS experiment of the selected precursor ion at m/z 631.0. This ion corresponds to the single-charged fragment ion [Hep2 phosphoethanolamine2]+ formed in the orifice/skimmer region of the mass spectrometer by raising the orifice voltage to 180 V.

 
Recombinant enzyme expression data
We have shown that production of the LgtK protein at 37°C leads to an insoluble protein of low activity (data not shown). We thought that part of the reason the protein appears insoluble when grown at 37°C was due to the formation of inclusion bodies, but clearly the protein remains in the low-speed supernatant, suggesting that the problem is more likely due to protein misfolding or a result of its membrane association. For this reasons we grew the strain at 20°C for production of the LgtK protein. The expression level of recombinant proteins from both N. meningitidis and N. gonorrhoeae appeared to be the same; however, we consistently measured threefold more activity from the N. gonorrhoeae version of the enzyme (data not shown).

To evaluate the enzyme activity, we were only able to partially purify the protein using a partitioning strategy. Because the enzyme is found associated with the membrane fraction, we used this initially to enrich the enzyme. For further characterization of the enzyme we used the MalE-fusion version of the protein, which could be purified as a soluble enzyme to near homogeneity in a single step on an amylose affinity column (data not shown). We recovered 33% of enzyme activity loaded on the amylose column, and this was stable in 20% glycerol for up to 1 week.

Enzyme activity
To investigate enzyme activity, we initially used a core oligosaccharide derived from the truncated LPS of the lgtK knockout mutant as an acceptor, as there had been suggestions in the literature that the PEtn at the 3 position of Hep II might be required for transfer of the {alpha}-GlcNAc residue (Rahman et al., 2001Go). We did not use the core oligosaccharide derived from the N. gonorrhoeae knockout, however, because it contained two PEtn residues on Hep II, which we felt might not reflect the true biosynthetic intermediate. For this reason we used the core oligosaccharide from the corresponding N. meningitidis immunotype L3 lgtK mutant, which had only one PEtn, at the 3 position of Hep II (van der Ley et al., 1997Go). This core oligosaccharide would be a trisaccharide similar to the structure shown in Figure 1, with the addition of phosphoethanolamine on Hep II. The enzyme activity was analyzed by examining the reaction mixtures with CE-MS, an example of this being in Figure 3. Because MS data is difficult to quantitate, the yield of product could only be estimated as around 1% or 2%. This analysis does show that only a trace of product could be detected indicating the enzyme is only very weakly active on this oligosaccharide. This result suggests the core oligosaccharide is a poor acceptor for this enzyme. In the product ion scan shown in Figure 3, the two peaks around 3 min are due to some positively charged impurities in the sample, because they were ahead of electroendoosmotic flow (~5 min). The peaks at 9 and 10 min were artifact spikes, due to the fluctuation of electrospray instrument at this high sensitivity setting.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. CE-MS analysis of enzyme reactions on core oligosaccharides from an LgtK knockout mutant. This figure shows a superimposition of the total ion current (dotted line, TIC) and a scan for the acceptor mass (dashed line) and a scan for the product mass (solid line). A small peak of 947 Da, which corresponds to the addition of a single GlcNAc residue (744 + 203), can be seen. The product ion scan is on a different scale (10x enhanced) relative to the acceptor scan. It is difficult to quantitate yields by CE-MS, however we estimate that there is approximately 1%–2% conversion of substrate to product.

 
Because the core oligosaccharide was a poor acceptor for the enzyme, we therefore employed a synthetic acceptor to obtain enough product from the enzyme reaction to confirm the sugar linkage formed in the reaction. Enzyme activity of LgtK could be measured with the synthetic acceptor 5-fluorescein-EX succimidyl ester (FEX)-aminophenyl-{alpha}-mannoside (FEX-{alpha}-Man). During the course of this work, the synthetic acceptor FEX-aminophenyl-{alpha}-L-glycero-D-manno-heptoside (FEX-{alpha}-Hep) was synthesized so that an authentic heptose-containing acceptor could be used. A comparison of activity with synthetic acceptors is shown in Table I.


View this table:
[in this window]
[in a new window]
 
Table I. Enzyme activity of MalE-LgtK

 
We tried various donor sugars with LgtK, including UDP-Glc, UDP-Gal, UDP-GalNAc, and UDP-GlcNAc. Enzyme activity was only seen with UDP-GlcNAc, and we were able to measure a Km(app) for this donor of 731 ± 80 mM (Figure 4). We also attempted to measure kinetic parameters for the acceptors FEX-{alpha}-Man, FEX-{alpha}-Hep, as well as p-nitrophenyl-{alpha}-Man and p-nitrophenyl-{alpha}-Hep. We observed substrate inhibition for both FEX-labeled acceptors (Figure 5), and we were not able to show saturation kinetics with the nitrophenyl glycosides up to 15 mM concentrations, which precluded us from measuring kinetic parameters with those acceptors (Figure 7).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Kinetic data for MalE-LgtK for UDP-GlcNAc. A representative progress curve for determination of Km(app) with MalE-LgtK and UDP-GlcNAc is shown. The concentration of UDP-GlcNAc was varied from 0.1 mM to 5 mM with the acceptor (FEX-{alpha}-Man) being held at 2 mM. Panel B shows is the replotted data as an Eadie-Hofstee plot of V versus V/S. Product formation was quantitated by CE analysis of the reaction mixtures.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. Substrate inhibition of MalE-LgtK with FEX-{alpha}-Man. When generating the progress curve with FEX-{alpha}-Man and FEX-{alpha}-Hep, we saw that instead of reaching saturation we observed enzyme inhibition. This precluded an accurate measure of the Km(app) for the FEX-{alpha}-glycosides.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7. Enzyme activity of MalE-LgtK with p-nitrophenyl-{alpha}-glycosides. The data plotted with the closed circles is the assay data with p-nitrophenyl-{alpha}-Man. The data plotted with the open circles is the assay data with p-nitrophenyl-{alpha}-Hep. These assays were performed at 37°C for 30 min. Activity was measured by separation and quantitation of the product peaks by CE.

 
Identification of the product formed by LgtK with synthetic acceptors
The sugar linkage of the product formed by the N. gonorrhoeae LgtK enzyme using FEX-{alpha}-Man as an acceptor in a preparative synthesis was analyzed using methylation analysis. Two linkage types were observed: 2-linked mannose and terminal N-acetyl-glucosamine. Nuclear magnetic resonance (NMR) was used to further investigate the structure of the purified product. There were two anomeric protons observed, one at {delta} 5.54 (unresolved doublet) which was assigned to a {alpha}-Man [H-2 {delta} 3.60 (J2,3 2 Hz)] and {delta} 4.65 (J1,2 3 Hz) typical for an {alpha}-GlcNAc [H-2 {delta} 3.86 (J2,3 9 Hz)]. To confirm the position of the GlcNAc substituent, a 2D 1H-1H nuclear Overhauser effect spectroscopy (NOESY) experiment was performed and an internuclear Overhauser effect between H-1 ({delta} 4.65) of the {alpha}-GlcNAc and H-2 ({delta} 3.60) of the {alpha}-Man was observed, verifying the sugar linkage analysis data. In addition a second strong internuclear Overhauser effect between the and H-1 ({delta}) of the {alpha}-GlcNAc and H-1 ({delta} 5.54) of the {alpha}-Man characteristic of a 2-linked D-manno-configured sugar (Romanowska et al., 1988Go) was observed helping further substantiate the 2-linkage. This lead to the final product of the LgtK enzyme reaction being assigned as {alpha}-GlcNAc-(1->2)-{alpha}-Man-(1->)-AP-FEX.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The role of the LgtK enzyme in LOS biosynthesis in N. gonorrhoeae was verified by producing the lgtK knockout mutant in N. gonorrhoeae. Our analysis showed that the lgtK knockout produced the same phenotype in N. gonorrhoeae as was seen previously in N. meningitidis NMB (Rahman et al., 2001Go). The analysis of the lgtK knockout LOS structure also revealed that in N. gonorrhoeae FA1090 a small but significant amount of a structure containing a hexose on Hep II could be seen in the lgtK knockout strain. Normally in N. gonorrhoeae FA1090 Hep-II also has an extension (the ß-chain) in addition to the 2-linked GlcNAc. It appears that the initiating hexose on Hep-II can still be partially added in the absence the LgtK reaction product. This hexose on Hep-II is normally added by the LgtG enzyme (Banerjee et al., 1998Go), and unlike the LgtF glucosyltransferase used for the {alpha}-chain extension it does not absolutely require the presence of the 2-linked GlcNAc on Hep II. We did not check the linkage of this hexose addition, but we speculate it is added by LgtG. There was however no evidence for longer products being made in this strain suggesting that the subsequent enzymatic additions are sensitive to the substitution pattern and/or conformation of Hep II.

The biochemical characterization of the inner core LPS biosynthetic enzymes has not been extensive. The current literature has reports of work on the heptosyltransferase I from E. coli (Kadrmas and Raetz, 1998Go) and the KDO-transferases from Chlamydia (Lobau et al., 1995Go). The enzymology of these proteins would be facilitated if suitable soluble synthetic acceptors could be used. These previous reports have not included attempts to characterize the enzyme using synthetic acceptors and have used radiolabeled LPS precursors as acceptors. Our initial attempts to assay the LgtK enzyme were performed with core oligosaccharides (no lipid A) derived from the lgtK mutant strain of N. meningitidis L3, which contains a phosphoethanolamine residue at O3 of Hep II. Reports in the literature suggested that the presence of the phosphoethanolamine group on the 3-position of Hep II would be required for enzyme activity (Rahman et al., 2001Go).

Our approach was to use CE-MS analysis to determine if the enzyme reactions were producing any product. Despite repeated attempts to optimize the reaction using the core oligosaccharide, we were unable to obtain more than 1% or 2% of the product in these reactions. In previous work we have been able to see other enzymes adding sugars to core oligosaccharides using this approach (Thibault et al., 2003Go). We interpreted this to mean that the core oligosaccharide was in fact a poor acceptor for this enzyme. It is also possible that the lipid A portion of the molecule may be required for this enzyme to perform its reaction; however, it was impossible to do assays with the lipid A–containing material because it forms high-molecular-weight aggregates. When we employed the synthetic acceptor FEX-{alpha}-Man or FEX-{alpha}-Hep, we were able to obtain quantitative conversion to product on the milligram scale with enzyme derived from either N. meningitidis or N. gonorrhoeae and to verify that the product being formed was indeed an {alpha}-1,2-linked GlcNAc residue. Our data suggests that the 3-linked phosphoethanolamine on Hep II could go on after the {alpha}-1,2-linked GlcNAc residue, and that the presence of the 3- and 6-linked phosphoethanolamine on Hep II in the lgtK mutant might simply reflect the low specificity of the phosphoethanolamine transferase with the LPS generated in the mutant strain. A direct test of this hypothesis could be to examine LgtK reactions on a synthetic acceptor with phosphoethanolamine at O3. The synthesis of such an acceptor, however, is not trivial, and to date we have not attempted to make such an acceptor.

We also noticed that the LgtK enzyme from N. meningitidis was less active toward the synthetic acceptor than the enzyme from N. gonorrhoeae. The explanation for the differential activity is not simple, although there is a short sequence difference from aa 243–253 in LgtK-Ng, which may be responsible, but we have not verified this experimentally.

We investigated the expression of the LgtK enzyme in E. coli and found that it could be overexpressed and enriched as an active enzyme when assayed with synthetic acceptors. Attempts to further purify the protein using conventional ion-exchange chromatography were unsuccessful because the enzyme rapidly lost activity (data not shown). We were able to express the enzyme as a fusion with the MalE protein from E. coli. A comparison of the native enzyme and MalE fusion showed that making the fusion protein resulted in only a slight loss of activity and that the purified MalE-LgtK fusion protein also lost activity (data not shown), but it was stable enough to use to collect data with the FE labeled acceptors. We were able to show that the enzyme was specific for UDP-GlcNAc, but our synthetic acceptors, though useful for measuring enzyme activity, were not suitable for collecting kinetic parameters.

We previously developed many synthetic acceptors to examine outer core enzymes from Neisseria and other bacterial pathogens (Gilbert et al. 1997Go, 2000Go; Wakarchuk and Cunningham, 2003Go) and have used this approach to start a study of a key control point enzyme, LgtK from N. gonorrhoeae. So far the analysis has been performed with only monosaccharide acceptors with a variety of aglycones. As we saw with other bacterial glycosyltransferases, acceptors with the larger aglycone FEX performed better in the assays (four- to sevenfold higher specific activity). A comparison of the acceptors FEX-{alpha}-Man and FEX-{alpha}-Hep showed the enzyme did not discriminate much between these two synthetic acceptors. We did notice that the {alpha}-Man acceptor was better than the {alpha}-Hep. This is somewhat surprising, but perhaps it reflects that the accessible part of Hep II is limited to the axial hydroxyl at C2 and that the C7 position of Hep is not a critical contact point for this enzyme. The preliminary kinetic data also suggests that these synthetic acceptors are not optimal—we were unable to obtain meaningful kinetic data because of very strong acceptor inhibition at higher concentrations of FEX-{alpha}-Man/Hep. The reason we observed substrate inhibition with the FEX-aminophenyl-{alpha}-Man and Hep acceptors is not known, but it is likely the large planar FEX aglycone may have a negative effect on the enzyme activity of LgtK at the relatively high acceptor concentrations we used. Attempts to use the smaller acceptor p-nitrophenyl-{alpha}-Man for kinetic assays were also unsuccessful, as we could not see the apparent acceptor saturation of the enzyme up to the limit of solubility of the acceptor (>15 mM). These data also clearly indicate that the nature of the aglycone is important for this enzyme and that size and shape play a role in how the acceptor is recognized. This remains one of the most important considerations when characterizing glycosyltransferases from many sources.

We were able to measure an apparent Km for UDP-GlcNAc and showed that this is the only UDP-linked sugar that the enzyme would use as a donor. Because we were unable to determine other kinetic parameters with these acceptor substrates, we have avoided over interpretation of this data. The data we did collect shows the Km(app) values would be in the mM range, which is similar to what has been seen with many other synthetic acceptors used with many other glycosyltransferases. It may be the aglycone that contributes to the substrate inhibition, but this will need to be tested by synthesis of several analogs where the aglycones have different properties to FEX. We have attempted to use other LPS-derived molecules to measure the enzyme activity, but molecules containing the lipid A portion are poorly soluble in water and tend to aggregate, making these poor acceptors. We have also invested some effort in using the oligosaccharide derived from the LPS by mild acid hydrolysis, but obtaining large amounts of this material with and without the phosphoethanolamine is not practical at present.

In conclusion, we have shown that the LgtK protein from N. gonorrhoeae and N. meningitidis has {alpha}-1,2-N-acetyl- glucosaminyltransferase activity on synthetic acceptors, which is the biochemical demonstration of an activity that has been previously only been inferred by structural analysis of knockout mutants of the bacterium. We have also shown that the enzyme activity does not depend on having a 3-substitued D-manno configured acceptor. What is not known is if the presence of the 3-substitution enhances activity, although our data suggest the 3-substituted Hep II was not a good acceptor for this enzyme. Clearly other synthetic acceptors are required to provide definitive data on the role of the phosphoethanolamine substitution in the activity of LgtK to the detailed examination of the acceptor specificity of LgtK. We are continuing to characterize this important enzyme to obtain further structure–function data.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Bacterial strains and plasmids
The following strains of N. meningitidis and N. gonorrhoeae were used: immunotype L3 strain MC58 (NRCC 4728) and N. gonorrhoeae FA1090 (obtained from Dr. Jan Cannon). The cloning vector pCW was used for expression of the LgtK genes and has been described previously (Wakarchuk et al., 1994Go). The lgtK gene was isolated from N. meningitidis and N. gonorrhoeae genomic DNA by polymerase chain reaction with Pwo polymerase as described by the manufacturer (Roche Molecular Systems, Indiana, IN) using primers ICS5P 5' TGCTTAGGAGGTCATATGGAAAAAGAATTCAGGATATTA 3' (used for both genes), and ICS3P 5' GGGGGGGCTGACTCATCATATTGCATCCAATAATTTGTCGGCG 3' (used for both genes). Maltose-binding protein fusions were constructed in pCW using the malE gene from E. coli (GenBank accession number ECOUW89), fused at the N-terminal end of LgtK, with three extra glycine codons in between the two genes. The malE gene was used without a leader peptide as described in technical literature from New England Biolabs (Mississauga, Ontario). The fusion protein was purified as described in the technical bulletin that accompanies the amylose resin manufactured by New England Biolabs. Plasmids were propagated in E. coli strain AD202 (CGSC # 7297) or DH12S (Invitrogen, Carlsbad, CA).

Generation of lgtK mutants of N. meningitidis and N. gonorrhoeae
Knockout strains in which the lgtK gene had been inactivated were constructed essentially as was previously described by (Kahler et al., 1996Go; van der Ley et al., 1997Go). The strains used were N. meningitidis MC58 and N. gonorrhoeae FA1090. Correct single insertions of the antibiotic resistance cassette were detected by polymerase chain reaction and Southern blot analysis (data not shown).

Bacterial growth and generation of LOS, core oligosaccharide, and O-deacylated LPS
N. gonorrhoeae lgtK::kanR was grown with shaking overnight at 37°C in Columbia broth supplemented with 30 µg/ml kanamycin, and biomass was then harvested by centrifugation. LOSs were isolated by the hot water–phenol extraction of bacterial cells (Westphal and Jann, 1965Go) as a gel-like pellet on ultracentrifugation of the aqueous phase. The LOS pellet was lyophilized and then purified on a column of Bio-Gel P-2 (1 cm x 100 cm) with water as eluent. Some of the LOS preparation was then treated with 1% acetic acid at 100°C for 1 h with subsequent removal of the insoluble lipid A by centrifugation (5,000 x g) to yield the core oligosaccharide, which was further purified by chromatography on a column of Bio-Gel P-2 with water as eluent. LOS was O-deacylated with anhydrous hydrazine under mild conditions as described previously (Holst et al., 1991Go). Briefly, 15 mg was treated with 1 ml anhydrous hydrazine for 1 h at 37°C. The sample was then cooled to 0°C, and the excess hydrazine was destroyed with the addition of 5 ml cold acetone. The precipitate was centrifuged at 5,000 x g for 15 min and then washed with acetone (3 x 2 ml) and then acetone:water (4:1 x 3 ml) and lyophilized.

Synthesis of synthetic acceptors FEX-{alpha}-Man and FEX-{alpha}-LD-Heptose
Aminophenyl-glycosides were made from the corresponding nitrophenyl-glycosides by catalytic hydrogenation (Hudlicky, 1984Go). These were then labeled with FEX and purified as previously described for FCHASE-aminophenylglycosides (Gilbert et al., 1997Go). Synthesis of the {alpha}-L,D-heptose compounds was performed partly as described in the literature (Garegg et al., 1992Go) and as will be described. The numbering of the compound structures is explained in Figure 6. Compound 1 was commercially available (Sigma-Aldrich, St. Louis, MO).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. Structures of synthetic acceptors and chemical intermediates. The structures of the acceptors used for the enzyme assays were compounds 1, 2, 6, and 7. The synthetic intermediates en route to compounds 6 and 7 were compounds 3, 4, and 5.

 
2,3,4,6,7-Penta-O-acetyl-L-glycero-{alpha}-D-mannoheptopyranosyl trichloroacetimidate
1,2,3,4,6,7-Hexa-O-acetyl-L-glycero-{alpha}-D-mannoheptopyranose, which was obtained following the literature cited (3, 600 mg, 1.3 mmole) was dissolved in N,N'dimethylformamide (50 ml), and hydrazine acetate (145 mg, 1.55 mmole) was added. The reaction mixture was stirred for 2 h, and at this point TLC (1:1 ethyl acetate:hexanes) indicated that the reaction was complete. The reaction was worked up by diluting with methylene chloride and washing with water. The aqueous solution was extracted once more with methylene chloride, then the combined organic phase was washed with water and twice with brine, dried over magnesium sulfate, filtered, and concentrated. The residue was coconcentrated three times with toluene to give 2,3,4,6,7-penta-O-acetyl-L-glycero-{alpha}-D-mannoheptopyranose (520 mg, 95%). The structure was confirmed by 1H NMR (CDCl3): {delta} 5.37(dd,1H, J2,3 3.4 and J3,4 10.3 Hz, H-3), 5.31–5.25 (m, 3H, H-2, H-1 and H-4), 5.22 (ddd, 1H, J5,6 2.2, J6,7 5.6 and J6,7' 6.8 Hz, H-6), 4.39 (dd, 1H, J6,7 5.6 and J7,7' 11.5 Hz, H-7), 4.23 (dd, 1H, J5,6 2.0 and J4,5 10.3 Hz, H-5), 4.13 (dd, 1H, J6,7' 6.8 and J7,7' 11.5 Hz, H-7'), 2.16, 2.13, 2.05, 2.01,1.97 (5x s, 3H, OAc ). This pyranose was dissolved in dry methylene chloride (20 ml) under an argon atmosphere, and the mixture was chilled in an ice-calcium chloride mixture. To this was added trichloroacetonitrile (1.25 ml, 12.5 mmole) followed by 1,8-diazabicyclo[5.4.0]undec-7-ene (20 µl, 0.125 mmole). The reaction turned yellow-orange and was complete in 2.5 h. The mixture was diluted with methylene chloride and then absorbed onto silica gel (5 g). This silica gel was placed on a short silica gel column, and the product was eluted with 30:70 ethyl acetate: hexanes to yield (4, 440 mg 63%). [{alpha}]D + 15.1° (c, 0.4 chloroform); 1H NMR (CDCl3): {delta} 8.76 (s, 1H, NH), 6.25 (s, 1H, H-1), 5.46 (brs, 1H, H-2), 5.38–5.36 (m, 2H, H-3 and H-4), 5.24 (ddd, 1H, J5,6 2.0 and J6,7' 7.6 Hz, H-6), 4.24–4.20 (m, 2H, H-7 and H-5), 4.14 (dd, 1H, J6,7' 7.6 and J7,7' 11.2 Hz, H-7'), 2.20, 2.12, 2.03, 1.99, 1.96 (5x s, 3H, OAc), fast atom bombardment (FAB)-MS (positive-ion): analytical calculated for C19H24NO12C13: 564.7. Found: m/z 564.9.

p-Nitrophenyl 2,3,4,6,7-Penta-O-acetyl-L-glycero-{alpha}-D-mannoheptopyranoside
Trichloroacetimidate (4, 70 mg, 0.124 mmole) was dissolved in dry methylene chloride (8 ml) under an argon atmosphere and p-nitrophenol (35 mg, 0.248 mmole) was added followed by 4A molecular sieves (150 mg). The mixture was stirred for 1 h at room temperature and then chilled in an ice–calcium chloride bath before triethylsilyl trifluoromethane sulfonate (40 µl, 0.173 mmole) was added. After 1.5 h, TLC showed disappearance of trichloroacetimidate, and the reaction was quenched with triethylamine (0.4 ml). The reaction mixture was diluted with methylene chloride and then absorbed on a small amount of silica gel. This silica gel was placed on a small silica gel column and eluted using 35:65 ethyl acetate: hexanes to yield (5, 58 mg; 86%). [{alpha}]D + 83.9° (c 0.13 chloroform); 1H NMR (CDCl3): {delta} 8.22 (d, 2H, Ph), 7.15 (d, 2H, Ph), 5.67 (d, 1H, J1,2 2.8 Hz, H-1), 5.51 (dd, 1H, J2,3 3.7 and J3,410.3 Hz, H-3), 5.46 (m, 1H, H-2), 5.42 (brt, 1H, J 10.1 Hz, H-4), 5.21 (dt, 1H, J5,6 2.0 and J6,7 6.8 Hz, H-6), 4.08 (dd, 1H, J5,6 2.0 and J4,5 10.0 Hz, H-5), 4.05–4.01 (m, 2H, H-7 and H-7'), 2.22, 2.21, 2.02, 2.01, 1.67 (5x s, 3H, OAc). FAB-MS (positive-ion): analytical calculated for C23H27NO14Na: 564.4. Found: m/z 564.4.

p-Nitrophenyl L-glycero-D-mannoheptopyranoside
Peracetate (5, 50 mg, 0.092 mmole) was dissolved in dry methanol (10 ml) and 1 M sodium methoxide solution (0.5 ml) was added. The reaction was complete in 2 h at room temperature. The mixture was neutralized using 101 Rexyn (H+) resin, and after filtration the solvent was evaporated. The product was purified by trituration overnight in diethyl ether. The resulting yellow solid was filtered off and rinsed with more diethyl ether and dried to yield (6, 23 mg; 75%). [{alpha}]D +134.8° (c 0.21 methanol); 1H NMR (CDCl3): {delta} 8.25 (d, 2H, Ph), 7.28 (d, 2H, Ph), 5.70 (s, 1H, H-1), 4.05 (m, 1H, H-2), 3.99 (t, 1H, J 9.5 Hz, H-4), 3.96–3.89 (m, 2H, H-6 and H-3), 3.57–3.50 (m, 2H, H-5 and H-7), 3.31–3.28 (m, 1H, H-7'); 13C NMR (CDCl3): {delta} 100.04 (C-1), 74.50 (C-5), 72.64 (C-3), 71.68 (C-2), 70.72 (C-6), 67.51 (C-4), 64.80 (C-7); FAB-MS (positive-ion): analytical calculated for C13H17NO9: 331.27. Found: m/z 331.37.

Sugar linkage analysis by methylation
Methylation analysis was performed with the NaOH/DMSO/CH3I procedure (Ciucanu and Kerek, 1984Go) on the product of the LgtK enzyme reaction that had been performed with the synthetic acceptor FEX-{alpha}-Man. The hydrolysis was performed in 4 M trifluoroacetic acid for 4 h at 100°C followed by reduction with NaBD4 in H2O overnight, then acetylated with acetic anhydride at 100°C for 2 h using residual sodium acetate as catalyst. The methyl ether derivatives were characterized by gas-liquid chromatography MS using a Hewlett-Packard chromatograph equipped with a 30 M DB-17 capillary column (180°C to 230°C at 2.5°C/min). MS was done in the electron impact mode and recorded on a Varian Saturn II mass spectrometer.

NMR
NMR experiments were acquired on a Varian Inova 500 MHz spectrometer using a 5 mm triple resonance probe with the 1H coil nearest to the sample and with a Z gradient coil. The measurements were performed on the TLC-purified enzyme reaction product starting from the synthetic acceptor FEX-{alpha}-Man. All measurements were made at 25°C, with the monodeuterated water resonance at 4.78 ppm. The previously lyophilized sample (2 mg) was dissolved in 0.6 ml D2O. All NMR experiments were performed as previously described (Gilbert et al., 2000Go)

CE-MS and CE-MS/MS
A crystal Model 310 CE instrument (AYI Unicam, Boston, MA) was coupled to an API 3000 mass spectrometer (Perkin-Elmer/Sciex, Concord, Canada) via a micro-Ionspray interface. A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1 µl/min to a low dead volume tee (250 µm ID, Chromatographic Specialties, Brockville, Canada). All aqueous solutions were filtered through a 0.45-µm filter (Millipore, Bedford, MA) before use. An electrospray stainless steel needle (27-gauge) was butted against the low dead volume tee and enabled the delivery of the sheath solution to the end of the capillary column. The separations were obtained on ~90-cm length bare fused-silica capillary using 10 mM ammonium acetate/ammonium hydroxide in deionized water, pH 9.0, containing 5% methanol. A voltage of 20 kV was typically applied at the injection. The outlet of the capillary was tapered to ~15 µm ID using a laser puller (Sutter Instruments, Novato, CA). Mass spectra were acquired with dwell times of 3.0 ms per step of 1 m/z unit in full-mass scan mode. The MS/MS data were acquired with dwell times of 1.0 ms per step of 1 m/z unit. Fragment ions formed by collision activation of selected precursor ions with nitrogen in the RF-only quadrupole collision cell were mass-analyzed by scanning the third quadrupole.

Production of the enzyme
Cultures of pCW::LgtK(and the MalE version) were grown first overnight at 30°C in 2YT supplemented with 150 µg/ml ampicillin. Fresh cultures (200 ml) were started with an inoculum of 0.5 A600, this culture was grown at 20°C until A600 = 0.5, at which point ispropylthiogalactoside was added to 0.5 mM. Growth was continued for 36–48 h, and then the cells were harvested by centrifugation and frozen at –20°C. Extracts were made by resuspending the cells in cold 50 mM HEPES, pH 7.5, with 10% glycerol (with 0.1% Polyoxyethylene octyl ether (POE) for MalE-fusion protein workup) and then sonication (for less than 0.5 g cells) or disruption with nitrogen pressure in an Emulsiflex C5 (Avestin). Protease inhibitors were added as suggested by the manufacturer (Complete Protease Inhibitor Tablets, Roche). A clarified supernatant was made by centrifugation at 4°C at 15,000–20,000 x g. The supernatant was decanted, and the pellet was resuspended pellet in half the volume of cold buffer. Polyethylene glycol precipitations were performed on 20,000 x g supernatants by adding NaCl and PEG8000 to a final concentrations of 4% PEG, 0.2 M NaCl. These mixtures were incubated at 4°C for 1 h with occasional mixing. The precipitate was collected by centrifugation at 15,000–20,000 x g for 30 min. The supernatant was removed and the pellet resuspended with cold 50 mM HEPES, pH 7.5, 10% glycerol. Detergent solubilization was performed on the 4% PEG precipitate, by adding 1% POE followed by incubation at 4°C for 20 min. Soluble enzyme was recovered after centrifugation at 20,000 x g for 30 min. To remove POE, the 1% POE supernatant was dialyzed against 500 volumes of 20 mM HEPES, pH 7.4, 20% glycerol at 4°C for 16 h. Some improvement of recovery of enzyme activity could be observed with the addition of 5 mM dithiothreitol to the buffers.

The MalE-fusion protein was purified by chromatography of the clarified 20,000 x g supernatant on an amylose affinity column as suggested by the manufacturer (New England Biolabs). To stabilize the protein, glycerol (15% v/v) and 0.1% POE were added to the column buffers. Briefly from 3.6 g cells (500 ml culture) we obtained 10.3 U of activity. The specific activity of the purified fusion protein was 57 mU/mg using FCHASE-{alpha}-Mannoside, which was a 5.8-fold increase in specific activity.

Glycosyltransferase assays
Enzyme activity was quantitated using the CE assay we previously described (Gilbert et al., 1997Go). The acceptors used in these assays were FEX-{alpha}-Mannoside, FEX-{alpha}-L,D-Heptoside, p-nitrophenyl-{alpha}-mannoside, and p-nitrophenyl-{alpha}-L,D-heptoside. The reactions contained, 0.2–5 mM FEX containing acceptor, or 0.5–15 mM p-nitrophenyl-glycoside acceptor, 50 mM HEPES, pH 8.5, 10 mM MnCl2, 5 mM UDP-GlcNAc, and 5 µl extract in a 10 µl reaction. Reactions were incubated at 37°C for 5–60 min. Reactions were stopped with an equal volume of 50% acetonitrile, 1% sodium dodecyl sulfate, 10 mM ethylenediamine tetra-acetic acid, then were diluted with water prior to analysis by CE. A unit of enzyme activity is defined as the amount of enzyme that converts 1 µmol of acceptor to product per minute of the reaction. The data were analysed by fitting the data using the Michaelis-Menten equation using GraphPad Prism version 3.03 for Windows (GraphPad Software, San Diego, CA).

Preparative reactions with FEX-{alpha}-Man were performed with ~1 mg of acceptor in a reaction volume of 1 ml (~1.2 mM). The progress of the reaction was monitored by CE, the reaction mixture was collected on a SepPak C18 cartridge after dilution to 10 ml with water, desalted with 10 ml of water, and then eluted with 70% acetonitrile. After removal of the solvent, the reaction mixture was separated on 0.5 mm TLC plates developed in ethyl acetate:methanol:water: acetic acid (7:2:1:0.1). The product had an Rf of 0.4 in this solvent. The product was scraped off the plate and eluted in warm water. This material was again desalted with a SepPak C18 cartridge and eluted in 70% acetonitrile. The dry product was used for NMR and methylation analysis as described.


    Acknowledgements
 
We thank Drs. Stephen Withers and Lawrence McIntosh for critical reading of the manuscript, and Steve Marshall for technical assistance. Part of this work was funded by a collaborative research project with GlycoDesign Toronto.


    Footnotes
 
1 To whom correspondence should be addressed; e-mail: warren.wakarchuk{at}nrc-cnrc.gc.ca


    Abbreviations
 
CE, capillary electrophoresis; FAB, fast atom bombardment; FEX, 5-fluorescein-EX succimidyl ester; KDO, 2-keto-3deoxy-octulosonic acid; LOS, lipooligosaccharide, LPS, lipopolysaccharide; MS, mass spectrometry; NMR, nuclear magnetic resonance


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Banerjee, A., Wang, R., Uljon, S.N., Rice, P.A., Gotschlich, E.C., and Stein, D.C. (1998) Identification of the gene (lgtG) encoding the lipooligosaccharide beta chain synthesizing glucosyl transferase from Neisseria gonorrhoeae. Proc. Natl Acad. Sci. USA, 95, 10872–10877.[Abstract/Free Full Text]

Blixt, O., Van, I.D., Norberg, T., and van den Eijnden, D.H. (1999) High-level expression of the Neisseria meningitidis lgtA gene in Escherichia coli and characterization of the encoded N-acetylglucosaminyltransferase as a useful catalyst in the synthesis of GlcNAc beta 1->3Gal and GalNAc beta 1->3Gal linkages. Glycobiology, 9, 1061–1071.[Abstract/Free Full Text]

Ciucanu, I., and Kerek, F. (1984) A simple and rapid method for the permethylation of carbohydrates. Carbohydr. Res., 131, 209–217.[CrossRef]

Coutinho, P.M. and Henrissat, B. (1999) Carbohydrate-active enzymes server. Online database available at http://afmb.cnrs-mrs.fr/~cazy/CAZY/index.html.

Garegg, P.J., Oscarson, S., Ritzen, H., and Szonyi, M. (1992) Synthesis of 2-(4-trifluoroacetamidophenyl)ethyl O-(L-glycero-alpha-D-manno- hepto pyranosyl)-(1-7)-O-(L-glycero-alpha-D-manno- heptopyranosyl)-(1-3)- L-glycero-alpha-D-manno-heptopyranoside, corresponding to the heptose region of the Salmonella ra core structure. Carbohydr. Res., 228, 121–128.[CrossRef][ISI][Medline]

Gilbert, M., Cunningham, A.M., Watson, D.C., Martin, A., Richards, J.C., and Wakarchuk, W.W. (1997) Characterization of a recombinant Neisseria meningitidis alpha-2,3-sialyltransferase and its acceptor specificity. Eur. J. Biochem., 249, 187–194.[ISI][Medline]

Gilbert, M., Brisson, J.R., Karwaski, M.F., Michniewicz, J., Cunningham, A.M., Wu, Y., Young, N.M., and Wakarchuk, W.W. (2000) Biosynthesis of ganglioside mimics in Campylobacter jejuni OH4384. Identification of the glycosyltransferase genes, enzymatic synthesis of model compounds, and characterization of nanomole amounts by 600-mhz (1)H and (13)C NMR analysis. J. Biol. Chem., 275, 3896–3906.[Abstract/Free Full Text]

Holst, O., Brade, L., Kosma, P., and Brade, H. (1991) Structure, serological specificity, and synthesis of artificial glycoconjugates representing the genus-specific lipopolysaccharide epitope of Chlamydia spp. J. Bacteriol., 173, 1862–1866.[Abstract/Free Full Text]

Hudlicky, M. (1984) Reductions in organic chemistry. ACS monograph series, Ellis Horwod, Chichester, U.K.

Kadrmas, J.L. and Raetz, C.R. (1998) Enzymatic synthesis of lipopolysaccharide in Escherichia coli. Purification and properties of heptosyltransferase I. J. Biol. Chem., 273, 2799–2807.[Abstract/Free Full Text]

Kahler, C.M., Carlson, R.W., Rahman, M.M., Martin, L.E., and Stephens, D.S. (1996) Two glycosyltransferase genes, lgtF and rfaK, constitute the lipooligosaccharide ice (inner core extension) biosynthesis operon of Neisseria meningitidis. J. Bacteriol., 178, 6677–6684.[Abstract/Free Full Text]

Lobau, S., Mamat, U., Brabetz, W., and Brade, H. (1995) Molecular cloning, sequence analysis, and functional characterization of the lipopolysaccharide biosynthetic gene kdtA encoding 3-deoxy-alpha-D-manno-octulosonic acid transferase of Chlamydia pneumoniae strain TW-183. Mol. Microbiol., 18, 391–399.[CrossRef][ISI][Medline]

Mandrell, R.E. and Apicella, M.A. (1993) Lipo-oligosaccharides (LOS) of mucosal pathogens: molecular mimicry and host-modification of LOS. Immunobiology, 187, 382–402.[ISI][Medline]

Noah, C., Brabetz, W., Gronow, S., and Brade, H. (2001) Cloning, sequencing, and functional analysis of three glycosyltransferases involved in the biosynthesis of the inner core region of Klebsiella pneumoniae lipopolysaccharide. J. Endotoxin Res., 7, 25–33.[CrossRef][ISI][Medline]

Persson, K., Ly, H.D., Dieckelmann, M., Wakarchuk, W.W., Withers, S.G., and Strynadka, N.C. (2001) Crystal structure of the retaining galactosyltransferase LgtC from Neisseria meningitidis in complex with donor and acceptor sugar analogs. Nat. Struct. Biol., 8, 166–175.[CrossRef][ISI][Medline]

Raetz, C.R. and Whitfield, C. (2002) Lipopolysaccharide endotoxins. Annu. Rev. Biochem., 71, 635–700.[CrossRef][ISI][Medline]

Rahman, M.M., Kahler, C.M., Stephens, D.S., and Carlson, R.W. (2001) The structure of the lipooligosaccharide (LOS) from the alpha-1,2-N-acetyl glucosamine transferase (rfaK(NMB)) mutant strain CMK1 of Neisseria meningitidis: implications for LOS inner core assembly and LOS-based vaccines. Glycobiology, 11, 703–709.[Abstract/Free Full Text]

Romanowska, E., Gamian, A., Lugowski, C., Romanowska, A., Dabrowski, J., Hauck, M., Opferkuch, H.J., and der Lieth, C.W. (1988) Structure elucidation of the core regions from Citrobacter O4 and O36 lipopolysaccharides by chemical and enzymatic methods, gas chromatography/mass spectrometry, and NMR spectroscopy at 500 MHz. Biochemistry, 27, 4153–4161.[CrossRef][Medline]

Thibault, P., Martin, A., Gilbert, M., Wakarchuk, W., and Richards, J.C. (2003) Analysis of bacterial glycolipids by capillary electrophoresis-electrospray mass spectrometry. Methods Mol. Biol., 213, 241–259.[Medline]

Unkmeir, A., Kammerer, U., Stade, A., Hubner, C., Haller, S., Kolb-Maurer, A., Frosch, M., and Dietrich, G. (2002) Lipooligosaccharide and polysaccharide capsule: virulence factors of Neisseria meningitidis that determine meningococcal interaction with human dendritic cells. Infect. Immun., 70, 2454–2462.[Abstract/Free Full Text]

van der Ley P., Kramer, M., Martin, A., Richards, J.C., and Poolman, J.T. (1997) Analysis of the icsBA locus required for biosynthesis of the inner core region from Neisseria meningitidis lipopolysaccharide. FEMS Microbiol. Lett., 146, 247–253.[ISI][Medline]

Wakarchuk, W.W. and Cunningham, A.M. (2003) Capillary electrophoresis as an assay method for monitoring glycosyltransferase activity. Methods Mol. Biol., 213, 263–274.[Medline]

Wakarchuk, W.W., Campbell, R.L., Sung, W.L., Davoodi, J., and Yaguchi, M. (1994) Mutational and crystallographic analyses of the active site residues of the Bacillus circulans xylanase. Protein. Sci., 3, 467–475.[Abstract]

Wakarchuk, W., Martin, A., Jennings, M.P., Moxon, E.R., and Richards, J.C. (1996) Functional relationships of the genetic locus encoding the glycosyltransferase enzymes involved in expression of the lacto-N-neotetraose terminal lipopolysaccharide structure in Neisseria meningitidis. J. Biol. Chem., 271, 19166–19173.[Abstract/Free Full Text]

Wakarchuk, W.W., Cunningham, A., Watson, D.C., and Young, N.M. (1998) Role of paired basic residues in the expression of active recombinant galactosyltransferases from the bacterial pathogen Neisseria meningitidis. Protein Eng., 11, 295–302.[Abstract/Free Full Text]

Westphal, O. and Jann, K (1965) Bacterial lipopolysaccharides. Extraction with phenol-water and further applications of the procedure. Methods Carbohydr. Chem., 5, 83–91.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
E. T. O'Connor, A. Piekarowicz, K. V. Swanson, J. M. Griffiss, and D. C. Stein
Biochemical Analysis of Lpt3, a Protein Responsible for Phosphoethanolamine Addition to Lipooligosaccharide of Pathogenic Neisseria
J. Bacteriol., February 1, 2006; 188(3): 1039 - 1048.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
S. M. Logan, E. Altman, O. Mykytczuk, J.-R. Brisson, V. Chandan, F. St. Michael, A. Masson, S. Leclerc, K. Hiratsuka, N. Smirnova, et al.
Novel biosynthetic functions of lipopolysaccharide rfaJ homologs from Helicobacter pylori
Glycobiology, July 1, 2005; 15(7): 721 - 733.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/6/537    most recent
cwh074v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wakarchuk, W.
Right arrow Articles by Whitfield, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wakarchuk, W.
Right arrow Articles by Whitfield, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea