Skip Navigation


Glycobiology Advance Access originally published online on April 2, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/8/591    most recent
cwg066v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Appenheimer, M. M.
Right arrow Articles by Lau, J. T.Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Appenheimer, M. M.
Right arrow Articles by Lau, J. T.Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 8 591-600
© 2003 Oxford University Press

Biologic contribution of P1 promoter–mediated expression of ST6Gal I sialyltransferase

Michelle M. Appenheimer6, Ruea-Yea Huang6, E.V. Chandrasekaran7, Martin Dalziel1,6, Yi Ping Hu2,6, Paul D. Soloway3,6, Sherry A. Wuensch4,6, Khushi L. Matta7 and Joseph T.Y. Lau5,6

6 The Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263
7 Department of Molecular and Cellular Biophysics, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263

Received on January 27, 2003; revised on March 5, 2003; accepted on March 5, 2003


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The synthesis of the common and well-documented Sia{alpha}2,6 to Galß1,4GlcNAc structure (Sia6LacNAc) is principally mediated by the sialyltransferase ST6Gal I, which is particularly highly expressed in liver, lactating mammary gland, intestinal epithelia of newborn animals, and B cells. Multiple independent promoters govern the expression of Siat1, the ST6Gal I gene. In liver, elevation of hepatic and serum ST6Gal is part of the acute phase reaction, the hepatic response to systemic trauma, and is governed by the inducible, liver-specific promoter-regulatory region, P1. A constitutive and nontissue-specific promoter, P3, mediates low-level, basal hepatic Siat1 transcription. We generated a mouse specifically unable to use the transcriptional initiation site uniquely used in P1-mediated ST6Gal I expression. These animals, Siat1{Delta}P1, are viable and display reduced ST6Gal I mRNA in liver with concomitantly reduced sialyltransferase activities in liver and in serum. Siat1{Delta}P1 animals are unable to elevate hepatic Siat1 mRNA as part of the inflammatory response induced by turpentine. Surprisingly, serum glycoprotein components exhibit normal extent of sialylation, with no noticeable difference in binding to SNA, the {alpha}2,6-sialyl-specific lectin. Siat1{Delta}P1 animals also exhibit an outwardly normal B cell response. On intraperitoneal challenge with the pathogen Salmonella typhimurium, a significantly greater accumulation of neutrophils within the peritoneal space was observed in Siat1{Delta}P1 animals compared to wild-type mice. Siat1{Delta}P1 mice also exhibit a greater bacterial burden in liver and spleen, accompanied by more pronounced spleno-/hepatomegaly and greater leukocyte infiltration into affected organs than their wild-type counterparts.

Key words: gene expression / immune response / inflammation / sialyltransferase / ST6Gal


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Sialyltransferases mediate the attachment of sialic acids (Sia) from CMP-Sia to glycoproteins and glycolipids. Sialic acids, the terminal residues found in many glycan chains, are key structural determinants for a number of endogenous cell surface receptors, such as the SigLec and selectin families of carbohydrate-recognizing molecules (Nelson et al., 1995Go; Varki, 1997Go; Kelm et al., 1996Go). Sia moieties are also ligands for a diverse array of exogenous lectins, most notably those on invasive pathogens, where binding to host sialyl-determinants is prerequisite to pathogenesis (Varki, 1993Go, 1997Go).

The sialyltransferase ST6Gal I is principally responsible for the synthesis of Sia {alpha}2,6 to Galß1,4GlcNAc (Sia6LacNAc) termini of glycans (Tsuji, 1996Go). A recently identified additional sialyltransferase in humans, ST6Gal II, can also theoretically elaborate the Sia6LacNAc termini (Takashima et al., 2002Go). However, expression of the mouse ST6Gal II is restricted principally to the brain, and, more importantly, no liver expression was observed (F. Piller, personal communication). Furthermore, animals unable to elaborate functional ST6Gal I are essentially devoid of Sia6LacNAc structures (Hennet et al., 1998Go; Manzi et al., 2000Go; Martin et al., 2002Go). Thus ST6Gal I is the dominant Sia6LacNac-synthesizing enzyme in the mouse and the exclusive source of these structures in liver (Manzi et al., 2000Go; Martin et al., 2002Go).

In contrast to ST6Gal II, ST6Gal I and Sia6LacNAc structures have widespread tissue distribution in mammals, but their levels of expression vary, with liver, lactating mammary gland, intestinal epithelia of newborn pups, and activated B cells generally being sources of highest expression (Dalziel et al., 2001Go). Tissue differences in ST6Gal I expression are attributed largely to differential usage of a number of physically distinct promoters controlling the single ST6Gal I gene Siat1 in mouse (Wuensch et al., 2000Go), and this feature is evolutionarily retained in the rat (Svensson et al., 1990Go; Wang et al., 1990Go), human (Wang et al., 1993Go), and bovine (Mercier et al., 1999Go) ST6Gal I genes. In liver, two distinct promoter-regulatory regions, P1 and P3, are operative. P1, whose utilization in adult animals is apparently restricted to liver (Hu et al., 1997Go), is the major contributor to the hepatic ST6Gal I mRNA pool and is operative in the ST6Gal I up-regulation during acute phase response (APR) (Dalziel et al., 1999Go). P3, on the other hand, is constitutively utilized in an apparently tissue-nonspecific manner (Svensson et al., 1990Go). P3 mediates the synthesis of the remainder but significant proportion of hepatic ST6Gal I mRNA. In contrast, development- and stage-specific ST6Gal I expression in B lineage cells is mediated by a different set of physically distinct promoter-regulatory regions, P2a, P2b, P2c, in addition to P3 (Wuensch et al., 2000Go). ST6Gal I expression in lactating mammary gland is mediated by P4 (Dalziel et al., 2001Go).

The intricate nature of ST6Gal I regulation suggests a model for multifaceted contribution of ST6Gal I and Sia6LacNAc that is curiously not supported by the ST6Gal I-deficient mouse, which is reportedly normal except for B cell–related immunodeficiency (Hennet et al., 1998Go). Gagneux and Varki (1999)Go advanced a general explanation that glycan diversity is shaped by exogenous pressures, such as viral and microbial pathogens, and mutant animals, such as the ST6Gal I-null mice, generally thrive symptom-free because of the absence of these exogenous pressures in the specific-pathogen-free environment of vivariums.

The hepatic inflammatory response, or APR, is a cumulative homeostatic process executed in response to tissue injury, trauma, infection, or tumor burden (Baumann and Gauldie, 1994Go). APR prevents ongoing tissue damage, isolates the inflammation to site of injury, and returns the body to stasis. Hepatic ST6Gal I, like other acute phase plasma proteins, is elevated during APR (Kaplan et al., 1984Go; Lammers and Jamieson, 1986Go; Dalziel et al., 1999Go) by cytokine- and glucocorticoid-mediated activation of the P1-associated transcriptional start site (Baumann et al., 1993Go; Dalziel et al., 1999Go). It is commonly thought that elevation of hepatic ST6Gal I is necessary to modify the burst of acute phase plasma proteins, many of which are heavily sialylated. ST6Gal enzymatic activity in serum is also elevated during APR, the source of which is believed to be the liver (Kaplan et al., 1984Go; Lammers and Jamieson, 1986Go; Weinstein et al., 1987Go).

Here, we partially inactivate Siat1, the mouse ST6Gal I gene, by disruption of the liver-specific P1 transcriptional start site to generate the mutant, Siat1{Delta}P1. We show that the B cell response is not disrupted in Siat1{Delta}P1 mice, in contrast to the systemically ablated ST6Gal I-null animals. We test the consequence of P1 disruption on the hepatic APR and on the response to challenge with Salmonella typhimurium, an intracellular bacillus that elicits a well-described repertoire of host responses, including multiple phases of innate, cellular, and humoral immunity (Tagliabue et al., 1985Go; Nencioni et al., 1987Go; Acharya et al., 1987Go; Murphy et al., 1989Go; Forrest et al., 1991Go).


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Mutagenesis of the P1 region of the Siat1 locus by homologous recombination
The Siat1 locus was mutagenized in embryonic stem (ES) cells by homologous recombination as shown in Figure 1. To achieve specific disruption of the transcriptional start site uniquely associated with P1, the 1.2-kb region containing Exon H was chosen for deletion. Exon H encodes 5'-untranslated region sequence that is present only in the P1 class of mRNA whose expression is thought to be restricted to liver (Hu et al., 1997Go). No ST6Gal I coding information is present on Exon H. The deleted 1.2-kb region resides more than 20 kb and 18 kb from the next nearest known transcription initiation sites, those associated with P2a and P2b (see Figure 1). Thus loss of this small segment should disrupt expression mediated by P1 while posing minimal risk of interference with Siat1 expression from other promoter-regulatory regions. RNA blot analysis indicated essentially unchanged levels of ST6Gal mRNA in brain, lung, and kidney using a probe recognizing all ST6Gal mRNA forms (Figure 2). Overall ST6Gal I mRNA in liver is depressed approximately fourfold in mice homozygous for the lesion in P1 (Siat1{Delta}P1). There was also a slight but consistent decrease in ST6Gal I mRNA level in spleen. Liver RNA was differentially probed for ST6Gal I mRNA transcribed from P1 and from the constitutively active P3 using probes recognizing Exon H and Exon Q sequences, respectively. Siat1{Delta}P1 animals expressed no H-containing form, while normal levels of the P3 form were present in the liver (Figure 2).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Mutagenesis of the P1 region of Siat1 by the replacement vector strategy. The top schematic depicts the 5' region of the Siat1 locus with exons as boxed regions. Known transcriptional initiation sites are depicted as arrows. The 20-kb region surrounding Exon H flanked by Eco RV sites (EV) is shown in the enlarged schematic labeled WT. The 1.2-kb region containing Exon H was replaced with Pgk-neo as shown in the mutant allele labeled Mutant. Routine genotype screening by Southern blot analysis of Eco RV digests yields a 20-kb band for WT and a 12-kb band for the mutant allele when probed with an EcoR1/EcoR1 fragment present on the 5'-flank. Inset is a representative Southern blot of a number of animals that are WT (+/+), heterozygous (+/-), or homozygous for the P1 deletion (-/-).

 


View larger version (64K):
[in this window]
[in a new window]
 
Fig. 2. Siat1 expression in P1-ablated animals. (top) Northern blot of RNA from tissues of WT (+/+) and Siat1{Delta}P1 (-/-) mice were probed for ST6Gal I sequences using a probe recognizing the shared coding region sequence (Exons III–VI). Lanes 1–5, respectively, are 20 µg of total RNA from liver, brain, lung, spleen, and kidney. (bottom) Five micrograms polyA+ RNA derived from livers from a pool of three WT (+/+) or Siat1{Delta}P1 (-/-) mice were probed for P1 mRNA using a probe against Exon H or for the P3 mRNA using a probe against Exon Q. Exon III–IV probe is a 791-bp PCR fragment generated using primers mst1ex3S (5'AACTACCATCCGCCTAGTGA) and ms1ex6as (5'GGAGAGGAGGATGGTGTCAG). The Exon H probe is a 163-bp PCR fragment generated using primers md10 (5'CCTTACTCCAGTTCATTCACA) and mst1p8Hu (5' TGAAGTGCCCAGAGTC). The 245-bp Exon Q probe was generated using primers mst1–p7(5'TGCAGCTCTCTCAATCGGG) and mst1–p13 (5'TCATCTGTGCTCCCTCTCTGC). RPLP32 (ribosomal protein RPL 32–27.3.7) was probed using a 295-bp Xba I fragment subcloned into pBSKS+ and served as a loading control. The data shown was obtained from animals in the 129/Svjae background with similar results (not shown) from animals back-crossed >4 generations into the C56BL/6 background.

 
Siat{Delta}P1 homozygotes were outwardly normal in weight and behavior; they were fertile and born at the expected frequency and sex ratio. Histological examination of liver and spleen revealed no outward abnormalities. Hematologic profiles of lymphocytes, monocytes, eosinophils, neutrophils, and erythrocytes in peripheral blood and bone marrow were within normal range. There was no significant difference in the levels of serum IgG or IgM. Resting B cells from spleen of wild-type (WT) and Siat1{Delta}P1 animals exhibited no striking difference in cell surface IgM, Sambucus nigra agglutinin (SNA) reactivity, or CD22 by fluorescence-assisted cell sorting (FACS) analysis (data not shown).

Hepatic acute phase response of Siat1{Delta}P1 animals
The APR was elicited by subcutaneous injection of the sterile irritant turpentine. Hepatic ST6Gal I mRNA response to the inflammatory signal, elevated four- to fivefold in WT animals, was lost in P1-disrupted mice (Figure 3A). However, ablation of the P1 region in Siat1 did not abolish the overall hepatic APR response. There was normal elevation of the well-known APR plasma proteins—{alpha}1-acid glycoprotein, haptoglobin, and serum amyloid A—on the hepatic mRNA level (Figure 3B, 3C, and 3D, respectively). Accumulation of APR plasma proteins in the serum following the inflammatory stimulus was indistinguishable between WT control and Siat1{Delta}P1 animals (data not shown and Figure 4A). The hepatic mRNA level of ST3Gal-III, an {alpha}2,3-sialyltransferase that also acts on the Galß1,4GlcNAc termini as ST6Gal, was unchanged in Siat1{Delta}P1 animals both in the absence or in the presence of inflammatory signal (Figure 3E). Two-dimensional gel analysis following turpentine injection showed no difference in isoelectric distribution of plasma proteins, which is consistent with unaltered degree of Sia modification (Figure 4A). SNA lectin blot analysis of plasma glycoproteins during APR also revealed no difference in degree of {alpha}2,6-linked Sia modification (Figure 4B).



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 3. Induction of acute phase protein mRNAs in Siat1{Delta}P1 animals by turpentine. Northern blot of RNA from tissues of WT (+/+) and Siat1{Delta}P1 (-/-) mice were probed for (A) ST6Gal I mRNA using a coding region probe, (B) {alpha}1-acid-glycoprotein mRNA, (C) haptoglobin mRNA, (D) serum amyloid A mRNA, and (E) ST3Gal-III mRNA. (F) Loading control for the northern blot was a probe for the ribosomal protein RLP32 (see Figure 2 legend). In each case, pairs of WT or Siat1{Delta}P1 animals were either control injected with saline or injected with 100 µL turpentine subcutaneously. RNA was harvested 48 h postinjection. The ST6Gal I coding region probe was a 750-bp PstI fragment from Exon II subcloned into pCRII vector. The data shown was obtained from animals in the 129/Svjae background with similar results (not shown) from animals back-crossed >4 generations into the C56BL/6 background.

 


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 4. Expression of acute phase plasma proteins in Siat1{Delta}P1 animals. (A) Serum was harvested from WT (+/+) and Siat1{Delta}P1 (-/-) mice 48 h postsubcutaneous injection of turpentine. One microliter was subjected to 2D gel analysis for SDS–PAGE (vertical dimension) and isoelectric focusing (horizontal dimension). Prominently labeled points are: hemopexin (hm), haptoglobin (hp), and {alpha}1-acid-glycoprotein (agp). (B) Western blot of serum proteins (25 µg) from WT (+/+) and Siat1{Delta}P1 (-/-) mice 48 h after turpentine injection was probed for {alpha}2,6-linked sialic acids by biotinylated SNA. Sera from four WT and four Siat1{Delta}P1 animals are shown.

 
Disruption of the P1 region of Siat1 resulted in a two- to threefold decrease in serum sialyltransferase activity as measured using Galß4GlcNAc{alpha}-o-benzyl (Bn) as the exogenously supplied acceptor (Figure 5A). Turpentine-elicited inflammatory response results in a 3.4-fold elevation of serum sialyltransferase activity in WT animals (Figure 5B). Interestingly, a similar degree of elevation, at 3.2-fold, was seen in the Siat1{Delta}P1 animals.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Expression of ST6Gal sialyltransferase activity in Siat1{Delta}P1 mice. Serum was harvested from four WT (+/+) and four Siat1{Delta}P1 (-/-) animals 2 weeks before (A) or 48 h after subcutaneous injection of turpentine (B) and tested for sialyltransferase activity using CMP-[3H]NeuAc and Galß4GlcNAc{alpha}-o-Bn as an acceptor as described in Materials and methods. The data shown was obtained from animals in the 129/Svjae background with similar results (not shown) from animals back-crossed >4 generations into the C56BL/6 background.

 
Galß4GlcNAc{alpha}-o-Bn can theoretically accept sialyl substitution to Gal in {alpha}2,6- or {alpha}2,3-linkage by ST6Gal or ST3Gal III sialyltransferases, respectively (Tsuji, 1996Go) However, the contribution of {alpha}2,3-sialyl substitution is less than 10% as assessed by SNA-agarose column chromatography (data not shown) and consistent with previous studies (Pousset et al., 1997Go). Hepatic {alpha}2,6-sialyltransferase activities are also concomitantly lowered in liver homogenates of Siat1{Delta}P1 animals (data not shown).

Humoral response of Siat1{Delta}P1 animals
In contrast to those in the ST6Gal I-null animal (Hennet et al., 1998Go), resting B cells isolated from the Siat1{Delta}P1 mouse showed no discernible difference with WT mouse in terms of surface IgM or SNA reactivity (not shown). To evaluate the humoral immune response capabilities of the Siat1{Delta}P1 mouse, we challenged the animals with the hapten NP [(4-hydroxy-3-nitrophenyl)acetyl] complexed to chicken {gamma}-globulin that generates a well-characterized B cell response (Jacob et al., 1991Go; Jacob and Kelsoe, 1992Go; Takahashi et al., 1998Go) measurable by enzyme-linked immunosorbent assay (ELISA) or by the expression of the {lambda} Ig light chain that is rarely used in the C57BL/6 mouse and allows visualization of the B cells arising specifically in response to the NP challenge (Jacob et al., 1991Go; Jacob and Kelsoe, 1992Go).

On challenge with NP, Siat1{Delta}P1 mice were identical to C57BL/6 WT mice in the kinetics and magnitude of production of anti-NP antibodies of the IgM, IgG1, and IgG3 isotypes as measured by ELISA over a course of 40 days (Figure 6A–C, respectively). Moreover, the development of NP-specific (using {lambda} chain Ig light chain as marker) and peanut agglutinin–reactive germinal centers in the spleen were identical between the Siat1{Delta}P1 and WT animals on challenge with NP (not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6. Antibody production following immunization of Siat1{Delta}P1 and WT C57BL/6 mice. Anti-NP antibody levels of the IgM (A), IgG1 (B), and IgG3 (C) isotypes were measured by ELISA as described in Materials and methods. Anti-NP antibody levels were measured before and subsequent to a second boost immunization (arrows). Absorption units are shown at 410 nm as a function of days after initial immunization. Multiple dilutions of sera were assayed to find the linear range of response by OD410 measurements (not shown). Sera dilution factors for results reported are: IgM 1/100, IgG1 1/400, and IgG3 1/100. Data for WT (triangles) presented as the mean ± SD from four mice. Data for Siat1{Delta}P1 animals (squares) shown are the mean ± SD. The numbers of mice varied, with days 3, 10, and 14 (N = 3); days 36 and 41 (N = 5); saline control (N = 6); day 7 (N = 8). The Siat1{Delta}P1 mice, homozygous for the P1 lesion, were back-crossed to C57BL/6 for 10 successive generations.

 
Response of Siat1{Delta}P1 animals to intraperitoneal inoculation of Salmonella
The response repertoire of the Siat1{Delta}P1 mouse against infection with a doubly attenuated strain of S. typhimurium, BRD509, which contains mutations in the aroA and aroD genes, was tested. Siat1{Delta}P1 animals generally exhibited an elevated bacterial burden in liver and spleen by 3–6 days after inoculation with S. typhimurium, as shown in Figure 7, which compares the bacterial burden of three Siat1{Delta}P1 animals against three WT animals. Intraperitoneal introduction of 0.5 x 106 colony-forming units (CFU) S. typhimurium generated a 14-fold (p = 0.005) and 7-fold (p = 0.039) greater bacterial burden in the liver and spleen, respectively, of the Siat1{Delta}P1 animals than in WT mice 6 days after inoculation (Figure 7A and 7B). Animals inoculated with 12.5 x 106 CFU resulted in 500-fold greater bacterial burden than those challenged with 0.5 x 106 CFU, but the difference between Siat1{Delta}P1 and WT animals diminishes. At 12.5 x 106 CFU IP, 100% morbidity was observed within 8 days (sample size: six WT and six Siat1{Delta}P1). In contrast, animals receiving the lower dosages (e.g., 0.5 x 106 CFU) generally remain viable and appear healthy for up to 2 weeks (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7. Bacterial burden of liver and spleen during S. typhimurium infection. WT (open bars) or Siat1{Delta}P1 (hatched bars) mice were infected intraperitoneally with 5 x 105 (Panels A and B) or 1.25 x 107 (Panels C and D) CFU of Salmonella typhimurium BRD509. Six days postinfection, livers (Panels A and C) and spleens (Panels B and D) were harvested and organ homogenates were analyzed for bacterial burden. Units on the y-axis represent bacterial burden expressed as CFU recovered from an individual animal. Animals used were in the C57BL/6 background (see Materials and methods).

 
Siat1{Delta}P1 animals also tend to exhibit a greater degree of spleno- and hepatomegaly than their WT counterparts. Summarized in Table I are animals receiving the high dosage (12.5 x 106 CFU) salmonella after 3 or 6 days with organ sizes expressed as a percentage of total body weight and statistically meaningful differences in spleno-/hepatomegaly at day 6.


View this table:
[in this window]
[in a new window]
 
Table I. Greater spleno-/hepatomegaly in Siat{Delta}P1 mice infected with 12.5 x 106 CFU S. typhimurium

 
Although the splenic and liver leukocyte counts amongst individual animals vary widely, the leukocyte numbers within liver and spleen are generally higher in infected Siat1{Delta}P1 animals than their WT counterparts. In animals infected with an IP bolus of 0.5 x 106 CFU of Salmonella, liver leukocytes are 2.1-fold (p = 0.025) higher in the mutant animals compared to WT controls. Splenic leukocytes are similarly higher in the mutant animals (1.7-fold; p = 0.019). This is summarized in Table II. However, flow cytometric analysis of leukocyte subsets revealed no notable difference in the proportions of B cells (CD22+ cells), CD4+ T cells (TCR+/CD4+ cells), CD8+ T cells (TCR+/CD8+ cells), NK cells (NK1.1+ cells), or NKT cells (TCR+/NK1.1+ cells) in either the livers or the spleens of Siat1{Delta}P1 mice and WT cohorts within the time frame of these experiments (i.e., 3 and 6 days after bacteria inoculation) (data not shown).


View this table:
[in this window]
[in a new window]
 
Table II. Accumulation of leukocytes in the livers and spleens of mice infected with 500,000 CFU S. typhimurium

 
The greatest difference was observed in the leukocyte population of the peritoneal space 18 h after inoculation with bacteria. Although numbers of total peritoneal leukocytes are the same between uninfected WT and mutant animals, infection resulted in 1.8-fold elevation of peritoneal leukocytes in WT but a 3.5-fold elevation in Siat1{Delta}P1 animals. This enhanced accumulation results in greater than twofold more leukocytes (p = 0.0206) in the peritoneal space of the Siat1{Delta}P1 animals than WT animals within 18 h of infection (Figure 8A).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 8. Peritoneal infiltration of neutrophils in Siat1{Delta}P1 mice. Peritoneal exudate cells were harvested from uninfected mice or animals 18 h after infection with 5 x 105 CFU of S. typhimurium. Shown are WT (open bars) or Siat1{Delta}P1 (hatched bars) mice. Total viable cells were enumerated (A) and subjected to flow cytometric analysis to determine the number of Gr-1+ cells present in the peritoneum (B) and the proportion of peritoneal leukocytes that are Gr-1hi (C). Animals used were in the C57BL/6 background (see Materials and methods).

 
In uninfected animals (both WT and Siat1{Delta}P1), approximately 20% of the total peritoneal leukocytes are Gr-1+ cells, which represent mature neutrophils and neutrophil precursor populations (Hestdal et al., 1991Go) with mature neutrophils (Gr-1hi) representing less than 2% of the total peritoneal population. Figure 8B shows that Salmonella challenge resulted in 3.4-fold greater accumulation of peritoneal Gr-1+ cells (p = 0.0052), with Gr-1+ cells representing 86% of the peritoneal population in the mutant animals but only 58% in WT cohorts. Moreover, the proportion of peritoneal cells that are mature neutrophils (Gr-1hi) was significantly greater in infected Siat1{Delta}P1 than in the WT counterparts (p = 0.0004), with Gr-1hi cells representing 38.3% and 15.5% of the total peritoneal population, respectively (Figure 8C). Total Gr-1hi cells are elevated fivefold in infected Siat1{Delta}P1, with 3.5 x 106 cells/animal compared with 0.7 x 106 cells/animal in WT mice.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Although the requirement for appropriate {alpha}2,6-sialylation for B cell development and function has been clearly demonstrated by the systemic ST6Gal I-null animal (Hennet et al., 1998Go), the relevance of ST6Gal I expression in other compartments is not clear. Animals homozygous for a lesion in the P1 region of Siat1 exhibited a partial and localized disruption to ST6Gal I expression resulting from the inability to express ST6Gal I using the transcriptional initiation site uniquely associated with the inducible P1 promoter-regulatory region. The Siat1{Delta}P1 mouse clearly exhibits functionally intact B cell response, at least in response to challenge with hapten NP, and demonstrates that the P1 promoter is not critical for generating the ST6Gal I activity necessary for humoral immune responses.

It has often been remarked, albeit without clear substantiation, that liver is the source of the soluble serum ST6Gal activity whereby the catalytic domain of the normally membrane-bound enzyme is proteolytically released and secreted (Kaplan et al., 1983Go; Weinstein et al., 1987Go; Richardson and Jamieson, 1995Go). The Siat1{Delta}P1 animal provides the first definitive evidence that liver is the major source of serum ST6Gal enzyme. P1 and its unique transcription initiation site is the predominant promoter-regulatory region governing ST6Gal I expression in liver, and disruption of P1 resulted in serum ST6Gal enzymatic activity that was 2.5-fold lower than WT levels (see Figure 5).

WT mice undergoing APR exhibited elevated serum ST6Gal activity by three- to fourfold. Quite unexpectedly, a three- to fourfold increase was also observed in Siat1{Delta}P1 mice following APR induction by turpentine. This observation is consistent with the idea that at least two independent mechanisms are responsible for the elevated serum ST6Gal activity during APR. Between the two mechanisms, increased hepatic transcription of Siat1 mediated by P1 and enhanced proteolytic release of existing enzyme, only the former is abrogated by P1 mutagenesis.

The constitutive P3 remains functional in Siat1{Delta}P1 animals and likely contributes significantly to the residual serum ST6Gal activity. Alternatively, although liver is the dominant source of serum ST6Gal activity under normal physiologic conditions, it is quite possible that other tissues contribute to the elevation of ST6Gal during APR. Indeed it has been demonstrated that rat small intestine ST6Gal activity is elevated in response to the APR (Hutton et al., 1987Go; Ch et al., 1988Go). Serum ST6Gal activity may also be derived from a newly identified second {alpha}2,6-sialyltransferase, ST6Gal II, encoded on a gene distinct from Siat1 (mouse chromosomes 17 and 16, respectively, as detailed in the mouse genome database, Wellcome Trust Sanger Institute, Ensembl ID ENSMUG00000024172 and Ensembl ID ENSMUG00000022885, respectively). However, ST6Gal II is both highly tissue-specific (brain) and weakly expressed (F. Piller, personal communication).

Elevation of hepatic ST6Gal activity during APR has often been viewed as a simple response to the increased need for sialylation of APR plasma proteins, many of which are heavily {alpha}2,6-sialylated. However, APR plasma protein isoelectric profiles of Siat1{Delta}P1 animals are indistinguishable from WT animals, suggesting a normal extent of sialic acid substitution. Siat1{Delta}P1 serum APR proteins also exhibit normal SNA binding, which reflects the degree of {alpha}2,6-sialyl substitution. Although these rudimentary approaches cannot visualize subtle alterations in glycan structures, these observations nevertheless indicate that P1 is unnecessary for adequate sialylation of plasma proteins during APR. The minimal level of hepatic ST6Gal I mRNA maintained in the absence of functional P1 is apparently sufficient for sialylation of APR plasma proteins.

If ST6Gal I induction is not needed to address the demand to sialylate serum APR proteins, what then is the physiologic value of P1-mediated Siat1 transcription? Gagneux and Varki (1999)Go suggested that the endogenous function(s) of ST6Gal I may be restricted to B cells and that ST6Gal I expression at other locations serves to interfere with invading pathogens, many of which bind preferentially to {alpha}2,3-sialyl structures (Karlsson, 1995Go).

The significance of soluble ST6Gal activity in systemic circulation and its elevation as part of the inflammatory response remain unclear, although it is unlikely that the enzyme would function in the circulation due to the lack of CMP-Sia (Kaplan et al., 1983Go). In keeping with the view that APR functions to limit the inflammatory response to the site of injury, there is the possibility that ST6Gal is delivered through the circulation and used at distal sites (the site of injury, for instance).

S. typhimurium infection elicits a well-described repertoire of host responses, including all phases of innate, cellular, and humoral immunity, that is an ideal readout to assess the impact of glycosylation in multiple phases of the host immune response. We have demonstrated that the humoral compartment, which is important for the eventual resolution of the infection, is intact in Siat1{Delta}P1 animals, unlike the systemic ST6Gal I-null animal (Hennet et al., 1998Go). Thus any altered immune response in Siat1{Delta}P1 animals toward S. typhimurium is unlikely to be mediated through defects in the B cell compartment.

The most pronounced observed consequence of P1 disruption is a greater than twofold elevated infiltration of leukocytes into the peritoneal space within 18 h of IP challenge with S. typhimurium (see Figure 8). The major component of this infiltrate is granulocytes because 86% of the total peritoneal leukocytes are Gr-1+ in the Siat1{Delta}P1 animals, with the remainder consisting of macrophages (Mac-1+/Gr-1), NK (NK1.1+), T (TCRß+), and B (B220+) cells (data not shown). This is followed by generally greater spleno-/hepatomegaly and by greater leukocyte infiltration into spleen and liver by 3 and 6 days after S. typhimurium inoculation. Together, these observations suggest altered leukocyte trafficking patterns as a consequence of P1 disruption, although the mechanistic basis of ST6Gal I contribution to leukocyte functionality outside the B cell compartment remains to be elucidated. One additional observed phenotype is the generally greater bacterial burden suffered in the liver and spleen of the Siat1{Delta}P1 animals (see Figure 7). The greater bacterial burden appears counterintuitive because it is more reasonable to predict that elevated leukocyte trafficking would be counterproductive to bacterial invasion and expansion.

Further work is necessary to determine whether or not the altered leukocyte infiltration is limited to the granulocyte subset and to define the mechanistic rationale of this phenotype. In addition to granulocytes themselves, the phenotype may be present in vascular endothelial cells, or some other cell type involved in leukocyte trafficking to the peritoneum. Presently, it is not clear how altered expression of Siat1 in the liver can contribute to altered granulocytic migration into the peritoneal cavity in response to bacterial challenge.

The Galß1,4GlcNAc-R structure utilized by ST6Gal I is also a precursor for the elaboration of a number of structures such as polylactosamines and sialyl-Lewis x with physiologic relevance to leukocyte migration and targeting. Changes in ST6Gal I activity can theoretically alter the pool of Galß1,4GlcNAc structures available for the synthesis of these other structures. However, the bulk of the Lewis and polylactosamine structures occur on the GlcNAcß6-Man{alpha}6-Man branch of the N-glycan tetra-antennary chain that is not preferred by the ST6Gal I (Joziasse et al., 1987Go). Moreover {alpha}2,6-sialylation of Galß1,4GlcNAc-R structures on O-linked glycans are rarely reported.

In keeping with a model for multifaceted contribution of ST6Gal I, and given the widespread tissue distribution of this sialyltransferase, it is also possible that multiple sites are impacted by abrogation of P1, leading to the diverse and apparently counterintuitive phenotypes. Finally, although P1 has long been recognized as a hepatic-specific regulator of Siat1 transcription, this belief is based principally on RNA surveys of complete organs. There is the possibility that the P1 is utilized in some nonhepatic cell type(s) or in a developmentally specific manner that is not amenable to detection by gross tissue RNA surveys. P1 ablation may lead to disruption of Siat1 expression in a nonhepatic cell subset that may ultimately impact different phases of the host repertoire against pathogenic challenge.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Gene targeting of Siat1 P1 region
A genomic clone isolated from a library with DNA from a 129/Svjae mouse (Hu et al., 1997Go) containing the Exon H region of Siat1 was used to excise the 2.6-kb XbaIXbaI fragment and 1.2-kb Xba1Xba1 fragment normally surrounding the 1.2-kb Siat1 genomic region, which contains Exon H. The replacement targeting vector was generated by inserting the 2.6-kb and 1.2-kb fragments upstream and downstream, respectively, of the cassette with mouse Pgk promoter regulating neomycin phosphotransferase and terminating with Pgk polyadenylation site. The targeting vector was linearized with NsiI and electroporated into ES cells derived from 129/Svjae. Two ES clones bearing the Siat1{Delta}P1 allele were used to generate chimeric mice in C57BL/6 host embryos. The P1({Delta}) allele was either bred into the 129/Svjae or C57BL/6 background by back-crossing to the appropriate WT mates for at least 2 (129/Svjae) or 10 (C57BL/6) generations. Routine genotype analysis was done by Southern blotting of EcoRV digests and probing with the EcoR1–EcoR1 probe, as shown in Figure 1. Taking advantage of the EcoRV site in neo, the mutant allele is visualized as a 12-kb signal that is clearly distinguishable from the 20-kb signal from the WT allele. Unless otherwise stated, data in this report were obtained from 129/Svjae animals. Acute phase response observations were also reproduced in mutant C57BL/6 animals but are not shown. Salmonella infections were performed on animals in the C57BL/6 background.

APR assays
Routinely, the APR was induced by subcutaneous injection of turpentine (100 µl) into the hind-leg region of Siat1{Delta}P1 or WT 129/Svjae. Serum was collected by tail bleeding at 2 weeks before and 48 h after turpentine (or saline) injection. Animals were sacrificed 48 h post–turpentine treatment, and livers were collected and snap-frozen in liquid N2.

For western blot analysis, serum aliquots (25 µl) were separated on 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and subjected to SNA analysis. Blots were blocked in 5% nonfat dry milk and 0.1% Tween 20 for at least 1 h at room temperature or overnight at 4°C. For detection of {alpha}2,6-linked sialic acids, the blots were probed with biotinylated-SNA (5 µg/ml, Vector Laboratories, Burlingame, CA) and then incubated with streptavidin–horseradish peroxidase (1:2000 dilution) and visualized with enhanced chemiluminescence reagent (Amersham, Little Chalfont, UK). Two dimensional gel analysis was performed using Mini-Protean II 2-D gel system (BioRad, Hercules, CA). Typically 1 µl of serum was used. The isoelectric focusing dimension contained 1.6% BioLyte 5/7, 0.4% BioLyte 3/10, and 0.8% BioLyte 3/5 ampholytes.

Sialyltransferase assays
Sialyltransferase assays were carried out under incubation conditions as described (Chandrasekaran et al., 1995Go). For measurement of sialyltransferase activity, 10 µl of serum from Siat1{Delta}P1 or WT 129/Svjae were incubated with CMP-3[H]NeuNAc and monitored for the transfer of 3[H] NeuNAc to the exogenously supplied acceptor compound, Galß4GlcNA{alpha}-o-Bn. NeuNAc transferred from CMP-3[H]NeuNAc was measured after recovery and separation of acceptor and 3[H]-sialylated acceptor compounds from unreacted CMP-3[H]NeuNAc and free 3[H]NeuNAc by C18-reverse phase chromatography (Ujita et al., 1998Go). 3[H] NeuNAc-labeled acceptor was quantified by scintillation counting. To avoid misleading results due to substrate depletion, the amount of CMP-3[H] NeuNAc conversion was kept below 5% at the termination of the reactions.

Measurement of B cell response
Antigen preparation and immunization were performed as described by Jacob et al. (1991)Go. NP-chicken gamma globulin (NP22-CGG, Biosearch Technologies, Novato, CA) was precipitated in alum (NP-CG/alum). Groups of C57BL/6 and Siat1{Delta}P1 mice were immunized with a single IP injection (50 mg in a volume of 200 {alpha}L) NP-CG/alum. Control groups (day 0) were injected with 200 µL saline. For this experiment, 2–3-month-old male and female C57BL/6 mice and Siat1{Delta}P1 animals, back-crossed 10 successive generations to C57BL/6 background, were used.

ELISA assays of serum IgM, IgG1, and IgG3 were performed as follows. MaxiSorp Nunc-Immuno plates were coated with 50 µg/ml of NP bovine serum albumin (NP23-BSA, from Biosearch Technologies) in 0.1 M carbonate buffer, pH 9.0, at 4°C overnight and blocked with 0.5% BSA in carbonate buffer (Takahashi et al., 1998Go). Sera collected at indicated times and diluted to various concentrations were plated on NP23-BSA-coated plates at room temperature for 2 h. After washing with phosphate buffered saline (PBS) containing 0.1% Tween 20, sera was analyzed using anti-mouse isotype-specific antibodies, IgM, IgG1, or IgG3, conjugated to alkaline phosphatase (SBA Clonotyping System/AP from Southern Biotechnology Associates, Birmingham, AL). Alkaline phosphatase activity was visualized using SigmaFast p-nitrophenyl phosphate (Sigma, St. Louis, MO), and optical density values were obtained using a microplate reader.

S. typhimurium infections
A doubly attenuated strain of S. typhimurium, BRD509, which contains mutations in the aroA and aroD genes (Hoiseth and Stocker, 1981Go; Strugnell et al., 1992Go) was used. Siat1{Delta}P1, back-crossed 10 successive generations to C57BL/6 background, and age/sex-matched WT C57BL/6 cohorts (typically 10–12-week-old females) were infected with varying doses (ranging from 400,000 to 12,500,000 CFU) by IP injection. Typically three to five animals of the Siat1{Delta}P1 strain and a similar number of WT control animals were used for each experimental point.

Overnight cultures of S. typhimurium BRD509 were washed in PBS, and IP was injected into mice without the use of anesthesia. The number of S. typhimurium in an inoculum was estimated by absorbance at 600 nm. Actual infective S. typhimurium doses were verified by culturing an aliquot of the inoculum overnight on MacConkey agar plates.

At time points indicated, the animals were sacrificed by CO2 asphyxiation. Peritoneal exudate cells were harvested in ice-cold RPMI 1640 (Gibco, Grand Island, NY). Livers and spleens were dounce homogenized and passed through a 100-µm filter, and erythrocytes were hypotonically lysed. Liver homogenates were further processed by differential centrifugation through a Lympholyte M cushion (Accurate Chemical, Westbury, NY) to remove hepatocytes. Viable leukocytes from liver, spleen, and peritoneum were enumerated with a hemocytometer by Trypan blue exclusion. Immunofluorescent staining and flow cytometric analysis of leukocyte subsets were performed as follows. Cells (0.5–1 x 106) were washed in PBS containing 0.5% BSA and 0.02% sodium azide (PAB). Fc receptor sites were blocked by incubation with goat serum (1:10, Gibco) and anti-CD16/32 (Fc{gamma} III/II Receptor) Fc Block (Pharmingen, San Diego, CA). Samples were then incubated with combinations of fluorescently labeled antibodies recognizing B cells (B220), T cells (TCRß), NK cells (NK1.1), neutrophils (Gr-1), and CD11b (Mac-1); washed with PAB; and fixed in 1% formaldehyde. Flow cytometric analysis was performed using a FACScan flow cytometer (Becton-Dickinson Immunocytometry Systems, Franklin Lakes, NJ) and the CellQuest software package. The total bacterial burden, including both extracellular S. typhimurium and bacteria located within host cells, was determined by lysing serially diluted eukaryotic cells in sterile water. The bacteria were then cultured overnight on MacConkey agar plates, and the resultant colonies were counted. Statistical analysis of bacterial burden and leukocyte numbers and populations was performed using unpaired t-test with a significance cutoff of p = 0.05.


    Acknowledgements
 
This work was supported by grants GM38193 (J.T.Y.L.) and CA35329 (K.L.M.). This research utilized core facilities supported in part by RPCI's NCI-funded Cancer Center Support Grant CA16056. The assistance and efforts of Ms. Helen Mahler and Mr. Andrew Gross are gratefully acknowledged.


    Footnotes
 
1 Present address: Centre de Biophysique Moleculaire, Rue Charlee Sadron (Bat B), 45071 Orleans, Cedex 07 France. Back

2 Present address: Dept of Cell Biology, Second Military Medical University, 800 Xiang Yin Road, Shanghai 200433, China. Back

3 Present address: Division of Nutritional Sciences, Cornell University, 108 Savage Hall, Ithaca, NY 14853. Back

4 Present address: Davis H. Smith Center for Vaccine Biology and Immunology, University of Rochester, Rochester, NY 14642. Back

5 To whom correspondence should be addressed; e-mail: joseph.lau{at}roswellpark.org Back


    Abbreviations
 
APR, acute phase response; Bn, benzyl; BSA, bovine serum albumin; CFU, colony-forming units; ELISA, enzyme-linked immunosorbent assay; ES, embryonic stem; FACS, fluorescence-assisted cell sorting; NP, (4-hydroxy-3-nitrophenyl)acetyl; PBS, phosphate buffered saline; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; SNA, Sambucus nigra agglutinin; WT, wild-type


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Acharya, I.L., Lowe, C.U., Thapa, R., Gurubacharya, V.L., Shrestha, M.B., Cadoz, M., Schulz, D., Armand, J., Bryla, D.A., and Trollfors, B. (1987) Prevention of typhoid fever in Nepal with the Vi capsular polysaccharide of Salmonella typhi. A preliminary report. N. Engl. J. Med., 317, 1101–1104.[Abstract]

Baumann, H. and Gauldie, J. (1994) The acute phase response. Immunol. Today, 15, 74–80.[CrossRef][ISI][Medline]

Baumann, H., Morella, K.K., and Campos, S.P. (1993) Interleukin-6 signal communication to the alpha-1-acid glycoprotein gene, but not junB gene, is impaired in HTC cells. J. Biol. Chem., 268, 10495–10500.[Abstract/Free Full Text]

Ch, S.W., Carter, E.A., Tompkins, R.G., and Burke, J.F. (1988) Increase of sialyltransferase activity in the small intestine following thermal injury in rats. Biochem. Biophys. Res. Commun., 153, 377–381.[CrossRef][ISI][Medline]

Chandrasekaran, E.V., Jain, R.K., Larsen, R.D., Wlasichuk, K., and Matta, K.L. (1995) Selectin ligands and tumor-associated carbohydrate structures: specificities of alpha 2,3-sialyltransferases in the assembly of 3'-sialyl-6-sialyl/sulfo Lewis a and x, 3'-sialyl-6'-sulfo Lewis x, and 3'-sialyl-6-sialyl/sulfo blood group T-hapten. Biochemistry, 34, 2925–2936.[CrossRef][Medline]

Dalziel, M., Lemaire, S., Ewing, J., Kobayashi, L., and Lau, J.T.Y. (1999) Hepatic acute phase induction of murine beta-galactoside alpha2,6 sialyltransferase (ST6Gal-1) is IL-6 dependent and mediated by elevation of Exon H-containing class of transcripts. Glycobiology, 9, 1003–1008.[Abstract/Free Full Text]

Dalziel, M., Huang, R.-A., Dall'Olio, F., Morris, J.R., Taylor-Papadimitriou, J., and Lau, J.T.Y. (2001) Mouse ST6Gal sialyltransferase gene expression during mammary gland lactation. Glycobiology, 11, 407–412.[Abstract/Free Full Text]

Forrest, B.D., LaBrooy, J.T., Beyer, L., Dearlove, C.E., and Shearman, D.J. (1991) The human humoral immune response to Salmonella typhi Ty21a. J. Infect. Dis., 163, 336–345.[ISI][Medline]

Gagneux, P. and Varki, A. (1999) Evolutionary considerations in relating oligosaccharide diversity to biological function. Glycobiology, 9, 747–755.[Abstract/Free Full Text]

Hennet, T., Chui, D., Paulson, J.C., and Marth, J.D. (1998). Immune regulation by the ST6Gal sialyltransferase. Proc. Natl Acad. Sci. USA, 95, 4504–4509.[Abstract/Free Full Text]

Hestdal, K., Ruscetti, F.W., Ihle, J.N., Jacobsen, S.E., Dubois, C.M., Kopp, W.C., Longo, D.L., and Keller, J.R. (1991) Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J. Immunol., 147, 22–28.[Abstract]

Hoiseth, S.K. and Stocker, B.A. (1981) Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature, 291, 238–239.[CrossRef][Medline]

Hu, Y.P., Dalziel, M., and Lau, J.T.Y. (1997) Murine hepatic beta-galactoside alpha 2,6-sialyltransferase gene expression involves usage of a novel upstream exon region. Glycoconj. J., 14, 407–411.[CrossRef][ISI][Medline]

Hutton, C.W., Corfield, A.P., Clamp, J.R., and Dieppe, P.A. (1987) The gut in the acute phase response: changes in colonic and hepatic enzyme activity in response to dermal inflammation in the rat. Clin. Sci., 73, 165–169.[Medline]

Jacob, J. and Kelsoe, G. (1992) In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers. J. Exp. Med., 176, 679–687.[Abstract/Free Full Text]

Jacob, J., Kassir, R., and Kelsoe, G. (1991) In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl I. The architecture and dynamics of responding cell populations. J. Exp. Med., 173, 1165–1175.[Abstract/Free Full Text]

Joziasse, D.H., Schiphorst, W.E., Van den Eijnden, D.H., Van Kuik, J.A., Van, Halbeek, H., and Vliegenthart, J.F. (1987) Branch specificity of bovine colostrum CMP-sialic acid: Gal beta 1—4GlcNAc-R alpha 2—6-sialyltransferase. Sialylation of bi-, tri-, and tetraantennary oligosaccharides and glycopeptides of the N-acetyllactosamine type. J. Biol. Chem., 262, 2025–2033.[Abstract/Free Full Text]

Kaplan, H.A., Woloski, B.M.R.N.J., Hellman, M., and Jamieson, J.C. (1983) Studies on the effect of inflammation on rat liver and serum sialyltransferase: evidence that inflammation causes release of Gal ß1-4 GlcNAc {alpha}2-6 sialyltransferase from liver. J. Biol. Chem., 258, 11505–11509.[Abstract/Free Full Text]

Kaplan, H.A., Woloski, B.M., and Jamieson, J.C. (1984) Studies of the effect of experimental inflammation on rat liver nucleotide sugar pools. Comp. Biochem. Physiol., 77, 207–212.[CrossRef]

Karlsson, K.A. (1995) Microbial recognition of target-cell glycoconjugates. Curr. Opin. Struct. Biol., 5, 622–635.[CrossRef][ISI][Medline]

Kelm, S., Schauer, R., and Crocker, P.R. (1996) The sialoadhesins—a family of sialic acid-dependent cellular recognition molecules within the immunoglobulin superfamily. Glycoconj. J., 13, 913–926.[CrossRef][ISI][Medline]

Lammers, G. and Jamieson, J.C. (1986) Studies on the effect of experimental inflammation on sialyltransferase in the mouse and guinea pig. Comp. Biochem. Physiol. B., 84, 181–187.[CrossRef][Medline]

Manzi, A.E., Norgard-Sumnicht, K., Argade, S., Marth, J.D., van Halbeek, H., and Varki, A. (2000) Exploring the glycan repertoire of genetically modified mice by isolation and profiling of the major glycan classes and nano-NMR analysis of glycan mixtures. Glycobiology, 10, 669–689.[Abstract/Free Full Text]

Martin, L.T., Marth, J.D., Varki, A., and Varki, N.M. (2002) Genetically altered mice with different sialyltransferase deficiencies show tissue-specific alterations in sialylation and sialic acid 9-O-acetylation. J. Biol. Chem., 277, 32930–32938.[Abstract/Free Full Text]

Mercier, D., Wierinckx, A., Oulmouden, A., Gallet, P.F., Palcic, M.M., Harduin-Lepers, A., Delannoy, P., Petit, J.-M., Leveziel, H., and Julien, R. (1999) Molecular cloning, expression and exon/intron organization of the bovine ß-galactoside {alpha}2,6-sialyltransferase. Glycobiology, 9, 851–863.[Abstract/Free Full Text]

Murphy, J.R., Wasserman, S.S., Baqar, S., Schlesinger, L., Ferreccio, C., Lindberg, A.A., and Levine, M.M. (1989) Immunity to Salmonella typhi: considerations relevant to measurement of cellular immunity in typhoid-endemic regions. Clin. Exp. Immunol., 75, 228–233.[ISI][Medline]

Nelson, R.M., Venot, A., Bevilacqua, M.P., Linhardt, R.J., and Stamenkovic, I. (1995) Carbohydrate-protein interactions in vascular biology. Annu. Rev. Cell Dev. Biol., 11, 601–631.[CrossRef][ISI][Medline]

Nencioni, L., Villa, L., De Magistris, M.T., Romano, M., Boraschi, D., and Tagliabue, A. (1987) Cellular immunity against Salmonella typhi after live oral vaccine. Adv. Exp. Med. Biol., 216B, 1669–1675.[Medline]

Pousset, D., Piller, V., Bureaud, N., Monsigny, M., and Piller, F. (1997) Increased alpha2,6 sialylation of N-glycans in a transgenic mouse model of hepatocellular carcinoma. Cancer Res., 57, 4249–4256.[Abstract/Free Full Text]

Richardson, K. and Jamieson, J.C. (1995) Release of sialyltransferases from rat liver Golgi membranes by a cathepsin D-like proteinase: comparison of the release of Gal beta 1-4GlcNAc alpha 2-6 sialyltransferase, Gal beta 1-3(4)GlcNAc alpha 2-3 sialyltransferase and lactosylceramide alpha 2-3 sialyltransferase (SAT-1). Comp. Biochem. Physiol. B., 110, 445–450.[CrossRef][Medline]

Strugnell, R., Dougan, G., Chatfield, S., Charles, I., Fairweather, N., Tite, J., Li, J.L., Beesley, J., and Roberts, M. (1992) Characterization of a Salmonella typhimurium aro vaccine strain expressing the P.69 antigen of Bordetella pertussis. Infect. Immun., 60, 3994–4002.[Abstract/Free Full Text]

Svensson, E.C., Soreghan, B., and Paulson, J.C. (1990) Organization of the ß-galactoside {alpha}2,6-sialyltransferase gene: evidence for the transcriptional regulation of terminal glycosylation. J. Biol. Chem., 265, 20863–20868.[Abstract/Free Full Text]

Tagliabue, A., Nencioni, L., Caffarena, A., Villa, L., Boraschi, D., Cazzola, G., and Cavalieri, S. (1985) Cellular immunity against Salmonella typhi after live oral vaccine. Clin. Exp. Immunol., 62, 242–247.[ISI][Medline]

Takahashi, Y., Dutta, P.R., Cerasoli, D.M., and Kelsoe, G. (1998) In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. V: Affinity maturation develops in two stages of clonal selection. J. Exp. Med., 187, 885–895.[Abstract/Free Full Text]

Takashima, S., Tsuji, S., and Tsujimoto, M. (2002) Characterization of the second type of human beta-galactoside alpha 2,6-sialyltransferase (ST6Gal II), which sialylates Galbeta 1, 4GlcNAc structures on oligosaccharides preferentially. Genomic analysis of human sialyltransferase genes. J. Biol. Chem., 277, 45719–45728.[Abstract/Free Full Text]

Tsuji, S. (1996) Molecular cloning and functional analysis of sialyltransferases. J. Biochem. Tokyo, 120, 1–13.[Abstract/Free Full Text]

Ujita, M., McAuliffe, J., Schwientek, T., Almeida, R., Hindsgaul, O., Clausen, H., and Fukuda, M. (1998) Synthesis of poly-N-acetyllactosamine in core 2 branched O-glycans. The requirement of novel beta-1,4-galactosyltransferase IV and beta-1,3-n-acetylglucosaminyltransferase. J. Biol. Chem., 273, 34843–34849.[Abstract/Free Full Text]

Varki,A. (1993) Biological roles of oligosaccharides. Glycobiology, 3, 97–130.[Abstract/Free Full Text]

Varki,A. (1997) Sialic acids as ligands in recognition phenomena. FASEB J., 11, 248–255.[Abstract]

Wang, X.C., O'Hanlon, T.P., Young, R.F., and Lau, J.T.Y. (1990) Rat beta-galactoside alpha 2,6-sialyltransferase genomic organization: alternate promoters direct the synthesis of liver and kidney transcripts. Glycobiology, 1, 25–31.[Abstract/Free Full Text]

Wang, X.C., Vertino, A., Eddy, R.L., Byers, M.G., Jani-Sait, S.N., Shows, T.B., and Lau, J.T.Y. (1993) Chromosome mapping and organization of the human beta-galactoside alpha 2,6-sialyltransferase gene. Differential and cell-type specific usage of upstream exon sequences in B-lymphoblastoid cells. J. Biol. Chem., 268, 4355–4361.[Abstract/Free Full Text]

Weinstein, J., Lee, E.U., McEntee, K., Lai, P.H., and Paulson, J.C. (1987) Primary structure of ß-galactoside {alpha}2,6-sialyltransferase. Conversion of membrane-bound enzyme to soluble forms by cleavage of the NH2-terminal signal anchor. J. Biol. Chem., 262, 17735–17743.[Abstract/Free Full Text]

Wuensch, S.A., Huang, R.-A., Ewing, J., Liang, X.L., and Lau, J.T.Y. (2000) Murine B cell differentiation is accompanied by programmed expression of multiple novel ß-galactoside {alpha}2,6-sialyltransferase mRNA forms. Glycobiology, 10, 67–75.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
M. Hedlund, E. Ng, A. Varki, and N. M. Varki
{alpha}2-6 Linked Sialic Acids on N-Glycans Modulate Carcinoma Differentiation In vivo
Cancer Res., January 15, 2008; 68(2): 388 - 394.
[Abstract]