Glycobiology Advance Access originally published online on February 20, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology, 2003, Vol. 13, No. 6 445-455
© 2003 Oxford University Press
1,3-Fucosyltransferase IX (Fut9) determines Lewis X expression in brain
2 Division of Cell Biology, Institute of Life Science, Soka University, Tangi-cho, Hachioji, Tokyo 192-8577, Japan
3 Glycogene Function Team, Research Center for Glycoscience (RCG), National Institute of Advanced Industrial Science and Technology (AIST), Central-2, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8568, Japan
4 Division of Neurochemistry, Institute of Life Science, Soka University, Tangi-cho, Hachioji, Tokyo 192-8577, Japan
5 Division of Oncological Pathology, Aichi Cancer Center Research Institute, Chikusa-ku, Nagoya 464-0021, Japan
6 Department of Medical Biochemistry, Graduate School, Tokyo Medical and Dental University, Yushima, Bunkyo-ku, Tokyo 113-8513, Japan
7 Amersham Biosciences KK, 3-25-1, Hyakunincho, Shinjuku-ku, Tokyo 169-0073, Japan
8 Tokyo Research Laboratories, Kyowa Hakko Kogyo Co., 3-6-6 Asahi-machi, Machida-shi, Tokyo 194-8533, Japan
Received on September 11, 2002; revised on January 8, 2003; accepted on January 13, 2003
| Abstract |
|---|
|
|
|---|
The expression of the Lewis X (Lex) carbohydrate structure in brain is developmentally regulated and is thought to play a role in cellcell interaction during neuronal development. Mice possess three functional
1,3-fucosyltransferase genes: Fut4, Fut7, and Fut9. Fut7 is known to have no activity to synthesize Lex. In the present study, the relative activities of Fut4 and Fut9 for Lex synthesis were determined using recombinant enzymes. Fut9 exhibited very strong activity for oligosaccharide acceptors and glycolipid acceptors, that is, more than 10- and 100-fold, respectively, than that of Fut4. Furthermore, both cerebrum and cerebellum at various stages of development (E17, P0, P7, P30, P100) expressed 15100 times more Fut9 transcript than Fut4 transcript. Neurons and astrocytes in primary culture also expressed 1015 times more Fut9 than Fut4 transcript. Moreover,
1,3-Fut activity toward a polylactosamine chain in homogenates of brain tissues and primary cultured cells showed a pattern typical of Fut9, not Fut4. The developmental profile of activity for the synthesis of Lex was well correlated with that of Fut9 transcript. Immunohistochemistry with anti-Fut9 monoclonal antibody revealed the distribution of the Lex structure. These results showed that Fut9 is the most responsible enzyme for the synthesis of Lex in brain.
Key words:
1,3-fucosyltransferase
/
Fut4
/
Fut9
/
Lewis X
/
SSEA-1
| Introduction |
|---|
|
|
|---|
Cell surface carbohydrates play important roles in cellcell interaction and recognition. The Lewis X (Lex) carbohydrate structure,
1,3-fucosyl-N-acetyllactosamine, is recognized as an antigenic epitope of stage-specific embryonic antigen-1 (SSEA-1) or CD15 antigen. The Lex structure on the polylactosamine chain, which is detected as SSEA-1 at the morulae stage in mouse embryo, is considered to function as a cellcell interaction ligand in the compaction process (Solter and Knowles, 1978
The Lex structure in brain is carried on glycolipids, proteins, and proteoglycans. The carbohydrate chain carrying the structure is synthesized by a series of glycosyltransferases in the Golgi apparatus, the last step of Lex synthesis being the transfer of a fucose to the N-acetylglucosamine (GlcNAc) of the type 2 chain (Galß1-4GlcNAc) with an
1,3-linkage by
1,3-fucosyltransferases.
The
1,3-fucosyltransferases (
1,3FUTs or
1,3Futs) make up a family. We have cloned mouse Fut9, human FUT9, and rat Fut9 (Fuc-TIX) (Kudo et al., 1998
; Kaneko et al., 1999
; Shimoda et al., 2002
) in addition to the five known human
1,3FUTs, FUT3 (Fuc-TIII) (Kukowska-Latallo et al., 1990
), FUT4 (Fuc-TIV) (Goelz et al., 1990
; Kumar et al., 1991
; Lowe et al., 1991
), FUT5 (Fuc-TV) (Weston et al., 1992a
), FUT6 (Fuc-TVI) (Koszdin and Bowen, 1992
; Weston et al., 1992b
), and FUT7 (Fuc-TVII) (Natsuka et al., 1994
; Sasaki et al., 1994
). FUT3, FUT4, FUT5, FUT6, and FUT9 can synthesize the Lex structure, but FUT7 cannot. The five human
1,3FUTs (FUT3, 4, 5, 6, 7) share a highly homologous sequence, whereas FUT9 has a quite different sequence (Kaneko et al., 1999
). This indicated that the substrate specificity of FUT9 is unique among the
1,3FUTs. In fact, FUT9 preferentially transfers Fuc to the GlcNAc residue at the nonreducing terminal end of the polylactosamine chain, resulting in the terminal Lex structure, whereas the other
1,3FUTs preferentially transfer a Fuc to the GlcNAc residue at the penultimate position, resulting in the internal Lex structure (Nishihara et al., 1999
). Reflecting the substrate specificity, FUT9 exhibits 20-fold stronger activity for the synthesis of CD15, the terminal Lex structure, than does FUT4, whereas FUT4 exhibits 4.5-fold stronger activity for the synthesis of VIM2, the internal Lex structure, than does FUT9 (Nakayama et al., 2001
). FUT9 is mainly expressed in neuronal cells in the CNS, stomach epithelial cells, and peripheral blood leukocytes (Kaneko et al., 1999
; Nakayama et al., 2001
) and is considered the most likely candidate for the enzyme synthesizing Lex in brain.
Mice have only three functional
1,3Fut genes, Fut4, Fut7, and Fut9, corresponding to the human FUT4, FUT7, and FUT9 genes (Kaneko et al., 1999
). The other mouse
1,3Fut (Fut3, 5, and 6) genes were found to be pseudo-genes. Fut7 is limited to specific cells, such as leukocytes and endothelial cells of the venule, and cannot synthesize the Lex structure (Maly et al., 1996
; Nakayama et al., 2001
). Fut4 is ubiquitously expressed in various tissues (Ozawa and Muramatsu, 1996
; Kaneko et al., 1999
). Of the three functional mouse
1,3Fut genes, Fut4 and Fut9 are expressed in brain and both can synthesize the Lex structure. Rat Fut4 and Fut9 are also expressed in brain and developmentally regulated (Baboval et al., 2000
). We recently demonstrated that Pax6, a transcription factor involved in brain patterning and neurogenesis, controls Lex expression in the rat embryonic brain by regulating Fut9 (Shimoda et al., 2002
).
In the present study, we first performed a quantitative analysis of the relative activity to synthesize Lex and the developmental expression of both mouse
1,3Futs based on transcriptional and enzymic activity levels. Then primary cultures of neurons or astrocytes and the brain tissues were also analyzed immunohistochemically. We concluded that Fut9 is most responsible for the expression of Lex in brain.
| Results |
|---|
|
|
|---|
Relative
1,3-Fut activity of Fut9 and Fut4 for oligosaccharide substrates and glycolipid substratesBoth Fut4 and Fut9 are expressed in mouse brain. As reported previously, human FUT9 exhibits 20-fold stronger activity for the synthesis of CD15, the terminal Lex structure, than does FUT4, whereas FUT4 exhibits 4.5-fold stronger activity for the synthesis of VIM2, the internal Lex structure, than does FUT9 (Nakayama et al., 2001
We first determined the relative activity of mouse Fut4 and Fut9 to make sure they were the same as in humans. Neuro2A cells transfected stably with each of two Fut genes that were used as enzyme sources. To obtain the relative activity for Fut4 and Fut9, the amount of Fut4 and Fut9 expressed in each cell homogenate was adjusted judging from the transcript level, and the same amount of each was added to the enzyme reaction. Table I shows the relative
1,3-Fut activities of the two enzymes toward three 2-aminobenzamide (2AB)-labeled oligosaccharide substrates. A polylactosamine acceptor, Galß1-4GlcNAcß1-3Galß1-4GlcNAcß1-3Galß1-4GlcNAc-2AB (3LN-2AB), has two GlcNAc residues to be fucosylated, the distal GlcNAc (V) and the internal GlcNAc (III). The activity of Fut9 toward the distal GlcNAc (V) was 90%, that is, 15.5 times stronger than the activity of Fut4 (5.8%), and was as high as the Fut9 activities toward Galß1-4GlcNAcß1-3Galß1-4Glc-2AB, lacto-N-neotetraose-2AB (LNnT-2AB) (100%), and Galß1-4GlcNAcß1-3Galß1-4GlcNAc-2AB (2LN-2AB) (94%). Fut4 showed weak activity toward the distal GlcNAc (V) of 3LN-2AB (5.8%), which was as low as the Fut4 activities toward LNnT-2AB (6.6%) and 2LN-2AB (9.3%). In contrast, Fut4 showed stronger
1,3-Fut activity toward the internal GlcNAc (III) (19%) of 3LN-2AB than the distal GlcNAc (V). The relative activity for the internal GlcNAc (III) fucosylation of Fut9 to Fut4 was 0.51. These results demonstrated that Fut9 exerts 1015 times stronger activity for the Lex synthesis than Fut4 on the oligosaccharide substrates.
|
The same recombinant enzymes of Fut4 and Fut9 were also used to determine the relative
1,3-Fut activities for glycolipid acceptors. Five different glycolipid substrates were employed for the assays as shown in Table II. The same amounts of Fut9 and Fut4 and the same amount of each substrate were used for the enzyme reactions, so we could determine the relative activities of the two enzymes for each substrate. On thin-layer chromatography (TLC) analysis of reaction products that had incorporated [14C]-Fuc into each glycolipid acceptor, Fut9 gave intense positive bands of fucosylated products except for the substrate NeuGc
2-3Galß1-4GlcNAcß1-3Galß1-4Glc1-1'Cer (IV3 NeuGcnLc4) (Table II). In contrast, the Fut4 activity for these glycolipid acceptors was very weak. This is not due to the artificial inactivation of Fut4 because the same Fut4 lysate used in this experiment showed high activity against the oligosaccharide acceptor, 3LN-2AB, as already mentioned (Table I). Relative
1,3-Fut activities between Fut4 and Fut9 for various glycolipid acceptor substrates are summarized in Table II.
|
The neutral fucosylated glycolipids carrying the Lex structure, Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4Glc1-1'Cer (III3FucnLc4) and Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4GlcNAcß1-3Galß1-4Glc1-1'Cer (V3FucnLc6), were apparently synthesized by Fut9. The two fucosylated products with a single fucosylation from the Galß1-4GlcNAcß1-3Galß1-4GlcNAcß1-3Galß1-4Glc1-1'Cer (nLc6) substrate, which were V3FucnLc6 and Galß1-4Glc- NAcß1-3Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4Glc1-1'Cer (III3FucnLc6), could not be detected as separate bands. Gal
1-3-Galß1-4GlcNAcß1-3Galß1-4Glcß1-1'Cer (IV3GalnLc4) was the best glycolipid acceptor for the transfer of Fuc by Fut9 (Table II). This was quite an interesting finding on Fut9 substrate specificity and contrasted with the negative activity of Fut9 toward IV3NeuGcnLc4. These results demonstrated that Fut9 cannot fucosylate the distal GlcNAc residue of the carbohydrate chain with the sialic acid at the nonreducing end but can efficiently fucosylate it when a galactose is localized in spite of the sialic acid. The short chain glycolipid, Galß1-4GlcNAcß1-3Galß1-4Glcß1-1'Cer (nLc4), was a better acceptor substrate than the longer chain glycolipid, nLc6 (Table II). It was also interesting that Fut9 could synthesize the VIM-2 structure on the glycolipid, NeuGc
2-3Galß1-4GlcNAcß1-3Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4Glc1-1'Cer (VI3NeuGcIII3FucnLc6), in which the internal GlcNAc residue was fucosylated, whereas Fut9 could not synthesize the sLex structure on the glycolipid, NeuGc
2-3Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4Glc1-1'Cer (IV3NeuGcIII3FucnLc4).
Fut4 exhibited very weak activity toward various glycolipid acceptor substrates, as seen in Table II, although the same Fut4 lysates showed high levels of activity for the oligosaccharide acceptor, 3LN-2AB, as mentioned (Table I). The reaction products of Fut9 could be easily detected even when using the smaller amount of radioactive GDP-Fuc. We tried various reaction conditions to detect the
1,3-Fut activity of Fut4 for glycolipids but could detect only small amounts of fucosylated glycolipid products. For the distal GlcNAc on glycolipids, Fut4 could fucosylate only small amounts, less than 1/100 of those in the case of Fut9. Even for the internal GlcNAc of NeuGc
2-3Galß1-4GlcNAcß1-3Galß1-4GlcNAcß1-3Galß1-4Glc1-1'Cer (VI3NeuGcnLc6), Fut4 was weaker than Fut9, with just 1/10 of the activity. We concluded that Fut4 is very weak at transferring Fuc to and synthesizing the Lex structure on glycolipids, compared with Fut9. This strongly indicated that the Lex structure on glycolipids in mouse brain is synthesized by Fut9.
Transcript levels of Fut9 and Fut4 genes during mouse brain development
Transcript levels of Fut9 and Fut4 during the development of mouse brain were determined quantitatively by the real-time reverse transcription polymerase chain reaction (RT-PCR) method. Developmental profiles of each transcript in cerebrum and in cerebellum containing mesencephalon are shown in Figure 1AD. The vertical axes show the Fut4 (Figure 1A, C) and Fut9 (Figure 1B, D) transcript levels normalized with the transcript levels of glyceraldehyde phosphate dehydrogenase (GAPDH). The Fut9 transcript was predominantly expressed at all stages both in cerebrum and in cerebellum containing mesencephalon. In cerebrum, Fut9 was expressed in amounts 3080 times that of Fut4. Fut4 transcripts showed the highest value at stage E17 and decreased after birth (Figure 1A). Fut9 transcripts increased during the embryonic stage, showed the highest value at P0 and decreased (Figure 1B). The developmental profile of the Fut9 transcripts well correlated with that of the activity to synthesize Lex in cerebrum (Figure 2E).
|
|
In cerebellum and mesencephalon, Fut9 was expressed at 1540 times the amount of Fut4 from the embryo to P0 stage and almost 100 times the level of Fut4 after birth. Fut4 transcripts showed the highest value at E17 and decreased after birth (Figure 1C). Fut9 transcripts increased from the embryo to P7 stage, showed the highest value at P7, and decreased in adult brain (Figure 1D). The developmental change of Fut9 transcripts in cerebellum and mesencephalon was also well correlated with that of activity for Lex synthesis (Figure 2F).
From these four results(1) that the
1,3-Fut activity of Fut9 for oligosaccharide substrates was more than 10 times that of Fut4, (2) that the
1,3-Fut activity of Fut9 for glycolipid substrates was more than 100 times that of Fut4, (3) that the expression level of Fut9 was more than 15 times that of Fut4 in brain throughout the course of development, and (4) that developmental profiles of Fut9 transcripts in cerebrum and in cerebellum containing mesencephalon were well correlated with those for the synthesis of Lexwe demonstrated that the Lex structure in mouse brain is synthesized predominantly by Fut9, not by Fut4.
1,3-Fut activity in mouse brain for polylactosamine acceptor, 3LN-2AB, shows a Fut9-specific profile
As already mentioned (Table I), we examined the specificity of mouse Fut4 and Fut9 for a polylactosamine chain, 3LN-2AB. The reaction products of the two enzymes had different high-pressure liquid chromatography (HPLC) profiles, as seen in Figure 2A and B. Fut4 gave a large P2 peak and small P1 and P3 peaks (Figure 2A), whereas Fut9 gave a large P1 peak and small P2 and P3 peaks (Figure 2B). The three products, P1, P2, and P3, were identified as Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4GlcNAcß1-3Galß1-4GlcNAc-2AB, Galß1-4GlcNAcß1-3Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4GlcNAc-2AB, and Galß1-4(Fuc
1-3)-GlcNAcß1-3Galß1-4(Fuc
1-3)GlcNAcß1-3Galß1-4GlcNAc-2AB, respectively, in our previous study (Nishihara et al., 1999
). Mouse Fut9 preferentially fucosylated the distal GlcNAc of 3LN-2AB, resulting in the product giving the large P1 peak that carries the Lex structure, whereas mouse Fut4 preferentially fucosylated the internal GlcNAc to give a large P2 peak.
Representative HPLC profiles of the reaction products in tissue homogenates of mouse brain for 3LN-2AB are shown in Figure 2C and D. E17 (Figure 2C) and P100 (Figure 2D) cerebrum extracts showed the same product pattern as recombinant mouse Fut9 showed. The ratio of P1 to P2 of the
1,3-Fut activity in E17 and P100 cerebrum homogenates was the same as that of recombinant Fut9 products (Figure 2BD). The other brain tissue samples, cerebrum of P0, P7, and P30 mice and cerebellum and mesencephalon of E17, P0, P7, P30, and P100 mice, also showed the same HPLC profile of fucosylated products as that of recombinant Fut9 (data not shown). These results confirmed the conclusion that the Lex structure in mouse brain is synthesized predominantly by Fut9.
The
1,3-Fut activity to synthesize Lex, for example, the activity for the P1 peak, in mouse brain was developmentally regulated. The activity of Lex synthesis, corresponding to the P1 peak, was maximal at birth, at around P0 to P7, and decreased gradually in both cerebrum (Figure 2E) and cerebellum and mesencephalon (Figure 2F). Developmental profiles of the activity for Lex synthesis were consistent with those of Fut9 transcripts (Figure 1B, D). In contrast, the
1,3-Fut activity synthesizing the internal Lex structure, that is, the activity for the P2 peak, was insignificant throughout the development of the brain.
These results demonstrated that the expression of Fut9 is developmentally regulated and directs the synthesis of Lex in both cerebrum and cerebellum and mesencephalon, whereas Fut4 is only expressed at a very low level and is not responsible for the expression of Lex in brain.
Specificity of an mAb against FUT9
The specificity of the mAb against human FUT9, KM2681, was determined by western blotting analysis (Figure 3). The cell lysates of Neuro2A cells transfected stably with each of two mouse Fut genes, Fut4 and Fut9, which were used as recombinant enzyme sources. KM2681 showed specific reactivity against mouse Fut9 because of the highly conserved amino acid sequences between human FUT9 and mouse Fut9. KM2681 was used as anti-mouse Fut9 mAb in this article. KM2681 did not cross-react with mouse Fut4 and any other proteins included in Neuro2A cells.
|
Expression of Fut9 and SSEA-1 in primary-cultured neurons and astrocytes
Cerebral neuronal cells in primary culture were stained with anti-Fut9 mAb and anti-SSEA-1 mAb. The purity of the neurons in the culture was approximately 97%, as determined by immunostaining with anti-neurofilament antibody (Figure 4A). Fut9 was localized in the Golgi area of almost all neuronal cells (Figure 4B), but the Lex structure recognized by anti-SSEA-1 mAb was not expressed in all neuronal cells (Figure 4C, D) because its expression is probably determined by some other glycosyltransferase(s) that synthesizes the root structure of the carbohydrate chain carrying the terminal Lex structure. The surfaces of the body, processes, and growth cones of neuronal cells were strongly stained with anti-SSEA-1 mAb (Figure 4C).
|
Cerebral astrocytes in primary culture were also stained with anti-Fut9 mAb and anti-SSEA-1 mAb. The purity of the astrocytes was over 98%, judging from the immunocytochemical-staining with anti-glial fibrillary acidic protein (GFAP) antibody. Fut9 was again localized in the Golgi area of almost all astrocytes (Figure 4F). But the Lex structure recognized by anti-SSEA-1 mAb was not expressed in all astrocytes because its expression may also depend on precursor structures (Figure 4G, H). The surface of astrocytes was strongly stained by anti-SSEA-1 mAb (Figure 4G).
Quantitative analysis of Fut4 and Fut9 transcripts in cerebral primary cultured cells
Transcript levels of Fut9 and Fut4 genes in the neurons and astrocytes of the cerebral primary culture were determined quantitatively by real-time RT-PCR (Figure 1E, F). In both neurons and astrocytes, the Fut9 transcript was predominant, at more than 15 times the level of Fut4 transcript. This is consistent with the ratio of Fut9 to Fut4 transcript in mouse cerebrum tissue (Figure 1A, B). The neurons expressed five times more Fut9 transcript than the astrocytes.
Immunohistochemical staining of P7 mouse brain with anti-Fut9 mAb and anti-SSEA-1 mAb
In the previous section (Figure 2), P7 mouse brain showed the highest
1,3-Fut activity for the synthesis of Lex, that is, the highest P1 peak, during development. Sagittal sections of P7 mouse brain tissues were immunohistochemically stained with anti-Fut9 mAb and anti-SSEA-1 mAb. The immunohistochemical procedure was performed on frozen sections to detect both glycolipids and glycoproteins carrying the Lex structure.
In cerebral cortex, pyramidal neurons in layers IIIV and those in layers V and VI were strongly stained by anti-SSEA-1 mAb (Figure 5A). Fut9 was detected also in the neurons in layers IIIV and those in layers V and VI (Figure 5B). Then we performed double staining with anti-SSEA-1 mAb and anti-Fut9 mAb for P7 mouse brain. Confocal images of pyramidal neurons in layers IIIV of the cerebral cortex double stained with anti-Fut9 mAb (fluorescein isothiocyanate; FITC) and anti-SSEA-1 mAb (rhodamine) are shown in Figure 5C and D, respectively. A fused image (Figure 5E) demonstrated that Fut9 and SSEA-1 localized in the same cells. Colocalization of Fut9 and Lex was also observed in pyramidal neurons in layers V and VI of the cerebral cortex.
|
In cerebellum, granule neurons in the internal granule cell layer were stained strongly by both mAbs, whereas the granule neurons in the external granule cell layer were not stained. Notably, the granule neurons migrating from the external to the internal granule cell layer began to be stained by anti-SSEA-1 mAb (Figure 5F) and anti-Fut9 mAb (Figure 5G). Purkinje cells were faintly stained by both mAbs.
The colocalization of Fut9 and Lex in both cerebrum and cerebellum again supported that the Lex structure in mouse brain is synthesized mainly by Fut9.
| Discussion |
|---|
|
|
|---|
We conclude that the Lex structure in mouse brain is synthesized mainly by Fut9 for the following reasons. (1) Fut9 exhibited more than 10 and 100 times the
1,3-Fut activity for oligosaccharide substrates and glycolipid substrates, respectively, that Fut4 exhibited. (2) Fut9 was expressed in both cerebrum and cerebellum and mesencephalon at a level more than 15 times higher than that of Fut4 throughout the development. (3) Extracts from cerebrum and from cerebellum and mesencephalon at each developmental stage showed the substrate specificity pattern that is unique to Fut9. (4) The developmental profile of Lex synthesis is well correlated with that of Fut9 transcript. Finally, (5) Fut9 colocalized with the Lex structure in mouse brain. The high expression level of Fut9 transcript in the brain and the strong relative activity of Fut9 for the synthesis of Lex indicated that Fut9 contributes to the synthesis in brain with at least 15x10 times (150 times) more activity than Fut4. Fut9 must be the most responsible enzyme for the synthesis of Lex in brain not only on glycolipids but also on glycoprotein and proteoglycan. The contribution of Fut4 to the synthesis of Lex in brain would be small.
This developmental profile of
1,3-Fut activity and Fut9 transcripts in mouse brain was consistent with a previous report on rat brain (Wiederschain et al., 1998
), although in that study the site specificities of the activity for polylactosamine were not examined. The sudden disappearance of the Lex-carrying glycolipids after birth (Jungalwala, 1994
) did not correlate with the gradual decrease in the
1,3-Fut activity for Lex synthesis (Figure 2E, F). As reported (Dasgupta et al., 1996
), the Lex expression on glycolipids in brain is determined by lactosylceramide N-acetylglucosaminyltransferase (Lc3 synthase), which synthesizes the root structure of the glycolipids carrying Lex. The marked decrease in the Lc3 synthase activity after birth was reported to be the cause of the sudden disappearance of the Lex-carrying glycolipids (Jungalwala, 1994
). In fact, we recently cloned a gene encoding Lc3 synthase and demonstrated that its expression level is well correlated with that of Lex-carrying glycolipids during the development of the mouse brain (Togayachi et al., 2001
).
In the present study, mouse Fut9 showed the same unique acceptor specificity for polylactosamine, that is, the preferential fucosylation of the distal GlcNAc residue, as human FUT9. Mouse Fut4 preferentially fucosylated the internal GlcNAc, like human FUT3, FUT4, FUT5, and FUT6. This acceptor substrate specificity corresponds to the position on the phylogenetic tree of
1,3-Fut members. According to this tree, the Fut9 gene subfamily diverged from the ancestral gene before the other
1,3-Fut subfamilies. Mouse Fut9 exhibited much stronger activity for synthesis of Lex on both oligosaccharides and glycolipids than mouse Fut4. Human FUT9 also exhibited much higher levels of activity for the synthesis on oligosaccharides (Nakayama et al., 2001
) and glycolipids (data not shown) than human FUT4.
The mutant LEC11 cells, derived from Chinese hamster ovary cells, express an
1,3-Fut gene orthologous to the human FUT6 gene but not the human FUT9 gene (Zhang et al., 1999
). LEC11 cells exhibited preferential transfer of Fuc to the internal GlcNAc of the nLc6 neolacto-glycolipid acceptor (Zhang et al., 1999
). In contrast, another mutant cell line, LEC12, expressed the hamster Fut9 gene but not the hamster Fut6 gene and exhibited preferential transfer of Fuc to the distal GlcNAc of nLc6 (Zhang et al., 1999
). In the present study, we could not separate the two fucosylated products V3FucnLc6 and III3FucnLc6. Considering the site specificity of the mouse Fut9 activity for the polylactosamine acceptor, 3LN-2AB, and the LEC12 activity reported previously (Patnaik et al., 2000
), V3FucnLc6 must be a main product that is synthesized from nLc6 by mouse Fut9.
Sherwood and Holmes (1999)
reported that human recombinant FUT4 has low
1,3-Fut activity for neolacto-series glycolipid acceptor, nLc4, IV3NeuGcnLc4, nLc6, and VI3NeuGcnLc6, although they did not determine the amount of FUT4 and the activity of FUT4 relative to the other
1,3FUTs. Baboval et al. (2000)
reported that rat recombinant Fut9 has much higher
1,3-Fut activity for glycolipid acceptor, nLc4, than rat Fut4, although they did not determine the amount of rat Fut4 and rat Fut9 and the activity of rat Fut9 relative to the rat Fut4. In the present study, we demonstrated that the activity of mouse Fut4 toward neolacto-series glycolipid acceptors was very weak in comparison to the activity of mouse Fut9.
One interesting finding was that Fut9 can efficiently transfer a Fuc to the
1,3-galactosylated lactosamine chain of glycolipids, resulting in the synthesis of IV3Gal III3FucnLc4. The Lex structure, which is referred to as SSEA-1 in the embryo, is also expressed in undifferentiated mouse F9 teratocarcinoma cells, but the expression is lost in these cells when differentiation is induced with retinoic acid (Kudo and Narimatsu, 1995
). The disappearance of Lex in the differentiated F9 cells is caused by the up-regulation of
1,3-galactosyltransferase, which masks the Lex structure by the addition of galactose with an
1,3-linkage (Cho et al., 1996
). The highly effective production of IV3Gal III3FucnLc4 by Fut9 (Table II) indicated that Fut9 does not compete with
3GalT for acceptor substrates and the Gal
1-3Galß1-4(Fuc
1-3) GlcNAc-R structure can be synthesized in cells that express both Fut9 and
3GalT. This is in contrast to the absence of activity of Fut9 for
2,3-sialylated neolacto-glycolipid acceptor, IV3NeuGcnLc4 (Table II). Although Fut9 cannot transfer a Fuc to the distal GlcNAc residue of sialylated lactosaminethat is, it has no activity for sLex synthesisit was found in the present study that Fut9 can synthesize the VIM-2 (CDw65) structure by
1,3-fucosylation of the internal GlcNAc of sialylated polylactosamine, as demonstrated by the activity for 3LN-2AB (Table I) and by the production of VI3NeuGcnLc6 (Table II).
Of the three functional mouse
1,3Futs, Fut4, -7, and -9, only Fut9 has an amino acid sequence that is highly conserved in the human counterpart FUT9, the level of conservation being equal to that for
-actin, suggesting a strong selective pressure for the preservation of the FUT9 (Fut9) sequence during evolution. In mouse, the Lex structure appears on the surface of neural tubes at E9, and the forebrain, the midbrain, and the spinal cord all begin to be stained by anti-Lex mAb from E10 (Yamamoto et al., 1985
; Ashwell and Mai, 1997a
). In chick embryo, the Lex structure was observed in the elevating neural plate and neural fold at stage 7/8 and in the closing neural tube at stage 10/11 (Streit et al., 1996
). Moreover, there is evidence to suggest that the Lex carbohydrate structure functions as a cellcell recognition molecule in the highly organized structures of the CNS (Gotz et al., 1996
; Sajdel-Sulkowska, 1998
; Yoshida-Noro et al., 1999
). The Lex structure synthesized by Fut9 should play an important role in neurogenesis.
The synthesis of the HNK-1 structure, sulfoglucuronyl carbohydrate (SO-33GlcAß1-3Galß1-4GlcNAcß1-R), may compete with the synthesis of the Lex structure (Galß1-4[Fuc
1-3]GlcNAcß-). A number of studies have suggested that the HNK-1 structure itself is involved in cellcell recognition and signaling during the development of the CNS (for example, Nair et al., 1993
). Recently, the synthesis of HNK-1-carrying glycolipids in mature granule neurons was found to cause dedifferentiation, cell aggregation, and enhanced proliferation of neurites (Chou et al., 1998
). In rat cerebral cortex, both glycolipids and glycoproteins carrying HNK-1 are strongly expressed during the embryonic stage. In rat cerebellum, glycolipids carrying HNK-1 are expressed in a biphasic manner, with the initial peak at around P1-P3 and the second peak at P20 (Jungalwala, 1994
). The stage of initial decline in the level of these glycolipids correlated with that of the migration of immature granule neurons from the external to the internal granule cell layer, guided by Bergman glial fibers.
We observed that the disappearance of the HNK-carrying glycolipids in those cells was correlated with the appearance of positive signals obtained with anti-SSEA-1 and anti-Fut9 antibodies. As seen from the immunohistochemical staining of P7 mouse cerebellum with anti-SSEA-1 mAb and anti-Fut9 mAb (Figure 5F, G), both the migrating granule neurons and the granule neurons in the internal granule cell layer expressed Fut9 and the Lex structure. Baboval et al. (2000)
reported that rat Fut9 transcripts are expressed strongly in the cells of the internal granule cell layer in adult rat cerebellum. Mai et al. (1995)
reported that the expressions of CD15 and HNK-1 are complementary in some regions of the brainstem and the cerebellum in the adult mouse. These results indicate that Fut9 regulates the expression of CD15 and HNK-1 positively and negatively, respectively, in mouse cerebellum. We will begin double staining with the anti-CD15 and anti-HNK-1 mAbs in brain tissue and primary-cultured cells. The biological functions of the Lex and HNK-1 structures, whose expressions are probably under reciprocal regulation during neurogenesis, remain to be elucidated.
| Materials and methods |
|---|
|
|
|---|
Preparation of oligosaccharide and glycolipid acceptor substrates
LNnT was purchased from Oxford Glycosystems (Oxford, UK). 2LN and 3LN were prepared from keratan sulfate (Seikagaku-Kogya, Tokyo) as described in a previous paper (Nishihara et al., 1999
nLc4 and IV3GalnLc4 were obtained from the neutral glycolipid fraction of bovine erythrocyte membranes. IV3 NeuGcnLc4 and VI3NeuGcnLc6 were purified from the acidic glycolipid fraction of the same erythrocyte membranes (Uemura et al., 1978
; Watanabe et al., 1979
). After the separation of neutral and acidic glycolipids using DEAE-Sephadex A-25 (Pharmacia Biotech, Tokyo), individual glycolipids were obtained by HPLC on a column of Iatrobeads (6RS-8060, Iatron, Tokyo) (Ledeen and Yu, 1982
). nLc6 was prepared from VI3 NeuGcnLc6 by neuraminidase treatment of Arthrobactor ureafaciens (Nacalai Tesque, Kyoto, Japan), followed by extraction with chloroform/methanol (2:1 and 1:1, v/v). All glycolipids used were checked by TLC, and their identities were confirmed.
Establishment of Neuro2A cells transfected stably with the Fut4 or Fut9 gene
The DNA fragments encoding the full-length open reading frames (ORFs) of the mouse Fut4 and Fut9 genes were isolated and subcloned into another expression vector, pCXN2, for expression in Neuro2A cells. Stable transformant cells were then selected using geneticin (1.2 mg/ml) (G418; Sigma, St. Louis, MO). The transcript levels of Fut4 and Fut9 genes were determined for each stable transformant by real-time RT-PCR, as described in a following section.
Determination of the relative
1,3-Fut activity of Fut9 and Fut4 for oligosaccharide and glycolipid acceptor substrates
The levels of Fut4 and Fut9 transcripts expressed in stable transformant cells were measured, and homogenates of the cells were used as an enzyme source for assay of
1,3-Fut activity using each acceptor substrate. To obtain the relative activity for Fut4 and Fut9, the amount expressed in each cell homogenate was adjusted judging from the transcript level, and the same amount of each was added to the enzyme reaction. The same amount of each substrate was also added. The enzyme reaction and the HPLC analysis of reaction products were performed as described in a previous paper (Nishihara et al., 1999
).
Using 10 µg of each glycolipid acceptor, the
1,3-Fut reaction was allowed to proceed at 37°C for 2 h in 50 mM 4-morpholine propane sulfonic acid (pH 7.5), 10 mM ATP, 100 mM NaCl, 5 mM MnCl2, 10 mM GDP-[14C]Fuc (4.4x105 cpm/nmol), and 0.2% Triton X-100 and terminated by boiling for 3 min followed by the adding of 0.1 M KCl. The enzyme sources were the same as for the oligosaccharide acceptor substrates, and the amounts of Fut4 and Fut9 in the reactions were adjusted according to the level of transcript. After centrifugation of the reaction mixtures, the supernatant was applied to a Sep-Pak C18 column (Waters, Milford, MA) equilibrated with 0.1 M KCl. The unreacted GDP-Fuc was washed out with H2O, and the lipid products were eluted with methanol. The eluates were dried with an N2 evaporator and dissolved in 30 µl methanol. The glycolipid products (10 µl) were applied to a HPTLC plate (Merck, Darmstadt, Germany) and developed in chloroform-methanol-0.02%CaCl2 (5:4:1). The bands of reaction products incorporating radioactivity were detected with a BAS2000 Imaging Analyzer system (Fujifilm, Tokyo). III3FucnLc4, neutral glycolipid mixture, and ganglioside mixture (DIA-IATRON, Tokyo) were used as TLC standards.
Quantitative analysis of Fut4 and Fut9 transcripts in brain tissues and primary cultured cells using the real-time RT-PCR method
Total cellular RNA was isolated from mouse brain tissues and primary cultured cells using the acid guanidium thiocyanate/phenol/chloroform method (Chomczynski and Sacchi, 1987
). Complementary DNA was synthesized with an oligo dT primer from the total RNA using a SUPER-SCRIPT Preamplification System for First Strand cDNA Synthesis (Invitrogen, NY). The cDNAs were used for the real-time RT-PCR.
The real-time RT-PCR was carried out using a TaqMan PCR kit (Roche, Piscataway, NJ) and the following gene-specific primer sets: Fut4 forward primer, CAAAGCCCTGGAGACCGT AGGT; Fut4 reverse primer, CGCTCCTGGAATAGAGGAAGCC; Fut9 forward primer, CA AATCCCATGCGGTCCTGAT; Fut9 reverse primer, TGCTCACCGTCAAGAAGC CATAA; GAPDH forward primer, TCCTGCACCACCAACTGCTTAGCCC; and GAPDH reverse primer, CTTGATGTCATCATAYTTGGCAGG. The gene-specific probes, CCTCCCAT ACTCCAGGGCTGCGGG, CCTCAGCAGGCCAGGCCACCCTTT, and TGACCACAGTCCATGCCATCACTGC for Fut4, Fut9, and GAPDH, respectively, were rabeled with 5'-FAM and 3'-TAMRA. After the mixing of each solution, 50 cycles of PCR were performed in ABI PRISM 7700 (Applied Biosystems Japan, Tokyo) under the following conditions: 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C. Standard DNA plasmids of the respective full-length ORF cDNA were used for the quantitation of each transcript.
Assay of
1,3-Fut activity for the polylactosamine chain in brain tissue extracts
The cerebrum and the cerebellum containing mesencephalon were each sampled at several developmental stages (E17, P0, P7, P30, and P100) and frozen at -70°C until use. The tissues were crushed and solubilized in HEPES buffer (pH 7.2) containing 2% Triton X-100 by brief sonication, and 50 µg of extracted protein was subjected to the assay of activity for polylactosamine acceptor, 3LN, as described previously (Nishihara et al., 1999
).
Establishment of a mAb against FUT9
The ORF of the human FUT9 gene was subcloned into a bacterial expression vector, pET-14b (Novagen, Madison, WI). Mice were immunized with the recombinant protein expressed in Escherichia coli. The screening of hybridomas reacting to human FUT9 was performed using microtiter plates coated with the recombinant human FUT9 to obtain anti-FUT9 mAb, KM2681 (mouse IgG1).
Western blotting analysis
Neuro2A cells transfected stably with each of two mouse Fut genes, Fut4 and Fut9, were used as recombinant enzyme sources. Cell pellets were solubilized in 20 mM HEPES buffer (pH 7.2) containing 2% Triton X-100 by brief sonication. Proteins separated on 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis were transferred to an Immobilon polyvinylidene difluoride membrane (Millipore) in a Transblot SD cell (Bio-Rad, Hercules, CA). The membrane was blocked with phosphate buffered saline (PBS) containing 5% skim milk at 4°C overnight and then incubated with 10 µg/ml of anti-FUT9 mAb, KM2681. The membrane was stained according to the manual with the ECL western blotting detection reagents (Pharmacia Biotech, Tokyo).
Primary culture of neurons and astrocytes from mouse brain
E17 and P0 mouse brain was used for the primary culture of neurons and astrocytes, respectively, according to a method described previously (Nagata et al., 1993
). The brains were cleaned of meninges and blood vessels, minced, and trypsinized in PBS containing 0.25% trypsin and 0.05% DNase I at 37°C for 10 min. After inhibition of the trypsin activity by addition of fetal calf serum, the dissociated cells were filtered through a 100-mesh (125 µm) screen and washed twice with PBS. For the neuron culture, the cells were seeded onto the poly-L-lysine-coated wells of 24-well plates at a density of 5x105 cells/well or 75-cm2 culture flasks at a density of 5x107 cells/bottle in minimum essential medium containing 2% fetal bovine serum. The neurons were cultured for 5 days at 37°C in 5% CO2. For the astrocyte culture, the cells were seeded onto 75-cm2 flasks at a density of 2.0x107 cells/bottle in Dulbecco's modified essential medium containing 10% fetal bovine serum and cultured at 37°C in 5% CO2 with a change of medium twice a week. After 1 week, nonastrocytes were removed by shaking (McCarthy and de Vellis, 1980
). The resultant astrocytic monolayer was removed and dissociated by trypsin treatment. The cell suspension was seeded onto 24-well plates at a density of 2x105/well or onto 75-cm2 culture flasks at a density of 2x107 cells. The astrocytes were cultured for further 5 days.
The purity of the neurons and the astrocytes in each primary culture was approximately 97% and over 98%, respectively, as determined by immunostaining with anti-neurofilament antibody (Dako A/S, Denmark) for neurons and with anti-GFAP antibody (Dako A/S) for astrocytes.
Immunofluorescent staining of neurons and astrocytes in primary culture with anti-SSEA-1 or anti-Fut9 mAb
Cultured cells on poly-L-lysine-coated cover glasses were fixed with 4% paraformaldehyde/PBS for 10 min at room temperature. After three washes with PBS, blocking was performed in 1% bovine serum albumin/PBS for 1 h at 4°C. The cells were incubated with the first antibodies, anti-SSEA-1 mAb or anti-Fut9 mAb, overnight at 4°C. They were washed with PBS three times and then incubated with the secondary antibodies, FITC-conjugated goat IgG fraction anti-mouse IgM (Cappel, ICN, OH) for anti-SSEA-1 mAb or FITC-conjugated sheep IgG fraction anti-mouse IgG (Cappel, ICN) for anti-Fut9 mAb. For the staining of Fut9, which is intracellulary localized in the Golgi apparatus, all solutions for treatment contained 0.05% Triton X-100.
Immunohistochemical staining of P7 mouse brain
Brain tissues of P7 mice were fixed in 4% paraformaldehyde/PBS overnight at 4°C. After their equilibration in 20% sucrose/PBS, they were embedded in Tissue Mount (Chiba Medical, Chiba, Japan). Fresh frozen sections (6 µm thick) were washed in PBS at room temperature, treated with 0.3% (v/v) H2O2 in PBS for 15 min for the blocking of endogenous peroxidase, and then washed three times in PBS. An Avidin/Biotin Blocking Kit (Vector Laboratories, Burlingame, CA) was used prior to 30-min incubation with 0.5% normal swine serum (Dako A/S) and 0.1% NaN3 in PBS at room temperature. The sections were incubated overnight at 4°C with each primary mAb, anti-Fut9 mAb, KM2681 (mouse IgG1), or anti-SSEA-1 mAb (mouse IgM). After three washes with PBS, binding was visualized using the streptavidin-biotin technique (Vector M.O.M. Immunodetection kit, Vector Laboratories), and nuclei were counterstained with 5% methyl green stain solution, pH 4.0 (Muto Pure Chemicals, Tokyo). The double staining with anti-Fut9 mAb and anti-SSEA-1 mAb was performed by using FITC-conjugated sheep IgG fraction anti-mouse IgG (Cappel, ICN) and rhodamine-labeled affinity purified antibody to mouse IgM (Kirkegaard & Perry Laboratories, MD), respectively. Confocal images were detected with the laser scanning microscope LSM510 (Zeiss, Germany).
| Acknowledgements |
|---|
We thank R. Watanabe and H. Fukumitsu (Division of Immunoscience, Institute of Life Science, Soka University) for helpful suggestions and discussions. We also thank T. Inoue and K. Hayashida (Animal House, Institute of Life Science, Soka University) for technical assistance. This work was supported in part by a Grant-in-Aid for Scientific Research C. No.12680620 from the Ministry of Education, Science, Sports, and Culture of Japan.
1 To whom correspondence should be addressed; e-mail: h.narimatsu{at}aist.go.jp ![]()
| Abbreviations |
|---|
2AB, 2-aminobenzamide; CNS, central nervous system; FITC, fluorescein isothiocyanate; Fut or FUT, fucosyltransferase; GAPDH, glyceraldehyde phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; HPLC, high-pressure liquid chromatography; Lex, Lewis X; 2LN, Galß1-4GlcNAcß1-3Galß1-4GlcNAc; 3LN, Galß1-4Glc-NAcß1-3Galß1-4GlcNAcß1-3Galß1-4GlcNAc; LNnT, lacto-N-neotetraose; mAb, monoclonal antibody; nLc4, Galß1-4GlcNAcß1-3Galß1-4Glcß1-1'Cer; nLc6, Galß1-4GlcNAcß1-3Galß1-4GlcNAcß1-3Galß1-4Glc1-1'Cer; ORF, open reading frame; PBS, phosphate buffered saline; RT-PCR, reverse transcription polymerase chain reaction; SSEA-1, stage-specific embryonic antigen-1; TLC, thin-layer chromatography
| References |
|---|
|
|
|---|
Allendoerfer, K.L., Durairaj, A., Matthews, G.A., and Patterson, P.H. (1999) Morphological domains of Lewis-X/FORSE-1 immunolabeling in the embryonic neural tube are due to developmental regulation of cell surface carbohydrate expression. Dev. Biol., 211, 208219.[CrossRef][ISI][Medline]
Ashwell, K.W. and Mai, J.K. (1997a) Developmental expression of the CD15 epitope in the hippocampus of the mouse. Cell Tissue Res., 289, 1723.[CrossRef][ISI][Medline]
Ashwell, K.W. and Mai, J.K. (1997b) A transient CD15 immunoreactive sling in the developing mouse cerebellum. Int. J. Dev. Neurosci., 15, 883889.[CrossRef][ISI][Medline]
Baboval, T., Henion, T., Kinnally, E., and Smith, F.I. (2000) Molecular cloning of rat
1,3-fucosyltransferase IX (Fuc-TIX) and comparison of the expression of Fuc-TIV and Fuc-TIX genes during rat postnatal cerebellum development. J. Neurosci. Res., 62, 206215.[CrossRef][ISI][Medline]
Cho, S.K., Yeh, J., Cho, M., and Cummings, R.D. (1996) Transcriptional regulation of
1,3-galactosyltransferase in embryonal carcinoma cells by retinoic acid. Masking of Lewis X antigens by
galactosylation. J. Biol. Chem., 271, 32383246.
Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156159.[ISI][Medline]
Chou, D.K., Suzuki, Y., and Jungalwala, F.B. (1996) Expression of neolactoglycolipids: sialosyl-, disialosyl-, O-acetyldisialosyl- and fucosyl-derivatives of neolactotetraosyl ceramide and neolactohexaosyl ceramide in the developing cerebral cortex and cerebellum. Glycoconj. J., 13, 295305.[CrossRef][ISI][Medline]
Chou, D.K., Tobet, S.A., and Jungalwala, F.B. (1998) Restoration of synthesis of sulfoglucuronylglycolipids in cerebellar granule neurons promotes dedifferentiation and neurite outgrowth. J. Biol. Chem., 273, 85088515.
Dasgupta, S., Hogan, E.L., and Spicer, S.S. (1996) Stage-specific expression of fuco-neolacto- (Lewis X) and ganglio-series neutral glycosphingolipids during brain development: characterization of Lewis X and related glycosphingolipids in bovine, human and rat brain. Glycoconj. J., 13, 367375.[CrossRef][ISI][Medline]
Gocht, A., Struckhoff, G., and Lhler, J. (1996) CD15-containing glycoconjugates in the central nervous system. Histol. Histopathol., 11, 10071028.[ISI][Medline]
Goelz, S.E., Hession, C., Goff, D., Griffiths, B., Tizard, R., Newman, B., Chi-Rosso, G., and Lobb, R. (1990) ELFT: a gene that directs the expression of an ELAM-1 ligand. Cell, 63, 13491356.[CrossRef][ISI][Medline]
Gooi, H.C., Feizi, T., Kapadia, A., Knowles, B.B., Solter, D., and Evans, M.J. (1981) Stage-specific embryonic antigen involves
1 goes to 3 fucosylated type 2 blood group chains. Nature, 292, 156158.[CrossRef][Medline]
Gotz, M., Wizenmann, A., Reinhardt, S., Lumsden, A., and Price, J. (1996) Selective adhesion of cells from different telencephalic regions. Neuron, 16, 551564.[CrossRef][ISI][Medline]
Jungalwala, F.B. (1994) Expression and biological functions of sulfoglucuronyl glycolipids (SGGLs) in the nervous systema review. Neurochem. Res., 19, 945957.[CrossRef][ISI][Medline]
Kaneko, M., Kudo, T., Iwasaki, H., Ikehara, Y., Nishihara, S., Nakagawa, S., Sasaki, K., Shiina, T., Inoko, H., Saitou, N., and Narimatsu, H. (1999)
1,3-Fucosyltransferase IX (Fuc-TIX) is very highly conserved between human and mouse; molecular cloning, characterization and tissue distribution of human Fuc-TIX. FEBS Lett., 452, 237242.[CrossRef][ISI][Medline]
Koszdin, K.L. and Bowen, B.R. (1992) The cloning and expression of a human
1,3-fucosyltransferase capable of forming the E-selectin ligand. Biochem. Biophys. Res. Commun., 187, 152157.[CrossRef][ISI][Medline]
Kudo, T. and Narimatsu, H. (1995) The ß1,4-galactosyltransferase gene is post-transcriptionally regulated during differentiation of mouse F9 teratocarcinoma cells. Glycobiology, 5, 397403.
Kudo, T., Ikehara, Y., Togayachi, A., Kaneko, M., Hiraga, T., Sasaki, K., and Narimatsu, H. (1998) Expression cloning and characterization of a novel murine
1,3-fucosyltransferase, mFuc-TIX, that synthesizes the Lewis X (CD15) epitope in brain and kidney. J. Biol. Chem., 273, 2672926738.
Kukowska-Latallo, J.F., Larsen, R.D., Nair, R.P., and Lowe, J.B. (1990) A cloned human cDNA determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group
1,3/1,4-fucosyltransferase. Genes Dev., 4, 12881303.
Kumar, R., Potvin, B., Muller, W.A., and Stanley, P. (1991) Cloning of a human
1,3-fucosyltransferase gene that encodes ELFT but does not confer ELAM-1 recognition on Chinese hamster ovary cell transfectants. J. Biol. Chem., 266, 2177721783.
Ledeen, R.W. and Yu, R.K. (1982) Gangliosides: structure, isolation, and analysis. Methods Enzymol., 83, 139191.[ISI][Medline]
Lowe, J.B., Kukowska-Latallo, J.F., Nair, R.P., Larsen, R.D., Marks, R.M., Macher, B.A., Kelly, R.J., and Ernst, L.K. (1991) Molecular cloning of a human fucosyltransferase gene that determines expression of the Lewis X and VIM-2 epitopes but not ELAM-1-dependent cell adhesion. J. Biol. Chem., 266, 1746717477.
Mai, J.K., Bartsch, D., and Marani, E. (1995) CD15 and HKN-1 reveal cerebellar compartments with a complex overlap. Eur. J. Morphol., 33, 101107.[ISI][Medline]
Mai, J.K., Krajewski, S., Reifenberger, G., Genderski, B., Lensing-Hohn, S., and Ashwell, K.W. (1999) Spatiotemporal expression gradients of the carbohydrate antigen (CD15) (Lewis X) during development of the human basal ganglia. Neuroscience, 88, 847858.[CrossRef][ISI][Medline]
Maly, P., Thall, A., Petryniak, B., Rogers, C.E., Smith, P.L., Marks, R.M., Kelly, R.J., Gersten, K.M., Cheng, G., Saunders, T.L., and others. (1996) The
1,3-fucosyltransferase Fuc-TVII controls leukocyte trafficking through an essential role in L-, E-, and P-selectin ligand biosynthesis. Cell, 86, 643653.[CrossRef][ISI][Medline]
Marcus, R.C., Shimamura, K., Sretavan, D., Lai, E., Rubenstein, J.L., and Mason, C.A. (1999) Domains of regulatory gene expression and the developing optic chiasm: correspondence with retinal axon paths and candidate signaling cells. J. Comp. Neurol., 403, 346358.[CrossRef][ISI][Medline]
McCarthy, K.D. and de Vellis, J. (1980) Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J. Cell Biol., 85, 890902.
Nagata, K., Takei, N., Nakajima, K., Saito, H., and Kohsaka, S. (1993) Microglial conditioned medium promotes survival and development of cultured mesencephalic neurons from embryonic rat brain. J. Neurosci. Res., 34, 357363.[CrossRef][ISI][Medline]
Nair, S.M., Prasadarao, N., Tobet, S.A., and Jungalwala, F.B. (1993) Rostrocaudal expression of antibody HNK-1-reactive glycolipids in mouse cerebellum: relationship to developmental compartments and leaner mutation. J. Comp. Neurol., 332, 282292.[CrossRef][ISI][Medline]
Nakayama, F., Nishihara, S., Iwasaki, H., Kudo, T., Okubo, R., Kaneko, M., Nakamura, M., Karube, M., Sasaki, K., and Narimatsu, H. (2001) CD15 expression in mature granulocytes is determined by
1,3-fucosyltransferase IX, but in promyelocytes and monocytes by
1,3-fucosyltransferase IV. J. Biol. Chem., 276, 1610016106.
Natsuka, S., Gersten, K.M., Zenita, K., Kannagi, R., and Lowe, J.B. (1994) Molecular cloning of a cDNA encoding a novel human leukocyte
1,3-fucosyltransferase capable of synthesizing the sialyl Lewis X determinant. J. Biol. Chem., 269, 20806.
Nishihara, S., Iwasaki, H., Kaneko, M., Tawada, A., Ito, M., and Narimatsu, H. (1999)
1,3-Fucosyltransferase 9 (FUT9; Fuc-TIX) preferentially fucosylates the distal GlcNAc residue of polylactosamine chain while the other four
1,3FUT members preferentially fucosylate the inner GlcNAc residue. FEBS Lett., 462, 289294.[CrossRef][ISI]





