Skip Navigation


Glycobiology Advance Access originally published online on January 22, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/6/411    most recent
cwg039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Falkenberg, V. R.
Right arrow Articles by Fregien, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Falkenberg, V. R.
Right arrow Articles by Fregien, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 6 411-418
© 2003 Oxford University Press

Multiple transcription initiation and alternative splicing in the 5' untranslated region of the core 2 ß1-6 N-acetylglucosaminyltransferase I gene

V. Rebecca Falkenberg, Karen Alvarez, Clara Roman and Nevis Fregien1

Department of Cell Biology and Anatomy, University of Miami School of Medicine, Miami, FL 33176, USA

Received on August 5, 2002; revised on November 26, 2002; accepted on December 5, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The glycosyltransferase core 2 ß1,6 N-acetylglucosaminyltransferase I (C2GnT I) plays an important regulatory role in the synthesis of biologically significant oligosaccharide structures. This gene is expressed in a variety of cell types, including lymphocytes and mucin-producing cells. The expression pattern of this gene suggests a complex system of regulation. To investigate the molecular regulation of this gene and locate potential promoter elements, rapid amplification of cDNA ends (RACE) analysis was used to determine the 5' ends of the C2GnT I mRNAs from a number of tissues. These experiments identified five C2GnT I mRNAs that are different in their 5' untranslated regions. The RACE cDNAs had four different 5' terminal sequences (exons A, B, D, and E'), suggesting four transcription initiation sites. One mRNA form was the result of alternative exon (exon C) utilization. These exons are spread across 60 kb of DNA on human chromosome 9, and all splice to the exon (exon F) that contains the C2GnT I coding region. Reverse transcription polymerase chain reaction experiments using primers specific for each of the four 5' end exon sequences revealed that the 5' terminal exons are differentially expressed, suggesting tissue specificity for the different 5' untranslated regions. These findings are consistent with the presence of multiple tissue-specific promoters for the C2GnT I gene.

Key words: 5' untranslated region / alternative splicing / glycosyltransferase / mRNA


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
There is tremendous diversity in the carbohydrate structures that are added to cell surface glycoproteins of mammalian cells. The expression of these various individual structures is differentially regulated during embryogenesis as well as in cell- and tissue type-specific methods in the adult. Many of these structures have been shown to have specific cellular and developmental functions. The proper arrangement of individual sugar residues for each unique oligosaccharide structure is accomplished by the ordered, sequential activities of multiple enzymes. Therefore, the genetic control of the synthesis of a specific carbohydrate structure is achieved by regulating the expression of the enzymes required for its construction. In many cases this is accomplished by controlling the expression of a single essential enzyme that adds a specific sugar residue along the synthetic pathway of the complete oligosaccharide.

One important regulatory step in the synthesis of O-linked oligosaccharides is the conversion of a core 1 oligosaccharide structure to a core 2 structure by addition of a N-acetylglucosamine (GlcNAc) in a ß1,6 linkage to the N-acetylgalactosamine (GalNAc) residue attached to the serine or threonine in the protein chain. The ß1,6 branched GlcNAc provides the requisite substrate for further sugar additions by other glycosyltransferases. Many biologically significant oligosaccharide structures are constructed on this branch, including some important cell recognition and adhesion molecules.

The core 2 branch can be added by at least three enzymes, the core 2 ß1,6 N-acetylglucosaminyltransferase (C2GnT-L) L-type for leukocyte, the C2GnT M-type for mucin (Yeh et al., 1999Go), and the C2GnT T-type for thymus (Schwientek et al., 2000Go). The T-type is expressed almost exclusively in the thymus, whereas the M-type is expressed predominantly in mucin-producing cells (Hiraoka et al., 2000Go). The L-type, also referred to as core 2 ß1,6-N-acetylglucosaminyltransferase I (C2GnT I) is more widely expressed in many tissues, including mucin-producing cells and lymphocytes. C2GnT I expression is regulated in T lymphocytes as they mature. Immature T cells must down-regulate C2GnT I as they transit through the thymus because T cells expressing the core 2 branch in the thymus will be induced to apoptose by binding to galectin-1 (Baum et al., 1995Go; Galvan et al., 2000Go). However, when T cells or B cells become activated (Piller et al., 1988Go; Nakamura et al., 1998Go), C2GnT I activity must be induced because the expression of the core 2 branch is critical for the synthesis of selectin adhesion molecules required for leukocyte recruitment to sites of inflammation (Cho and Cummings, 1994Go; Rosen and Bertozzi, 1994Go; Wilkins et al., 1996Go; Hemmerich et al., 1995Go).

Improper expression of C2GnT I is associated with a number of pathological conditions (Tsuboi and Fukuda, 2001Go). C2GnT I gene knockout mice are moderately neutrophilic and show abnormal lymphocyte trafficking (Ellies et al., 1998Go; Sperandio et al., 2001Go). The overexpression of C2GnT I is associated with T cell leukemias (Saitoh et al., 1991Go) as well as colon and other cancers (Brockhausen et al., 1991b). Some immunodeficiencies have been associated with elevated expression of C2GnT I, such as Wiskott-Aldrich syndrome (Datti et al., 1994Go) and HIV type 1-infected T cells (Lefebvre et al., 1994Go). It has been suggested that elevated expression of C2GnT I leads to myocardial dysfunction in diabetic rats (Nishio et al., 1995Go) and transgenic mouse models (Koya et al., 1999Go). These findings indicate that the expression of C2GnT I is important for many normal cellular activities and that aberrant expression is associated with various pathological conditions.

The C2GnT I gene provides an interesting model for the regulation of gene expression. It is expressed in many but not all cell types in housekeeping-like fashion. It is also expressed in a developmentally regulated manner in T cells and mucin-producing epithelial cells, two cell types of different embryological origin. In addition, the expression of this gene is associated with many types of malignant cancers. Previous reports have indicated that there are multiple promoters for the mouse C2GnT I gene that are used tissue specifically (Sekine et al., 1997Go). Therefore, this study was initiated to investigate the human gene and identify the regulatory elements in the C2GnT I gene that are important for its transcription. We identify four different transcription initiation sites that are differentially used by different tissue types. Furthermore, there is also a tissue-specific, alternative exon use in the 5' untranslated region (UTR) for a total of 5 forms of the C2GnT I mRNA.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Mapping the 5' ends of the C2GnT I mRNAs expressed in different tissues
Previous studies had indicated that C2GnT I mRNA cloned from HL60 cells is transcribed from a single promoter and is the product of the splicing of two exons, one in the 5' UTR and a second that contains the entire coding sequence (Bierhuizen et al., 1995Go). Another study found that in the mouse the C2GnT I gene is expressed from multiple promoters in a tissue-specific fashion and that there are alternative splicing patterns in the 5' UTR (Sekine et al., 1997Go). To determine whether the human C2GnT I mRNA from other human tissues contain different 5' ends, 5' rapid amplification of cDNA ends (RACE) was performed using cDNA templates of RNAs isolated from 22 different adult tissues and 2 fetal tissues. The 5' RACE products obtained after two sequential rounds of amplification using nested C2GnT I gene-specific primers are shown in Figure 1. The cDNA samples from many of the different tissues gave 5' RACE products that were detected by ethidium bromide staining of the gel. To further confirm the authenticity of these RACE products as C2GnT I mRNAs and to improve the sensitivity of detection, the gel was blotted and hybridized with a digoxygenin-labeled oligonucleotide probe (Core2hyb) that is complementary to a sequence upstream of the second C2GnT I gene-specific primer (Core2GSP2). These results showed several different sized 5' RACE products, ranging from 200 bp to about 700 bp in length. The sizes varied among the different tissues with some bands appearing in several samples. Some tissues had more than one band. These data suggest that there are multiple human C2GnT I mRNAs that differ in their 5' UTRs.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Rapid amplification of cDNA ends. The upper panel shows the ethidium bromide–stained agarose gel of the C2GnT I mRNA 5' RACE products from 24 different tissues. The lower panels show the blots of the gels after hybridization with a labeled core 2-specific oligonucleotide probe and detected by chemiluminescence. The sizes of selected maker bands are listed at the right. The lanes are: M, 123-bp ladder marker DNA; 1, heart; 2, peripheral blood lymphocytes; 3, liver; 4, fetal liver; 5, kidney; 6, spleen; 7, colon; 8, lung; 9, small intestine; 10, muscle; 11, stomach; 12, testis; 13, placenta; 14, pituitary; 15, thyroid; 16, adrenal gland; 17, pancreas; 18, ovary; 19, uterus; 20, prostate; 21, fat; 22, mammary gland; 23, brain; 24, fetal brain.

 
The 5' RACE products from several tissues were cloned and sequenced. When multiple sizes of RACE products were observed from a single tissue sample, attempts were made to clone each of the amplimers. In some cases, the higher-molecular-weight bands were sliced from the gels using a razor blade, and the DNA was eluted and reamplified prior to cloning. Alignment analysis of the sequences identified five variations of the 5' UTR of the C2GnT I mRNAs. The sequences of each of the variants have been submitted to GenBank (accession numbers AY196293, AY196294, AY196295, AY196296, and AY1962970). Four of the mRNA types had unique sequences at the 5' end, suggesting that each of these four different transcripts initiated at different sites in the genome. The fifth mRNA contained an additional sequence within the 5' UTR, downstream of one of the previously identified 5' terminal exons, suggesting an additional alternatively spliced exon in this message. The sequences of these exons are shown in Figure 2 and diagrams of the different mRNA forms are drawn in Figure 3.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2. Sequences of the C2GnT I 5' UTR exons and flanking DNA. The sequences of the exons identified by 5' RACE, indicated as exons A through F, are listed in the order that they appear from 5' to 3' on chromosome 9. The exon regions are within the boxed regions and are shown with 200 bases of 5' flanking DNA and 20 bases of 3' flanking DNA. The extended exon, exon E' is indicated by the hatched box. The position of gene-specific primer Core2GSP 2 is indicated with an arrow above in exon F.

 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Diagram of the C2GnT I gene organization and C2GnT I mRNAs identified by RACE cloning. The top diagram represents the region of chromosome 9q21 with exons represented by boxes. The size of each exon is given beneath the box. The four putative promoters (P1–P4) are indicated by heavy arrows. Below the diagram of the gene, the exons have been assembled into the five different arrangements identified in the 5' RACE clones. The translation initiation ATG codon is indicated in exon F.

 
To determine whether these newly identified sequences were appropriately located in the genome to be 5' UTR exons, the RACE sequences were used to search the human genome database at the Sanger Centre (www.sanger.ac.uk). This search found that all of these sequences are located on chromosome 9 at q21, upstream of the previously reported location of the C2GnT I coding exon (Bierhuizen et al., 1995Go). Therefore, they are in the correct location to be part of the C2GnT I transcription unit. The arrangement of these exons is diagrammed in Figure 3. These exons are spread over more than 60 kb, and their relative positions are consistent with the observed splicing patterns. Putative promoters are numbered 1 through 4 from 5' to 3'. Exons E and F are common to all of the mRNA sequences. Messenger RNA types 1, 2, and 3 (Figure 3) splice from their individual 5' terminal exons to exons E and F. However, mRNA type 4 does not splice into exon E but initiates 294 bases upstream of the splice junction to create a longer exon E, exon E'. The sequences of these exons are shown in Figure 2 with some additional genomic flanking sequence.

One possible problem with using 5' RACE to identify the 5' end of an mRNA is the potential for premature termination of cDNA synthesis by the reverse transcriptase prior to reaching the actual 5' terminus. If this were to occur, the actual transcription initiation site would be further upstream of the observed RACE sequence. Premature termination could be caused by secondary structure in the mRNA and/or regions of high GC content. The cDNA panel used for these experiments is prepared by a dual-cycling cDNA synthesis procedure that significantly reduces this problem. The cDNA is synthesized in two steps. The first step uses mouse mammary tumor virus reverse transcriptase at 42°C and is followed by an additional synthesis step using Tth DNA polymerase, a thermostable polymerase that also has reverse transcriptase activity, at 75°C. The use of high temperature during cDNA synthesis enhances the reverse transcription through RNA secondary structures. In addition, because there was a region of high GC content near the start of exon B, two additional experiments were done to confirm this as the 5' end of the mRNA. First, additional gene-specific primers complementary to sequences within exon B were made and used for another 5' RACE. No additional RACE products could be generated. In addition, as an alternate approach to confirm the 5' RACE results, another RACE protocol, RLM RACE, was used. This protocol is based on the presence of a 5' cap structure on the mRNA to give a RACE product. This procedure identified a capped mRNA with the same start site as previous 5' RACE results, strongly suggesting exon B as a transcription start exon.

Exon utilization in different tissues
To establish the extent and distribution of exon usage among the different tissues, primers were designed from each of the initial exons (i.e., exon specific primers) and were used as 5' primers in conjunction with Core2GSP2, the primer used for RACE, as the 3' primer to amplify cDNA from each of the tissues. The results of these experiments are shown in Figure 4 and are compiled in Table I. None of the 5' terminal sequences have been observed in combination via splicing with another 5' terminal exon. For example, exon A was never seen spliced to exons B or D in any of the RACE clones, as might be expected if exons B or D were not primary transcribed exons. This suggests that each of these exons represents initiation of transcription from an independent promoter.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 4. Determination of 5' exon utilization and alternative splicing in C2GnT I mRNAs from human tissues. The ethidium bromide-stained agarose gels of four sets of RT-PCR reactions are shown. Each set of reactions used a common 3' primer and the mRNA type-specific primer indicated at the left. The template for the PCR products run in each lane was obtained from the tissues indicated at the top. Markers are the 100 bp DNA ladder (Gibco-BRL, Grand Island, NY) with sizes indicated at the right, and positive (cloned RACE plasmid DNA) and negative (ddH2O) controls are at the right.

 

View this table:
[in this window]
[in a new window]
 
Table I. Distribution of the C2GnT I mRNA forms expressed by different tissues

 
The distribution of exon usage is quite complex with most tissues displaying the expression of two or more mRNA forms. Exon B is expressed in the most tissues (16) and is the only 5' exon detected in 10 tissues; heart, spleen, liver, small intestine, pituitary, pancreas, uterus, peripheral blood lymphocytes, fetal liver, and fat. The only transcript observed in fetal brain initiates in exon D, suggesting a developmental role for this isoform. Initiation in exon E' is detected in the fewest number of tissues (four).

Alternative splicing was observed in a tissue specific fashion. Exon C has only been observed in transcripts containing exon B. Three tissues (heart, spleen, and liver) always splice from exon B to exon C. Ten tissues (placenta, pituitary, adrenal, pancreas, ovary, uterus, prostate, peripheral blood lymphocytes, fetal liver, and fat) appear not to splice exon C. The four tissues from the digestive and respiratory systems (colon, lung, small intestine, and stomach) show both types of messages. There appears to be an mRNA splice variant that is unique to testis. The testis mRNA shows two exon D–containing transcripts. One has the predicted size for an RNA spliced from exon D to exon E; the other is about 100 bases longer and may indicate another, not yet characterized exon. We have not cloned and sequenced this amplification product. These experiments show that the expression of the C2GnT I mRNAs is varied from tissue to tissue. It is possible that the presence of different cell types within each tissue is responsible for some of this complexity, but this is yet to be determined.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The data presented in this article indicate that the transcription of the C2GnT I gene is quite complex. This was suggested by previous studies that indicated this gene is widely expressed in many tissues and is developmentally regulated (Granovsky et al., 1995Go; VanderElst and Datti, 1998Go). There appear to be four different mRNA types that have different 5' terminal exons, consistent with the hypothesis that there are four different promoters that are used in a tissue-specific fashion. These exons span a region of about 60 kb of genomic DNA on chromosome 9q21. In addition, one exon (exon C) is used in association with exon B and is alternatively spliced among different tissues.

The existence of multiple promoters has been reported for a number of glycosyltransferase genes. The ß1,4 galactosyltransferase gene has two different transcription initiation sites within about 200 bases of each other that produce two mRNAs (Rajput et al., 1996Go). Other glycosyltransferases that have multiple promoters include N-acetylglucosaminyltransferases III (Koyama et al., 1996Go) and V (Buckhaults et al., 1997Go; Saito et al., 1995Go) and {alpha}2,3-sialyltransferases I and IV (Kitagawa et al., 1996Go). The C2GnT I gene is very similar to the {alpha}2,6 sialyltransferase I (SIAT1) gene. The SIAT1 gene is transcribed from three different promoters with B cell- and liver-specific promoters. It is also alternatively spliced in the 5' UTR (Lo and Lau, 1996Go, 1999Go). Interestingly, both the C2GnT I and SIAT1 genes have an exon that is common to all mRNAs that can be transcribed from its own upstream promoter or inserted into the mRNA by splicing. These similarities are quite striking and suggest some functional significance to the organization of these genes and the expression of 5' UTR sequences.

The existence of multiple promoters for the C2GnT I and other glycosyltransferase genes may be due to the need for the expression of this gene in many but not all cell types and/or at different times during embryogenesis. The individual promoters can be regulated independently so that the gene can be transcribed in different and overlapping cell types or in response to different signaling systems. Analysis of the promoter elements for each of these promoters should be able to sort out these differences. Another consequence of using different promoters is the addition of a different 5' UTR sequence to the mRNA. The 5' UTR sequences could affect translation or mRNA stability.

The expression of C2GnT I has been correlated with increased metastatic capacity (Yousefi et al., 1991Go) and is associated with a variety of malignancies. These include acute myeloblastic leukemia (Brockhausen et al., 1991a), colorectal cancer (Shimodaira et al., 1997Go), pancreatic cancer (Beum et al., 1999Go), pulmonary adenocarcinoma (Machida et al., 2001Go), and tumors of the oral cavity (Renkonen et al., 2001Go). The mechanism for the increased C2GnT I expression in these malignancies is not known. It is possible that malignant transformation induces C2GnT I expression by activating transcription from one or more of these promoters as previously seen with other glycosyltransferases (Chen et al., 1998Go; Buckhaults et al., 1997Go). The elevated expression of this gene is believed to promote metastasis, but the exact mechanism(s) have not been clearly elucidated. Because it is possible that reduction of the expression of this gene might have antimetastatic effects, it would be helpful to know whether one or more of these promoters is responsible. Further experiments are needed to examine the use of these promoters in different tumor cells to elucidate the mechanism of the expression of this gene in the various cancer cells.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
5' RACE analysis
5' Rapid amplification of cDNA ends was performed using the Sure-RACE Kit from OriGene Technologies (Rockville, MD). This kit contains 24 samples of cDNAs prepared from 22 adult human tissues (brain, heart, kidney, spleen, liver, colon, lung, small intestine, muscle, stomach, testis, placenta, pituitary, thyroid gland, adrenal gland, pancreas, ovary, uterus, prostate, peripheral blood lymphocytes, fat, and mammary gland) and 2 human fetal tissues (fetal brain and fetal liver). The C2GnT I gene specific primers were designed from the sequence reported by Bierhuizen et al. (1995)Go obtained from GenBank (accession number L41415). The primer sequences selected were (numbers are based on the GenBank sequence): Core2GSP1, AAACGGAGAAG-GTGATTAGG, bases 318–337; and Core2GSP2, CTTGAAGGTTGTCAGTTTGC, bases 143–162. A third oligonucleotide, Core2hyb, TCATTTCAAGATGCCGT-TGC, bases 110–129, was used as a hybridization probe to confirm the identity of any putative C2GnT I RACE sequences. Oligonucleotides were obtained from Sigma-Genosys (St. Louis, MD). The amplifications were done using Taq DNA polymerase and buffers obtained from Takara (Otsuighiga, Japan). Briefly, two or three sequential rounds of amplification were performed. For the first round, 20-µl reactions were using the ADP1 primer CGGAATTCGTCACTCAGCG (provided with the Sure Race cDNAs) and the Core2GSP1 primer. The reaction mixtures were denatured at 94°C for 3 min, followed by 5 cycles of 94°C for 30 s; 65°C for 30 s; 72°C for 3 min; and then 15 cycles of 94°C for 30 s; 62° for 30 s; 72°C for 3 min; followed by 1 cycle of 72°C for 6 min; 4°C for 5 min. The samples were diluted to 200 µl, and 1 µl was used for the second round of amplification with the nested ADP2 primer, AGCGCGTGAATCAGATCG (supplied) and the Core2GSP2 primer. Second-round amplification conditions were: 25 cycles of 94°C for 30 s; 62°C for 30 s; 72°C for 1.5 min; followed by 1 cycle of 72°C for 6 min; 4°C for 5 min. RACE products that were isolated from gels were amplified a third time. Ten-microliter samples were analyzed by electrophoresis in a 1.2% agarose gels containing 0.5 mg/ml ethidium bromide. The gels were photographed and equilibrated in 0.4 M NaOH, and the DNA was transferred to positively charged nylon membranes (Roche, Indianapolis, IN) by capillary transfer using the same solution. Blots were UV-cross-linked with a Stratalinker (Stratagene, La Jolla, CA) and stored at –20°C until hybridized.

To test for expression from each of the 5' exons, 5' exon- specific primers sequences within each of the exons were selected to be compatible for use with Core2GSP2 as a 3' primer. The sequences of these primers are: exon A, CTGGGACCAGAAAAGGTC; exon B, TGGGCATCCTCCTGAGACT; exon D, CACGGGAAGGAAGAACT; and exon E', ACATTAAGGGAAATGCTGC.

The cap-dependent RLM RACE kit was obtained from Ambion (Austin, TX), and used per the enclosed instructions. The same gene specific primers already described were used.

Oligonucleotide probe labeling and Southern blot hybridizations
Oligonucleotides used for hybridization were labeled with digoxygenin using the DNA 3' end labeling kit from Roche. The hybridizations were done using a 1 nM probe concentration and at 57°C. Samples were processed, and the hybridization was detected by binding with an alkaline phosphatase conjugated anti-digoxygenin antibody and chemiluminescence with CDP-Star also from Roche.

Cloning and sequencing amplification products
Amplification products were cloned using the pGEM T-easy vector system (Promega, Madison, WI). Sequencing was done using the DNA sequencing facility of the Sylvester Comprehensive Cancer Center at the University of Miami School of Medicine.


    Acknowledgements
 
We would like to thank John Maher for help with the RLM RACE analysis and Claudia Garcia for excellent technical assistance with these experiments. This work was supported by a grant from the American Heart Association, Southeastern Region, to N.L.F.

1 To whom correspondence should be addressed; e-mail: nevis{at}miami.edu Back


    Abbreviations
 
C2GnT I, Core 2 ß1,6N-acetylglucosaminyltransferase I; RACE, rapid amplification of cDNA ends; RT-PCR, reverse transcription polymerase chain reaction; UTR, untranslated region.


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Baum, L.G., Pang, M., Perillo, N.L., Wu, T., Delegeane, A., Uittenbogaart, C.H., Fukuda, M., and Seilhamer, J.J.X. (1995) Human thymic epithelial cells express an endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes and T lymphoblastoid cells. J. Exp. Med., 181, 877–887.[Abstract/Free Full Text]

Beum, P.V., Singh, J., Burdick, M., Hollingsworth, M.A., and Cheng, P.W. (1999) Expression of core 2 beta-1,6-N-acetylglucosaminyltransferase in a human pancreatic cancer cell line results in altered expression of MUC1 tumor-associated epitopes. J. Biol. Chem., 274, 24641–24648.[Abstract/Free Full Text]

Bierhuizen, M.F., Maemura, K., Kudo, S., and Fukuda, M. (1995) Genomic organization of core 2 and I branching beta-1,6-N- acetylglucosaminyltransferases. Implication for evolution of the beta-1,6-N-acetylglucosaminyltransferase gene family. Glycobiology, 5, 417–425.[Abstract/Free Full Text]

Brockhausen, I., Kuhns, W., Schachter, H., Matta, K.L., Sutherland, D.R., and Baker, MA. (1991a) Biosynthesis of O-glycans in leukocytes from normal donors and from patients with leukemia: increase in O-glycan core 2 UDP-GlcNAc:Gal beta 3 GalNAc alpha-R (GlcNAc to GalNAc) beta(1–6)-N-acetylglucosaminyltransferase in leukemic cells. Cancer Res., 51, 1257–1263.[Abstract/Free Full Text]

Brockhausen, I., Romero, P.A., and Herscovics, A. (1991b) Glycosyltransferase changes upon differentiation of CaCo-2 human colonic adenocarcinoma cells. Cancer Res., 51, 3136–3142.[Abstract/Free Full Text]

Buckhaults, P., Chen, L., Fregien, N., and Pierce, M. (1997) Transcriptional regulation of N-acetylglucosaminyltransferase V by the src oncogene. J. Biol. Chem., 272, 19575–19581.[Abstract/Free Full Text]

Chen, L., Zhang, W., Fregien, N., and Pierce, M. (1998) The her-2/neu oncogene stimulates the transcription of N-acetylglucosaminyltransferase V and expression of its cell surface oligosaccharided products. Oncogene, 17, 2087–2093.[CrossRef][ISI][Medline]

Cho, M.J. and Cummings, R.D. (1994) Structure and biosynthesis of carbohydrate ligands for animal lectins involved in cell adhesion. Biochem. Soc. Trans., 22, 378–381.[ISI][Medline]

Datti, A., Orlacchio, A., Siminovitch, K.A., and Dennis, J.W. (1994) Core 2 N-acetylglucosaminyltransferase activity: a diagnostic marker for Wiskott-Aldrich syndrome. Glycosylation Dis., 1, 127–135.

Ellies, L.G., Tsuboi, S., Petryniak, B., Lowe, J.B., Fukuda, M., and Marth, J.D. (1998) Core 2 oligosaccharide biosynthesis distinguishes between selectin ligands essential for leukocyte homing and inflammation. Immunity, 9, 881–890.[CrossRef][ISI][Medline]

Galvan, M., Tsuboi, S., Fukuda, M., and Baum, L.G. (2000) Expression of a specific glycosyltransferase enzyme regulates T cell death mediated by galectin-1. J. Biol. Chem., 275, 16730–16737.[Abstract/Free Full Text]

Granovsky, M., Fode, C., Warren, C.E., Campbell, R.M., Marth, J.D., Pierce, M., Fregien, N., and Dennis, J.W. (1995) GlcNAc-transferase V and core 2 GlcNAc-transferase expression in the developing mouse embryo. Glycobiology, 5, 797–806.[Abstract/Free Full Text]

Hemmerich, S., Leffler, H., and Rosen, S.D. (1995) Structure of the O-glycans in GlyCAM-1, an endothelial-derived ligand for L-selectin. J. Biol. Chem., 270, 12035–12047.[Abstract/Free Full Text]

Hiraoka, N., Nakagawa, H., Ong, E., Akama, T.O., Fukuda, M.N., and Fukuda, M. (2000) Molecular cloning and expression of two distinct human chondroitin 4-O-sulfotransferases that belong to the HNK-1 sulfotransferase gene family. J. Biol. Chem., 275, 20188–20196.[Abstract/Free Full Text]

Kitagawa, H., Mattei, M.G., and Paulson, J.C. (1996) Genomic organization and chromosomal mapping of the Gal beta 1,3GalNAc/Gal beta 1,4GlcNAc alpha 2,3-sialyltransferase. J. Biol. Chem., 271, 931–938.[Abstract/Free Full Text]

Koya, D., Dennis, J.W., Warren, C.E., Takahara, N., Schoen, F.J., Nishio, Y., Nakajima, T., Lipes, M.A., and King, G.L. (1999) Overexpression of core 2 N-acetylglycosaminyltransferase enhances cytokine actions and induces hypertrophic myocardium in transgenic mice. FASEB J., 13, 2329–2337.[Abstract/Free Full Text]

Koyama, N., Miyoshi, E., Ihara, Y., Kang, R., Nishikawa, A., and Taniguchi, N. (1996) Human N-acetylglucosaminyltransferase III gene is transcribed from multiple promoters. Eur. J. Biochem., 238, 853–861.[ISI][Medline]

Lefebvre, J.-C., Giordanengo, V., Limouse, M., Doglio, A., Cucchiarini, M., Monpoux, F., Mariani, R., and Peyron, J.-F. (1994) Altered glycosylation of leukosialin, CD43, in HIV-1-infected cells of the CEM line. J. Exp. Med., 180, 1609–1617.[Abstract/Free Full Text]

Lo, N.W. and Lau, J.T. (1996) Novel heterogeneity exists in the 5'-untranslated region of the beta-galactoside alpha 2,6-sialytransferase mRNAs in the human B-lymphoblastoid cell line, louckes. Biochem. Biophys. Res. Commun., 228, 380–385.[CrossRef][ISI][Medline]

Lo, N.W. and Lau, J.T. (1999) Transcription of the beta-galactoside alpha2,6-sialyltransferase gene (SIAT1) in B-lymphocytes: cell type-specific expression correlates with presence of the divergent 5'-untranslated sequence. Glycobiology, 9, 907–914.[Abstract/Free Full Text]

Machida, E., Nakayama, J., Amano, J., and Fukuda, M. (2001) Clinicopathological significance of core 2 beta1,6-N-acetylglucosaminyltransferase messenger RNA expressed in the pulmonary adenocarcinoma determined by in situ hybridization. Cancer Res., 61, 2226–2231.[Abstract/Free Full Text]

Nakamura, M., Kudo, T., Narimatsu, H., Furukawa, Y., Kikuchi, J., Asakura, S., Yang, W., Iwase, S.H., and Miura, Y. (1998) Single glycosyltransferase, core 2 beta1->6-N-acetylglucosaminyltransferase, regulates cell surface sialyl-Lex expression level in human pre-B lymphocytic leukemia cell line KM3 treated with phorbolester. J. Biol. Chem., 273, 26779–26789.[Abstract/Free Full Text]

Nishio, Y., Warren, C.E., Buczek-Thomas, J.A., Rulfs, J., Koya, D., Aiello, L.P., Feener, E.P., Miller, T.B. Jr., Dennis, J.W., and King, G.L. (1995) Identification and characterization of a gene regulating enzymatic glycosylation which is induced by diabetes and hyperglycemia specifically in rat cardiac tissue. J. Clin. Invest., 96, 1759–1767.[ISI][Medline]

Piller, F., Piller, V., Fox, R.I., and Fukuda, M. (1988) Human T-lymphocyte activation is associated with changes in O-glycan biosynthesis. J. Biol. Chem., 263, 15146–15150.[Abstract/Free Full Text]

Rajput, B., Shaper, N.L., and Shaper, J.H. (1996) Transcriptional regulation of murine beta1,4- galactosyltransferase in somatic cells. Analysis of a gene that serves both a housekeeping and a mammary gland-specific function. J. Biol. Chem., 271, 5131–5142.[Abstract/Free Full Text]

Renkonen, J., Rabina, J., Mattila, P., Grenman, R., and Renkonen, R. (2001) Core 2 beta1,6-N-acetylglucosaminyltransferases and alpha1,3-fucosyltransferases regulate the synthesis of O-glycans on selectin ligands on oral cavity carcinoma cells. Apmis, 109, 500–506.[CrossRef][ISI][Medline]

Rosen, S.D. and Bertozzi, C.R. (1994) The selectins and their ligands. Curr. Opin. Cell Biol., 6, 663–673.[CrossRef][ISI][Medline]

Saito, H., Gu, J., Nishikawa, A., Ihara, Y., Fujii, J., Kohgo, Y., and Taniguchi, N. (1995) Organization of the human N-acetylglucosaminyltransferase V gene. Eur. J. Biochem., 233, 18–26.[ISI][Medline]

Saitoh, O., Piller, F., Fox, R.I., and Fukuda, M. (1991) T-lymphocytic leukemia expresses complex, branched O-linked oligosaccharides on a major sialoglycoprotein, leukosialin. Blood, 77, 1491–1499.[Abstract/Free Full Text]

Schwientek, T., Yeh, J.C., Levery, S.B., Keck, B., Merkx, G., van Kessel, A.G., Fukuda, M., and Clausen, H. (2000) Control of O-glycan branch formation. Molecular cloning and characterization of a novel thymus-associated core 2 beta1,6-n-acetylglucosaminyltransferase. J. Biol. Chem., 275, 11106–11113.[Abstract/Free Full Text]

Sekine, M., Nara, K., and Suzuki, A. (1997) Tissue-specific regulation of mouse core 2 beta-1,6-N-acetylglucosaminyltransferase. J. Biol. Chem., 272, 27246–27252.[Abstract/Free Full Text]

Shimodaira, K., Nakayama, J., Nakamura, N., Hasebe, O., Katsuyama, T., and Fukuda, M. (1997) Carcinoma-associated expression of core 2 beta-1,6-N-acetylglucosaminyltransferase gene in human colorectal cancer—role of O-glycans in tumor progression. Cancer Res., 57, 5201–5206.[Abstract/Free Full Text]

Sperandio, M., Forlow, S.B., Thatte, J., Ellies, L.G., Marth, J.D., and Ley, K. (2001) Differential requirements for core2 glucosaminyltransferase for endothelial L-selectin ligand function in vivo. J. Immunol., 167, 2268–2274.[Abstract/Free Full Text]

Tsuboi, S. and Fukuda, M. (2001) Roles of O-linked oligosaccharides in immune responses. Bioessays, 23, 46–53.[CrossRef][ISI][Medline]

VanderElst, I.E. and Datti, A. (1998) Beta1,6 N-acetylglucosaminyltransferase (core 2 GlcNAc-T) expression in normal rat tissues and different cell lines: evidence for complex mechanisms of regulation. Glycobiology, 8, 731–740.[Abstract/Free Full Text]

Wilkins, P.P., McEver, R.P., and Cummings, R.D. (1996) Structures of the O-glycans on P-selectin glycoprotein ligand-1 from HL-60 cells. J. Biol. Chem., 271, 18732–18742.[Abstract/Free Full Text]

Yeh, J.C., Ong, E., and Fukuda, M. (1999) Molecular cloning and expression of a novel beta-1, 6-N-acetylglucosaminyltransferase that forms core 2, core 4, and I branches. J. Biol. Chem., 274, 3215–3221.[Abstract/Free Full Text]

Yousefi, S., Higgins, E., Daoling, Z., Pollex-Kruger, A., Hindsgaul, O., and Dennis, J.W. (1991) Increased UDP-GlcNAc:Gal beta 1-3GaLNAc-R (GlcNAc to GaLNAc) beta-1,6-N-acetylglucosaminyltransferase activity in metastatic murine tumor cell lines. Control of polylactosamine synthesis. J. Biol. Chem., 266, 1772–1782.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. Tan and P.-W. Cheng
Mucin Biosynthesis: Identification of the cis-Regulatory Elements of Human C2GnT-M Gene
Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 737 - 745.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Sekine, C. Taya, H. Shitara, Y. Kikkawa, N. Akamatsu, M. Kotani, M. Miyazaki, A. Suzuki, and H. Yonekawa
The cis-Regulatory Element Gsl5 Is Indispensable for Proximal Straight Tubule Cell-specific Transcription of Core 2 beta-1,6-N-Acetylglucosaminyltransferase in the Mouse Kidney
J. Biol. Chem., January 13, 2006; 281(2): 1008 - 1015.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
P. K. Grewal, J. M. McLaughlan, C. J. Moore, C. A. Browning, and J. E. Hewitt
Characterization of the LARGE family of putative glycosyltransferases associated with dystroglycanopathies
Glycobiology, October 1, 2005; 15(10): 912 - 923.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. H. Choi, F. A. Osorio, and P.-W. Cheng
Mucin Biosynthesis: Bovine C2GnT-M Gene, Tissue-Specific Expression, and Herpes Virus-4 Homologue
Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 710 - 719.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/6/411    most recent
cwg039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Falkenberg, V. R.
Right arrow Articles by Fregien, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Falkenberg, V. R.
Right arrow Articles by Fregien, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?