Skip Navigation


Glycobiology Advance Access originally published online on December 17, 2002
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/5/327    most recent
cwg030v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (30)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 5 327-337
© 2003 Oxford University Press

Characterization of the rat {alpha}(1,3)galactosyltransferase: evidence for two independent genes encoding glycosyltransferases that synthesize Gal{alpha}(1,3)Gal by two separate glycosylation pathways

Simon G. Taylor, Ian F.C. Mckenzie and Mauro S. Sandrin1

John Connell Laboratory for Glycobiology, Austin Research Institute, Austin and Repatriation Medical Centre, Heidelberg, VIC, 3084, Australia

Received on July 9, 2002; revised on November 12, 2002; accepted on November 12, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The important xenoepitope Gal{alpha}(1,3)Gal was thought to be exclusively synthesized by a single {alpha}(1,3)galactosyltransferase. However, the cloning of the distant family member rat iGb3 synthase, which is also capable of synthesizing Gal{alpha}(1,3)Gal as the glycolipid structure iGb3, challenges the notion that {alpha}(1,3)galactosyltransferase is the sole Gal{alpha}(1,3)Gal-synthesizing enzyme. We describe the cloning of the rat homolog of {alpha}(1,3)galactosyltransferase, showing that indeed the rat expresses two distinct {alpha}(1,3)galactosyltransferases, {alpha}(1,3)GT and iGb3 synthase. Rat {alpha}(1,3)galactosyltransferase shows a high amino acid sequence identity with the {alpha}(1,3)galactosyltransferase of mouse (90%), pig (76%), and ox (75%), in contrast to the low amino acid sequence identity (42%) with iGb3 synthase. The rat {alpha}(1,3)galactosyltransferase is expressed in heart, brain, spleen, kidney, and liver and has a similar intron/exon structure to the mouse {alpha}(1,3)galactosyltransferase. Transfection studies show that in contrast to the iGb3 synthase, rat {alpha}(1,3)galactosyltransferase can synthesize Gal{alpha}(1,3)Gal on glycoproteins but cannot synthesize the glycolipid iGb3, defining two separate glycosylation pathways for the synthesis of Gal{alpha}(1,3)Gal. Furthermore iGb3 synthase was found to be distinct from {alpha}(1,3)GT with its ability to synthesize poly-{alpha}-Gal glycolipid structures.

Key words: {alpha}1,3galactosyltransferase / Gal{alpha}(1,3)Gal / glycolipid / xenotransplantation


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Carbohydrates are found in abundance at the surface of mammalian cells, where they are able to interface with the extracellular environment. They are capable of forming complex structures, displayed on protein and lipid backbones, and are potential epitopes that the immune system can utilize in the determination of self versus nonself.

The ABO blood group antigens are carbohydrate structures that, if mismatched during transplantation, can elicit a strong antibody mediated rejection process known as hyperacute rejection (HAR) (Nelson et al., 1992Go; Williams et al., 1968Go). Likewise, the carbohydrate epitope Gal{alpha}(1,3)Gal, found on the cell surface of pig tissue, also causes HAR during pig-to-human xenotransplantation, mediated by naturally occurring human preformed anti-Gal{alpha}(1,3)Gal antibodies (Sandrin and McKenzie, 1999Go; Sandrin et al., 1993Go, 1994bGo). For xenotransplantation to become a clinical reality, HAR must be overcome. Hence an active area of xenotransplantation is the characterization of Gal{alpha}(1,3)Gal glycoconjugates and their synthesis.

Gal{alpha}(1,3)Gal is synthesized by the transferase {alpha}(1,3)galactosyltransferase ({alpha}(1,3)GT) which, like many other glycosylating enzymes, resides within the Golgi of the cell. It catalyzes the biochemical reaction on glycoproteins and glycolipids, transferring a UDP-galactose to N-acetyllactosamine (NAcLac) in an {alpha}(1,3) linkage to form Gal{alpha}(1,3)Gal (Blanken and Van den Eijnden, 1985Go). The amino acid sequence of {alpha}(1,3)GT shares a high degree of homology with other cloned glycosyltransferases, including the A and B blood group transferases and Forssman synthase, all of which can be classified in the {alpha}(1,3)Gal/GalNAc transferase family. In many species Gal{alpha}(1,3)Gal was thought solely to be synthesized by one gene, the {alpha}(1,3)GT, but the recent cloning of rat iGb3 (isoglobotriaosylceramide) synthase (iGb3S) (Keusch et al., 2000bGo), which also synthesizes Gal{alpha}(1,3)Gal, has suggested otherwise. The amino acid sequence of iGb3S has a much lower identity (~40%) compared with other mammalian {alpha}(1,3)GT transferases, such as pig, ox, and mouse, although still enough to classify it in the {alpha}(1,3)Gal/GalNAc transferase family. Functionally, iGb3S is unique in synthesizing the glycolipid structure iGb3, transferring an {alpha}-Gal from UDP-Gal to lactosyl-ceramide (Keusch et al., 2000bGo). Synthesis of iGb3 is the initial committed step in the formation of the isoglobo-series glycolipid pathway and is the precursor to isogloboside (iGb4) and isoForssman (Keusch et al., 2000bGo). To date, iGb3S is the only known transferase in rat to catalyze the formation of Gal{alpha}(1,3)Gal.

At least two Gal{alpha}(1,3)Gal glycolipid structures have been isolated in the rat. The first is iGb3, the other is Gal{alpha}(1,3) Galß(1,4)GlcNAc{alpha}(1,3)Galß(1,4)Glcß1Cer (Gal{alpha}(1,3)nLc4) (Ogiso et al., 1995aGo,bGo). Gal{alpha}(1,3)nLc4 is a well-characterized Gal{alpha}(1,3)Gal glycolipid structure isolated from many species that is synthesized by the {alpha}(1,3)GT (Basu and Basu, 1973Go; Blanken and Van den Eijnden, 1985Go). This raises an important question of whether iGb3S is the only Gal{alpha}(1,3)Gal synthesizing transferase in rat or whether the rat expresses the {alpha}(1,3)GT homolog as found in other species. It was assumed by Keusch et al. (2000b)Go that the rat iGb3S was a different enzyme from {alpha}(1,3)GT; to investigate this and formally show the presence of two {alpha}1,3galactosyltransferases in one species, clones encoding rat {alpha}(1,3)GT were isolated from spleen cell mRNA using reverse-transcription polymerase chain reaction (RT-PCR) and oligonucleotide primers to the mouse {alpha}(1,3)GT. These were characterized and their expression and function compared to that of rat iGb3S. The finding of two {alpha}1,3galactosyltransferases has significant implications for xenotransplantation, where major efforts have been directed to the production of cloned pigs with an inactivated {alpha}(1,3)GT with a view toward producing Gal{alpha}(1,3)Gal- pigs.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Isolation of the rat cDNA encoding the {alpha}(1,3)GT
To clone the rat {alpha}(1,3)GT the cDNA sequence of the mouse {alpha}(1,3)GT (Larsen et al., 1989Go) was used with oligonucleotide primers designed to the 5' and 3' ends of the coding sequence. The rational for using mouse {alpha}(1,3)GT was its likelihood of sharing the highest homology to the rat {alpha}(1,3)GT. PCR using the oligonucleotide primers and rat spleen cDNA was used to isolate a ~1-kb fragment that was amplified and subcloned into the expression vector pCDNA1. Two independent clones were sequenced in both the 3' and 5' directions. The nucleotide sequence of the rat {alpha}(1,3)GT (GenBank assession number AF488784) contains an open reading frame of 1014 bp encoding a protein of 337 amino acids (Figure 1). The predicted protein sequence for rat {alpha}(1,3)GT suggests a type II integral membrane protein typical of a Golgi resident glycosyltransferase. There are three distinct structural features of the predicted protein: (1) a short (6 amino acid) amino terminal cytoplasmic tail; (2) a putative transmembrane region of 16 hydrophobic amino acids (residues 7–22), flanked on either side by charged amino acid residues; and (3) a 315 amino acid carboxy terminal domain that contains two potential N-linked glycosylation sites (residues 26 and 261). The catalytic domain was determined based on the conserved DXD motif (residues 194–196), a characteristic of all {alpha}(1,3)Gal/GalNAc transferases.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1. cDNA squence of r{alpha}(1,3)GT. The predicted amino acid sequence is designated above the nucleotide sequence as a single letter code. The putitive transmembrane domain (underscored) and the theoretical N-glycosylation sites (carets) are also shown. The DXD motif is marked (asterisks), and the errors in the 3' region due to mouse {alpha}(1,3)GT primers are underscored.

 
Genomic analysis of the rat {alpha}(1,3)GT gene
A DNA blot of genomic DNA isolated from rat spleen cells probed with rat {alpha}(1,3)GT cDNA (Figure 2, lane 1) shows three bands after digestion with PvuII: 3.8 kb, 2.5 kb, and 1.7 kb. The two lower bands were of similar sizes to mouse DNA digested with the same enzyme (Figure 2, lane 2). In contrast, probing with iGb3S cDNA showed four bands: 1.1 kb, 0.6 kb, 0.3 kb, and 0.2 kb (Figure 2, lane 3). The rat {alpha}(1,3)GT cDNA was unable to cross-hybridize with the bands detected by iGb3S cDNA, showing that the two probes are detecting different DNA sequences in the rat genome. Furthermore, the banding pattern shows that the rat {alpha}(1,3)GT sequence is more similar to {alpha}(1,3)GT detected in mouse than to the rat iGb3S sequence.



View larger version (89K):
[in this window]
[in a new window]
 
Fig. 2. Southern blot comparing rat {alpha}(1,3)GT and iGb3S. Rat (lanes 1 and 3) or mouse (lane 2) genomic DNA was digested with PvuII and hybridized with either the cDNA of rat {alpha}(1,3)GT (lane 1 and 2) or iGb3S (lane 3).

 
The rat genomic {alpha}(1,3)GT sequence was obtained by searching the rat genomic database (Trace Archive database, www.ncbi.nih.gov/blast/mmtrace.html) using the cloned {alpha}(1,3)GT cDNA sequence as the reference. The retrieved sequences matched exactly the isolated rat {alpha}(1,3)GT cDNA sequence, except for the 3' end where the mouse {alpha}(1,3)GT–designed primer annealed to the template during PCR amplification. This introduced three mismatches between the genomic and cloned nucleotide sequence G-T (999 nt), G-A (1004 nt), and C-T (1005 nt) (Figure 1). Two of the nucleotide changes were silent (at 999 nt and 1005 nt), but the nucleotide change at 1004 nt caused a primary amino acid change of S335-N. It would be unlikely for the residue change to cause the tranferase any gross functional differences because N335 is a conserved residue found in mouse, pig, and ox {alpha}(1,3)GT.

From the genomic sequence of rat {alpha}(1,3)GT the gene's exon/intron boundaries were elucidated and showed a preservation and arrangement of exons identical to that of mouse {alpha}(1,3)GT (Table I). The rat {alpha}(1,3)GT coding region is encoded by six exons: exons 4, 5, 6, 7, 8, and 9 (based on the numbering of mouse {alpha}(1,3)GT). Compared to the mouse, exons 5 and 7 have minor base changes at their exon splice boundaries (Table I). The isolated cDNA sequence represents an mRNA splice variant that lacks exons 5 and 6; thus, the nucleotide changes in exon 5 and 7 splice boundaries do not seem to affect splicing at these sites. This is consistent with observations in the mouse, in which a number of mRNA splice isoforms are found, with the splicing out of either exon 5, exon 6, or both (Joziasse et al., 1992Go).


View this table:
[in this window]
[in a new window]
 
Table I. Intron-exon boundaries of coding exons of the rat {alpha}1,3GT gene

 
The relationship of rat {alpha}(1,3)GT with other {alpha}(1,3)GTs and iGb3S
The predicted amino acid sequence using the genomic rat (1,3)GT sequence (including exons 5 and 6) was aligned with four other known transferase family members (Figure 3). The alignment shows rat {alpha}(1,3)GT has a very high amino acid identity with mouse, pig, and ox {alpha}(1,3)GT: 90%, 76%, and 75%, respectively. However, the rat {alpha}(1,3)GT differs from rat iGb3S with an overall identity of 42%. Furthermore, the identity between rat {alpha}(1,3)GT and iGb3S catalytic domains, encoded within exons 8 and 9, shows 51% identity. In contrast, amino acid identity was not observed within the N-terminal end of the two proteins: the cytoplasmic tail, transmembrane, and stem regions. Clearly, based on amino acid alignments and identity, the rat {alpha}(1,3)GT is closer to {alpha}(1,3)GT from other species than to rat iGb3S.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 3. The predicted amino acid comparison of rat {alpha}(1,3)GT. The predicted amino acid alignment from the genomic rat sequence comparing rat {alpha}(1,3)GT with mouse, pig, and ox {alpha}(1,3)GT and iGb3S. The identical residues between species are boxed.

 
RNA analysis by northern blot
The transcripts of rat {alpha}(1,3)GT and iGb3S were determined on a multitissue northern blot (Figure 4). Rat {alpha}(1,3)GT showed a single band of ~3.1 kb (Figure 4A). This is similar to the mRNA sizes observed with mouse {alpha}(1,3)GT 3.6 kb (Joziasse et al., 1992Go; Larsen et al., 1989Go), ox {alpha}(1,3)GT 3.6–3.9 kb (Joziasse et al., 1989Go), and pig {alpha}(1,3)GT 3.9 kb (Sandrin et al., 1994aGo) and suggests that, like other species, the rat {alpha}(1,3)GT contains a large 3' untranslated region. The iGb3S shows two bands, one of ~4.0 kb and the other of ~1.8 kb (Figure 4B). The reason for two transcripts of iGb3S is unclear but could be a consequence of the two transcripts possessing different 3' untranslated regions. Both rat {alpha}(1,3)GT and iGb3S were expressed in heart, brain, spleen, lung, and kidney (Figure 4) with rat {alpha}(1,3)GT expression being higher in spleen, whereas iGb3S expression was higher in lung. Liver was the only tissue that expressed rat {alpha}(1,3)GT but not iGb3S. In skeletal muscle and testis, expression of either transferase was not detected. Therefore, from the northern blot analysis, it is apparent that the rat {alpha}(1,3)GT and iGb3S differ in their transcript size, number, and pattern of tissue expression.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 4. Multitissue northern blot comparing rat {alpha}(1,3)GT and iGb3S expression. Poly A+ RNA purified from eight rat tissues—heart (lane 1), brain (lane 2), spleen (lane 3), lung (lane 4), liver (lane 5), skeletal muscle (lane 6), kidney (lane 7), and testis (lane 8)—was hybridized with either the cDNA of rat {alpha}(1,3)GT (A) or iGb3S (B).

 
Expression studies
To demonstrate that the rat {alpha}(1,3)GT cDNA is functional and can lead to the expression of Gal{alpha}(1,3)Gal, transfection studies were performed with Chinese hamster ovary cells transformed with the polyoma large T antigen (CHOP cells), which do not endogenously express Gal{alpha}(1,3)Gal. The Gal{alpha}(1,3)Gal epitope was detected on the surface of the cells by the binding of the fluorescent-labeled isolectin IB4 from Griffonia simplicifolia (IB4). Rat {alpha}(1,3)GT (Figure 5) showed a similar level of cell surface Gal{alpha}(1,3)Gal expression when compared with mouse {alpha}(1,3)GT (Figure 5), whereas iGb3S (Figure 5) showed lower Gal{alpha}(1,3)Gal expression. The lower expression level of iGb3 could be explained by the two rat transferases synthesizing Gal{alpha}(1,3)Gal by different biochemical pathways.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. Cell surface Gal{alpha}(1,3)Gal expression comparing rat {alpha}(1,3)GT and iGb3S. CHOP cells were transfected with 1 µg of DNA of the following constructs: rat {alpha}(1,3)GT, mouse {alpha}(1,3)GT, iGb3S, mock (pCDNA1); 48 h posttransfection they were cell surfaced stained with IB4-FITC and fluorescence measured by FACS analysis. Transfected cells ( thick line) and mock-transfected (thin line).

 
To investigate whether rat {alpha}(1,3)GT and iGb3S were functionally different, the ability of the transferases to synthesize iGb3 was monitored by the downstream expression of the isoglobo-series glycolipid pathway (Keusch et al., 2000bGo). The transferases were coexpressed with the Forssman synthase and detected using an anti-Forssman/isoForssman antibody. Interestingly, our CHOP cell line did not express the Forssman synthase endogenously, and it had to be cotransfected into the cells; this was in contrast to Keusch et al. (2000a)Go. IsoForssman expression only occurred when iGb3S was present, due to the synthesis of the iGb3 structure and initiation of the isoglobo-series glycolipid pathway (Figure 6). The lack of isoForssman expression for rat {alpha}(1,3)GT (Figure 6) was not surprising and supported the conclusion that this is the {alpha}(1,3)GT homolog, a distinct transferase from iGb3S. A similar observation for the lack of isoForssman expression was shown when mouse {alpha}(1,3)GT was expressed in CHO cells (Keusch et al., 2000bGo).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. Cell surface isoForssman expression for rat {alpha}(1,3)GT and iGb3S. CHOP cells were cotransfected with equal ratios of each construct of either pCDNA1 with either rat {alpha}(1,3)GT, iGb3S, or dog Forssman synthase with either rat {alpha}(1,3)GT or iGb3S. Posttranfection (48 h), cells were stained using an anti-isoForssman/Forssman antibody and fluorescence measured by FACS analysis. Transfected cells and nontransfected cells (thick line), pCDNA1 alone (thin line).

 
Immunoprecipitation of Gal{alpha}(1,3)Gal containing glycoproteins
Rat {alpha}(1,3)GT and iGb3S have clear differences in their ability to galactosylate glycolipids of the isoglobo-series glycolipid pathway, with only the iGb3S having the capability of forming iGb3 causing downstream expression of isoForssman. To investigate the role each transferase contributes to the glycosylation of glycoproteins, proteins immunoprecipitated from CHOP cells expressing either transferase were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and western blot. The rat {alpha}(1,3)GT and mouse {alpha}(1,3)GT showed identical patterns of glycosyltation with protein bands at approximately 120 kDa, 90 kDa, and 52 kDa binding to the IB4 lectin (Figure 7, lanes 2 and 3). The interaction was specific for Gal{alpha}(1,3)Gal as determined by inhibition with melibiose (Figure 7, lanes 5–8), a carbohydrate structure capable of blocking the Gal{alpha}(1,3)Gal–IB4 interaction. However Gal{alpha}(1,3)Gal containing protein could not be immunoprecipitated and detected from iGb3S-transfected cell lysates (Figure 7, lane 4). Thus, as expected, the rat {alpha}(1,3)GT, like {alpha}(1,3)GT from other species, was able to synthesize Gal{alpha}(1,3)Gal on glycoproteins destined for the cell surface, whereas iGb3S only appears capable of synthesizing Gal{alpha}(1,3)Gal on glycolipids. This distinguishes the two tranferases as having different glycosylation pathways.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 7. Immunoprecitation of cell surface Gal{alpha}(1,3)Gal expressing glycoproteins. CHOP cells were transfected with either pCDNA1 (lanes 1 and 5), mouse {alpha}(1,3)GT (lanes 2 and 6), rat {alpha}(1,3)GT (lanes 3 and 7), or iGb3S (lanes 4 and 8) and then immunoprecipitated with IB4-conjugated Sepharose beads. Binding was determined to be Gal{alpha}(1,3)Gal specific by competitive binding with 100 mM melibiose (lanes 5–8).

 
Glycolipid analysis of rat {alpha}(1,3)GT and iGb3S
To compare the synthesis of {alpha}-Gal glycolipids in vivo by the two rat transferases, transfected CHOP cells were metabolically labeled with 3H-Gal and the glycolipids extracted and size separated by high-performance thin-layer chromatography (HPTLC) (Figure 8). Mock-transfected cells show three doublet bands corresponding to one, two, and five neutral sugars (Figure 8, lane 1). Glycolipids with identical carbohydrate structures often migrate as doublets because differences in their lipid tail composition subtly influences their migration properties (this is a common observation of cellular glycolipid extracts (Schnaar, 1994Go). The two doublets migrating further than Gal{alpha}(1,4)Galß(1,4)Glcß1Cer (Gb3) correspond to Galß1Cer and Lac-Cer. The third doublet migrating just above Gal{alpha}(1,3)nLc4 corresponds to GM3, which was supported by its resistance to {alpha}-galactosidase, ß-galactosidase, {alpha}-N-acetylgalactosaminidase (not shown). This is in agreement with other investigators who have shown that CHO cells synthesize simple glycolipids up to Lac-Cer and also GM3 (Keusch et al., 2000aGo,bGo; Rosales Fritz et al., 1997Go). When CHOP cells were transfected with iGb3S, a very faint doublet migrating with Gb3 corresponding to iGb3 was present together with a stronger doublet below Gb3 corresponding to iGb4 and a large array of bands migrating with Gal{alpha}(1,3)nLc4 and below (Figure 8, lane 2). The strong iGb4 doublet is caused by the endogenous expression of the Gb4 synthase (Gb4S) in CHOP cells, converting already synthesized iGb3 into iGb4 by the addition of a GalNAc, and accounts in part for the faint iGb3 banding observed. Expression of Gb4S is not surprising because it is essential to the synthesis of iGb4, the required structure for Forssman synthase to synthesize isoForssman when iGb3S and Forssman synthase are cotransfected (Figure 6), completing the isoglobo-series pathway. In contrast, glycolipids extracted from rat {alpha}(1,3)GT-transfected cells showed the same banding pattern as mock-transfected cells. This was also observed when pig and mouse {alpha}(1,3)GT were transfected (not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 8. Glycolipid analysis of iGb3S. CHOP cells were transfected with either pCDNA1 (lane 1) or iGb3S (lane 2). The cells were metabolically radiolabeled with 3H-Gal and the glycolipids extracted. The extracted lipids were resolved on HPTLC plates in chloroform:methanol:water (65:35:8). To determine the number of neutral sugars present, purified rabbit red blood cell glycolipids containing Gb3 and Gal{alpha}(1,3)nLc4 were used. The iGb3 band was extremely faint on the autoradiograph, and its position on the plate has been marked (asterisk). The iGb4 doublet is slightly masked by the GM3 doublet (the bottom iGb4 doublet band is merging with the top GM3 doublet band).

 
Thus {alpha}(1,3)GTs are incapable of forming iGb3 to any detectable level and, perhaps more importantly, cannot cause the downstream synthesis of the iGb4 structure. Furthermore, at least in CHOP cells, a delineation can be made between {alpha}(1,3)GT and iGb3 with {alpha}(1,3)GT restricted to glycosylating proteins while iGb3S is restricted to the glycosylation of glycolipids. It should be noted that although {alpha}(1,3)GT is cabable of glycosylating glycolipids, the simplest of which is Gal{alpha}(1,3)nLc4, this structure is not synthesized in {alpha}(1,3)GT transfected CHOP cells because of their limited synthesis of glycolipid structures and the absence of the neolacto-series lacto-series glycolipid precursors needed for {alpha}(1,3)GT to synthesize Gal{alpha}(1,3)Gal as Gal{alpha}(1,3)nLc4/Lc4.

One interesting finding was the large array of bands formed by iGb3S expression migrating at and below Gal{alpha}(1,3)nLc4 (Figure 8, lane 2). These glycolipids are either due to the direct glycosylation by iGb3S using its own synthesized product as an acceptor or the action of another endogenous transferase using iGb3 as an acceptor. To investigate this further, Gb3 synthase (Gb3S) glycolipid expression was compared with iGb3S. Apart from the isoglobo-series pathway in which iGb3S synthesizes an {alpha}(1,3)Gal linkage, an analogous pathway exists, the globo-series pathway, in which Gb3S synthesizes an {alpha}(1,4)Gal linkage to Lac-Cer (Keusch et al., 2000aGo). Expression of Gb3S enables the downstream expression of Forssman. The glycolipids isolated from Gb3S expressing CHOP cells show similarities and differences in the banding pattern compared to iGb3S expressing cells (Figure 9, lanes 1 and 3). Similar to iGb3S, there is the presence of a doublet migrating with CTH, corresponding to Gb3 and a second doublet migrating below Gb3 corresponding to Gb4, although in both cases much more intense. In contrast, there are no bands migrating at or below Gal{alpha}(1,3)nLc4 as is observed for iGb3S. The greater intensity of the Gb3 and Gb4 band can be explained by the inability of Gb3S to synthesize the large array of glycolipid structures migrating at or below Gal{alpha}(1,3)nLc4 seen for iGb3S. Therefore Gb3 can only be converted toGb4, whereas iGb3 is converted to multiple glycolipid products migrating below Gal{alpha}(1,3) nLc4, hence depleting the amount of steady-state iGb3 present in the cell. This does, however, assume that these glycolipid structures are caused by the direct utilization of the iGb3 structure. When iGb3S and Gb3S glycolipids are treated with coffee bean {alpha}-galactosidase (Figure 9, lanes 2 and 4), which can cleave {alpha}-Gal, the iGb3S bands migrating below Gal{alpha}(1,3)nLc4 were cleaved (Figure 9, lane 2) and converted back to Lac-Cer, shown by a significant intensity increase in this doublet. This shows that these structures are in fact a direct utilization of iGb3. In contrast, in Gb3S-expressing cells Gb3 was sensitive due to the cleavage of {alpha}(1,4)Gal (Figure 9, lane 4). This shows the existence of large {alpha}-Gal linked glycolipids derived from iGb3, which are either synthesized by iGb3S or by the action of another transferase endogenous in CHOP cells, which can only utilize iGb3 and not Gb3.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 9. Glycolipid enzyme digestion comparision of rat iGb3S and rat Gb3S. CHOP cells were transfected with either iGb3S (lanes 1 and 2) or Gb3S (lanes 3 and 4). The cells were metabolically radiolabeled with 3H-Gal and the glycolipids extracted. The extracted lipids were resolved on HPTLC plates in chloroform:methanol:water (65:35:8). To determine the number of neutral sugars present, purified rabbit red blood cell glycolipids containing Gb3 and Gal{alpha}(1,3)nLc4 were used. The glycolipids were also digested using coffee bean {alpha}-galactosidase (lanes 2 and 4). The iGb3 band was too faint to be detected on this plate. The iGb4 doublet is slightly masked by the GM3 doublet (the bottom iGb4 doublet band is merging with the top GM3 doublet band).

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
In most species Gal{alpha}(1,3)Gal is thought to be synthesized by a single transferase, {alpha}(1,3)GT. In rats, iGb3S (Keusch et al., 2000bGo) was the only known Gal{alpha}(1,3)Gal synthesizing tranferase, but it was unclear whether this was the only transferase capable of synthesizing Gal{alpha}(1,3)Gal or if another transferase existed that could also synthesize this epitope. The cloning of the rat {alpha}(1,3)GT homolog described herein, which can synthesize Gal{alpha}(1,3)Gal, shows that there are two Gal{alpha}(1,3)Gal synthesizing genes in the rat: {alpha}(1,3)GT and iGb3S. Furthermore, rat {alpha}(1,3)GT is the homologous gene in the rat as those described in many other species (Joziasse et al., 1989Go; Larsen et al., 1989Go; Sandrin et al., 1994aGo).

Rat {alpha}(1,3)GT has a more similar genomic sequence and genetic structure to mouse {alpha}(1,3)GT than iGb3S, as shown by Southern blot analysis using restriction mapping with PvuII (Figure 2). This becomes more apparent when comparing the conservation of exon boundaries and number of exons present for rat {alpha}(1,3)GT and mouse {alpha}(1,3)GT (Figure 3). Interestingly, the rat {alpha}(1,3)GT clone isolated here (Figure 1) lacks exons 5 and 6, a feature not uncommon to {alpha}(1,3)GT cDNA clones isolated from mouse and pig (Joziasse et al., 1992Go; Vanhove et al., 1997Go). This provides evidence that, like mouse and pig, {alpha}(1,3)GT in the rat may express other mRNA splice variants of exons 5, 6, or 7. The amino acid alignments (Figure 3) between rat {alpha}(1,3)GT and other {alpha}(1,3)GT of other species, such as mouse, ox, and pig, typically shows >70% identity. This clearly defines this transferase to be the {alpha}(1,3)GT homolog in rats. Rat iGb3S, on the other hand, has a much lower identity, ~40%, indicating that the two transferases, {alpha}(1,3)GT and iGb3S, probably diverged in the rat from a single ancestral gene to take up different functions within the rat. This is further supported by the differential expression of the two transferases shown by northern blot analysis (Figure 4).

The rat {alpha}(1,3)GT is functionally active and capable of transferring {alpha}-Gal to glycoconjugates, forming Gal{alpha}(1,3)Gal on the cell surface of transfected CHOP cells, as is found for mouse {alpha}(1,3)GT and to a lesser extent, iGb3S (Figure 5). What makes rat {alpha}(1,3)GT distinct from iGb3S is its inability to cause the downstream synthesis of isoForssman (Figure 6), or to transfer an {alpha}-Gal to Lac-Cer to form the isoglobo-series glycolipid structure iGb3 (Figure 8). Furthermore, rat {alpha}(1,3)GT is capable of synthesizing Gal{alpha}(1,3)Gal on glycoproteins, a function not detected for iGb3S (Figure 7). This evidence unequivocally leads us to conclude that rat {alpha}(1,3)GT and iGb3S are functionally distinct transferases synthesizing Gal{alpha}(1,3)Gal by very different biochemical pathways.

The inability of iGb3S to glycosylate glycoproteins was based on IB4 binding to Gal{alpha}(1,3)Gal structures in western blots (Figure 7). Unfortunately IB4 was less effective at detecting iGb3S derived cell surface Gal{alpha}(1,3)Gal compared to rat {alpha}(1,3)GT (Figure 5) and may therefore not be as sensitive at detecting such structures. To improve the detection, a mouse monoclonal antibody specific for Gal{alpha}(1,3)Gal that detects iGb3S synthesized structures on transfected cells more effectively than for rat {alpha}(1,3)GT derived structures was also used in parallel for the immunoprecipiation studies. The result obtained (not shown) confirmed the IB4 data shown here (Figure 7). Previously, Keusch et al. (2000b)Go, used an inhibitor of glucosylceramide synthase, phenyl-2-hexadecanoylamino-3-pyrrolidino-1-propanol to block glycolipid synthesis on iGb3S expressing CHO cells. Surprisingly, levels of Gal{alpha}(1,3)Gal expression were still detected despite the use of this inhibitor. The results were attributed to either Gal{alpha}(1,3)Gal-synthesized glycoproteins (which, in light of our results, seems unlikely) or, a more probable explanation, the synthesis of Gal{alpha}(1,3)Gal on galactosylceramide forming the novel structure Gal{alpha}(1,3)Galß1Cer. In theory, a distinction in protein/lipid utilization between rat {alpha}(1,3)GT and iGb3S does seem plausible with rat {alpha}(1,3)GT like other {alpha}(1,3)GT, utilizing terminal NAcLac, expressed on both glycoproteins and glycolipids, whereas iGb3S utilizes a terminal lactose, a structure in mammalian cells only found on glycolipids. These findings open up an important biological question of why two Gal{alpha}(1,3)Gal synthesizing transferases, producing Gal{alpha}(1,3)Gal structures by different biochemical pathways, are required in the same species.

A glycolipid analysis of rat small intestine shows that a number of unique poly-{alpha}-Gal structures have been synthesized: Gal{alpha}(1,3)Gal{alpha}(1,4)LacCer, Gal{alpha}(1,3)Gal{alpha}(1,3) Gal{alpha}(1,3)Gal{alpha}(1,4)LacCer, and larger repeats (Breimer et al., 1981Go). All these structures are on a core backbone Gb3 glycolipid sturcture. Our glycolipid analysis shows iGb3S transfected cells are capable of forming such large (equal to or greater than Gal{alpha}(1,3)nLc4) poly-{alpha}-Gal structures as determined by their sensitivity to coffee bean {alpha}-galactosidase (Figure 9). Surprisingly, especially given the glycolipid structures isolated from the rat small intestine (Breimer et al., 1981Go), Gb3S was incapable of forming these poly-{alpha}-Gal structures. The evidence discounts the possibility that another transferase galactosylates iGb3 in CHOP cells as it should also be capable of utilizing Gb3. In vitro enzyme assays from cell lysates with iGb3S activity (Keusch et al., 2000bGo) have shown the synthesis of Gal{alpha}(1,3) Gal{alpha}(1,4)Lac using Gb3 as the acceptor substrate. Thus we propose a model of glycolipid synthesis for rat iGb3S in which it is capable of glycosylating Lac-Cer to produce iGb3, which in turn can be further glycosylated to form larger poly-{alpha}-Gal structures (Figure 10). In addition iGb3S can also utilize Gb3 if present, again forming large poly- {alpha}-Gal structures (Figure 10). It is therefore apparent that the acceptor specificity of iGb3S is unusual compared to other transferases with a common requirement for a terminal galactose irrespective of anomer or linkage. Another feature of iGb3S is its ability, in in vitro enzyme assays, to transfer {alpha}-Gal to Galß1Cer, forming Gal{alpha}(1,3) Galß1Cer (Keusch et al., 2000bGo), although our in vivo glycolipid analysis of coffee bean {alpha}-galactosidase treatment was unable to show any increase in Galß1Cer (Figure 9). However, we cannot eliminate the possibility that Gal{alpha}(1,3)Galß1Cer exists as minor product of iGb3S expression in vivo and was not detected by our analysis.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 10. Schematic diagram of iGb3S glycosylation. The proposed glycosylation by iGb3S forming two biochemical pathways: one was Lac-Cer being converted to iGb3, the committed step to the isoglobo-series pathway and the resultant formation of isoForssman; the other was the conversion of iGb3 or Gb3 to an array of poly-{alpha}-Gal glycolipids.

 
The comparison of iGb3S and Gb3S has shown that these two tranferases are distinguishable in their biochemical roles in the rat. Supporting this are differences in tissue expression (Keusch et al., 2000aGo,bGo) and glycolipid expression, with iGb3S synthesizing poly-{alpha}-Gal structures (Figure 9). Furthermore both Gb3 and iGb3 can be used as acceptor by Gb4 synthase (Keusch et al., 2000aGo,bGo). The results of this study show two distinct Gal{alpha}(1,3)Gal synthesizing pathways with two transferases, one contributing to each pathway. Until now the central dogma for many animal species was that Gal{alpha}(1,3)Gal was the sole product of one transferase, the {alpha}(1,3)GT.

It seems likely that other species could also express iGb3S and therefore have a second Gal{alpha}(1,3)Gal synthesizing pathway of critical importance to xenotransplantation. Our unpublished data show that similar to the rat, both mice and pigs have genes for both {alpha}(1,3)GT and iGb3S as shown by genomic Southern blots. Northern blot studies show that both glycosyltransferases are expressed in different tissues in mice and pigs (unpublished data). Analysis of the mouse genomic structure shows that, like {alpha}(1,3)GT, the iGb3S coding region is also encoded by five exons. The human homolog is located on chromosome 1, but the results of mRNA analysis suggest that this is a nonprocessed pseudogene (unpublished data). Furthermore, using monoclonal anti-Gal antibodies residual staining was found in tissues, such as thymus, liver, and heart, of Gal o/o mice. We have presented this preliminary data on mouse and pig iGb3S at the recent Xenotransplantation Meeting (Sandrin et al., 2001Go) and the International Transplantation meeting (Sandrin et al., 2002Go). Furthermore an iGb3 structure has been identified in hog stomach mucosa in a fucosylated form (Fuc{alpha}(1,2)Gal{alpha}(1,3)LacCer) (Slomiany et al., 1974Go), providing further evidence that iGb3S is expressed in pig. This could present problems for xenotransplantation, especially if iGb3S is expressed in other tissues of the pig, although it needs to be established whether the Gal{alpha}(1,3)Gal glycolipids synthesized by iGb3S are involved in HAR. In attempts to produce pigs devoid of Gal{alpha}(1,3)Gal strategies have assumed the presence of a single transferase, {alpha}(1,3)GT and thus focused on removal of {alpha}(1,3)GT or its product. This will require revision focusing on the removal of iGb3S and its product.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Cloning of rat {alpha}(1,3)GT
Poly A+ RNA was isolated from Sprague Dawley rat spleen cells using Rneasy and Oligotex purification kits (Qiagen, Clifton Hill, Victoria, Australia). First-strand cDNA was synthesized from the poly A+ RNA using reverse transcriptase, Superscript II (Life Technologies), priming with either 12–18 mer poly-dT primer (Life Technologies: Invitrogen Australia Pty Limited, Mount Waverley Victoria, Australia) or 6mer random primers (New England Biolabs, Beverly, MA). A 1014-bp fragment was PCR-amplified from the resultant cDNA using PWO, a proof reading DNA Polymerase enzyme (Roche Molecular Biochemicals, Mannheim, Germany), with the primer pairs, designed to the 5' and 3' open reading frame of mouse {alpha}(1,3)GT, MO519, 5'CCCAAGCTTATGAATGTCAAGGGAAAAGTAATC3' (HindIII site underscored) and MO520, 5'GCTCTAGATCAGACATTATTTCTAACCAAATTATA3' (XbaI site underscored), respectively. The restriction enzyme sites were engineered for the ease of further subcloning. The primers were annealed to the template during PCR amplification at 55°C and amplified for 35 cycles. The amplified fragment, the putative rat {alpha}(1,3)GT, was subcloned directionally into the pCDNA1 vector (Invitrogen, Carlsbad, CA) exploiting the terminal restriction sites (HindIII and XbaI). Two clones from independent PCR amplifications were thoroughly sequenced in both directions using a ABI automated sequencer 377 (Applied Biosystems, Foster City, CA).

Cloning of the Rat Gb3 and iGb3 synthase
Rat Gb3S and iGb3S were PCR-amplified from the rat first-strand cDNA using the same conditions as for rat {alpha}(1,3)GT. The oligonucleotide primers were designed from their relevant cDNA sequences (Keusch et al., 2000aGo,bGo) and are as outlined follows: iGb3S, MO509 5'CCCAAGCTTATGGCTCTGGAGGGACTCAGG3' (HindIII site underscored) and MO510 5' CGGGATCCTAGGTTCGCACCAGTGCGTA3' (BamHI site underscored); Gb3S, MO591 5'CCCAAGCTTATGTCCAAGCCCCCCGACTG3' (HindIII site underscored); and MO592 5'CGGGATCCTCACAAGTACATCGTCATGGCT3' (BamHI site underscored). The resultant amplified products were subcloned into pCDNA1 using the restriction enzyme sites (HindIII and BamHI).

Genomic Southern analysis
DNA extracted from rat spleen tissue or mouse tail tissue was prepared using a Puregene genomic DNA extraction kit (Gentra Systems Minneapolis, MN). Genomic DNA, 10 µg, was digested with the restriction enzyme PvuII and electrophoresised on a 1% agarose gel. Southern blotting was done (Sambrook and Maniatis, 1989Go) onto a nylon membrane, Highbond N+ (Amersham Pharmacia Biotech, Little Chalfton, United Kingdom). The membrane was hybridized with either the rat {alpha}(1,3)GT or rat iGb3S cDNA labeled with 32P. The membrane was washed in 0.1x Sodium chloride/sodium citrate buffer/1% SDS at 65°C and the remaining hybridized radioactivity cDNA detected by a phosphoimage screen (Molecular Dynamics, Sunnyvale, CA).

Rat northern analysis
A preblotted rat multitissue northern blot (Clontech, Palo Alto, CA) containing 2 µg poly A+ RNA of eight tissues (heart, brain, spleen, lung, liver, skeletal muscle, kidney, and testis) was hybridized with either the rat {alpha}(1,3)GT cDNA or iGb3S labeled with 32P. The membrane was washed in 0.1xSodium chloride/sodium citrate buffer/1% SDS at 60°C and detected by a phosphoimage screen (Molecular Dynamics).

Transfections
CHOP cells (Heffernan and Dennis, 1991Go), were maintained in Dulbecco's modified Eagle's medium (DMEM) (Cytosystems, Sydney, Australia) with 10% fetal bovine serum. The cells were seeded in 6-well plates (Linbro, Aurora, OH) at 3x105 cells and 24 h later transfected using Lipofectamine Plus Reagent (Gibco BRL Life Technologies, Gaithersburg, MD). The following cDNAs were transfected: mouse {alpha}(1,3)GT, rat {alpha}(1, 3)GT, iGb3S, Gb3S, Forssman synthase (Haslam and Baenziger, 1996Go) using 1 µg of each per well. After 48 h the cells were analyzed for expression.

FACS analysis
Transfected CHOPs were harvested from the six-well plates using 0.5 mM ethylenediamine tetra-acetic acid (EDTA)/phosphate buffered saline (PBS), washed with 0.5% (w/v) bovine serum albumin (BSA) (Commonwealth Serum Laboratories, Parkville, Victoria, Australia)/PBS. Cells (5x105) were stained, incubated on ice for 30 min with either IB4 (Vector, Burlingame, CA) conjugated to fluorescein isothiocyanate (FITC) at 10 µg/ml or anti-mouse Forssman antibody, M1/87 (Pharmingen, San Diego, CA, and Becton Dickinson, Franklin Lakes, NJ) at 5 µg/ml. The anti-Forssman antibody stained cells were washed and incubated for a further 30 min on ice in the presence of a sheep anti-mouse Ig conjugated to FITC (Silenus, Hawthorne, Victoria, Australia). The cells were washed after FITC staining and then analyzed cytoflurometericly using a fluorescence activated cell sorter (FACS), Facscalibur (Becton Dickinson).

Cell surface biotinylation
Transfected CHOP cells were harvested from plates using 0.5 mM EDTA/PBS, washed in biotinylation buffer (PBS [pH 8.0] containing 1 mM MgCl and 0.1 mM CaCl). The cell surface proteins of the cells were biotinylated by incubating 1x107 cells in 1 ml 0.5 mg sulfo-NHS-LC-biotin (Pierce)/biotinylation buffer for 40 min on ice. The cells were pelleted by centrifugation and the biotinylation reaction stopped by incubating the cells a further 10 min in DMEM/10% fetal calf serum and then washing a number of times in PBS. The labeled cells were lysed in 1 ml lysis buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 2.5 mM EDTA [Sigma, St. Louis, MO], 1% NP40, 1 mM phenylmethylsulfonylfluoride [Sigma], and 1 mM aprotinin [Sigma]), for 20 min and the nuclei and membrane fractions removed by centrifugation at 12,000xg.

Immunoprecipitation
The lysate was precleared with 50 µl of packed BSA-conjugated Sepharose beads (Pharmacia, Uppsala, Sweden) per 100 µl lysate and incubated at 4°C for 2 h. A second preclearing step was carried out overnight at 4°C. The precleared lystate was then immunoprecipitated using 25 µl of packed IB4 conjugated Sepharose beads per 100 µl precleared lysate and incubated at 4°C for a further 24 h. The beads were washed in lysis buffer and the proteins separated by electorophoresis on a 7.5% SDS–PAGE gel as per standard protocals (Coligan, 1995Go). The electrophoresised proteins were transferred to a nitrocellulose membrane, Protran (Schleicher & Schuell, Einbeck, Germany), blocked in 2.5% casein (BDH Laboratory Supplies, Poole, England)/Tris buffered saline (0.5 mM Tris, pH 7.5, 0.15 NaCl). The membrane was incubated in Tris buffered saline containing streptavidin-conjugated horseradish peroxidase (Amersham) for 1 h. The detection of bound horseradish peroxidase was by chemiluminescence using the reagent Renaissance (NEN Life Science, Boston, MA) and imaged using X-OMAT AR X-ray film (Kodak, Rochester, NY).

Metabolic labeling and glycolipid purification
CHOP cells 24 h posttransfection were metabolically labeled with 3H-galactose (NEN) at 35 µCi/ml. At 48 h posttransfection cells were harvested using 0.5 mM EDTA/PBS, washed in PBS buffer, and the glycolipids extracted as described by Haslam and Baenziger (1996)Go. Briefly, cells were pelleted by centrifugation and resuspended in a volume of methanol equal to the cell pellet. One volume of chloroform was added and then vortexed; an additional volume of methanol was added drop-wise, until the organic and aqueous phases resolved to a single phase. The cell debris was removed by centrifugation, and the extracted glycolipids were dried under N2. For analysis the glycolipids were resuspended in 60 µl chloroform/methanol/water (65:35:8), and 10 µl was spotted onto high performance thin layer chromatography (HPTLC) plates (Merck, Darmstadt, Germany). The glycolipids were resolved on the plates using chloroform/methanol/water 65:35:8 then dried and sprayed with En3Hance reagent (NEN) before exposure to X-OMAT AR X-ray film (Kodak) at –80°C for 2–5 days.

Glycolipid exoglycosidase digestions
The extracted radiolabeled glycolipids (10 µl, approximately 30,000 cpm) were dried under N2 and resuspended in 50 mM sodium citrate (pH 6.5) containing 0.05% sodium taurodeoxycholate (Sigma) and 0.1 U {alpha}-galactosidase (from green coffee beans, Sigma). The digestions were incubated at 37°C overnight, dried under vacuum, resuspended in 10 µl of chloroform/methanol/water (65:35:8), and separated by HPTLC as described.


    Acknowledgements
 
This work was supported in part by funds from the National Health and Medical Research Council of Australia. We would like to thank Dr. Julie Milland and Dr. Dale Christiansen for advice and helpful comments and Dr. D. Haslam for the generous gift of dog Forssman synthase DNA.


    Footnotes

1 To whom correspondence should be addressed; e-mail: m.sandrin{at}ari.unimelb.edu.au Back


    Abbreviations
 
BSA, bovine serum albumin; CHOP, Chinese hamster ovary cells transformed with the polyoma large T antigen; DMEM, Dulbecco's modified Eagle's medium; EDTA, ethylenediamine tetra-acetic acid; FACS, fluorescence activated cell sorter; FITC, fluorescein isothiocyanate; Gb3, globotriaosylceramide; Gb4, globoside; GT, galactosyltransferase; HAR, hyperacute rejection; iGb3, isoglobotriaosylceramide; iGb4, isogloboside; iGb3S, iGb3 synthase; HPTLC, high-performance thin-layer chromatography; IB4, isolectin IB4 from Griffonia simplicifolia; PBS, phosphate buffered saline; PCR, polymerase chain reaction; RT, reverse transcription; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Basu, M. and Basu, S. (1973) Enzymatic synthesis of a blood group B-related pentaglycosylceramide by an alpha-galactosyltransferase from rabbit bone marrow. J. Biol. Chem., 248, 1700–1706.[Abstract/Free Full Text]

Blanken, W.M. and Van den Eijnden, D.H. (1985) Biosynthesis of terminal Gal alpha 1–3Gal beta 1–4GlcNAc-R oligosaccharide sequences on glycoconjugates. Purification and acceptor specificity of a UDP-Gal:N-acetyllactosaminide alpha 1–3-galactosyltransferase from calf thymus. J. Biol. Chem., 260, 12927–12934.[Abstract/Free Full Text]

Breimer, M.E., Hansson, G.C., Karlsson, K.A., and Leffler, H. (1981) Glycosphingolipids and the differentiation of intestinal epithelium. Exp. Cell Res., 135, 1–13.[CrossRef][Web of Science][Medline]

Coligan, J.E., Dunn, B.M., Speicher, D.W., and Wingfield, P.T. (1995) Current protocols in protein science. New York: Wiley.

Haslam, D.B. and Baenziger, J.U. (1996) Expression cloning of Forssman glycolipid synthetase: a novel member of the histo-blood group ABO gene family. Proc. Natl. Acad. Sci. USA, 93, 10697–10702.[Abstract/Free Full Text]

Heffernan, M. and Dennis, J.W. (1991) Polyoma and hamster papovavirus large T antigen-mediated replication of expression shuttle vectors in Chinese hamster ovary cells. Nucleic Acids Res., 19, 85–92.[Abstract/Free Full Text]

Joziasse, D.H., Shaper, J.H., Van den Eijnden, D.H., Van Tunen, A.J., and Shaper, N.L. (1989) Bovine alpha 1–3-galactosyltransferase: isolation and characterization of a cDNA clone. Identification of homologous sequences in human genomic DNA. J. Biol. Chem., 264, 14290–14297.[Abstract/Free Full Text]

Joziasse, D.H., Shaper, N.L., Kim, D., Van den Eijnden, D.H., and Shaper, J.H. (1992) Murine alpha 1,3-galactosyltransferase. A single gene locus specifies four isoforms of the enzyme by alternative splicing. J. Biol. Chem., 267, 5534–5541.[Abstract/Free Full Text]

Keusch, J.J., Manzella, S.M., Nyame, K.A., Cummings, R.D., and Baenziger, J.U. (2000a) Cloning of Gb3 synthase, the key enzyme in globo-series glycosphingolipid synthesis, predicts a family of alpha 1,4-glycosyltransferases conserved in plants, insects, and mammals. J. Biol. Chem., 275, 25315–25321.[Abstract/Free Full Text]

Keusch, J.J., Manzella, S.M., Nyame, K.A., Cummings, R.D., and Baenziger, J.U. (2000b) Expression cloning of a new member of the ABO blood group glycosyltransferases, iGb3 synthase, that directs the synthesis of isoglobo-glycosphingolipids. J. Biol. Chem., 275, 25308–25314.[Abstract/Free Full Text]

Larsen, R.D., Rajan, V.P., Ruff, M.M., Kukowska-Latallo, J., Cummings, R.D., and Lowe, J.B. (1989) Isolation of a cDNA encoding a murine UDPgalactose:beta-D-galactosyl-1,4-N-acetyl-D-glucosaminide alpha-1,3-galactosyltransferase: expression cloning by gene transfer. Proc. Natl. Acad. Sci. USA, 86, 8227–8231.[Abstract/Free Full Text]

Nelson, P.W., Helling, T.S., Shield, C.F., Beck, M., and Bryan, C.F. (1992) Current experience with renal transplantation across the ABO barrier. Am. J. Surg., 164, 541–544; discussion 544–545.[CrossRef][Web of Science][Medline]

Ogiso, M., Nishiyama, I., Saito, N., Okinaga, T., Hoshi, M., and Komoto, M. (1995) Localization of neutral and acidic glycosphingolipids in rat lens. Glycobiology, 5, 187–194.[Abstract/Free Full Text]

Ogiso, M., Ohta, M., Irie, A., Hoshi, M., and Komoto, M. (1995) Characterization of neutral glycosphingolipids in rat lens. Exp. Eye Res., 60, 193–198.[CrossRef][Web of Science][Medline]

Rosales Fritz, V.M., Daniotti, J.L., and Maccioni, H.J. (1997) Chinese hamster ovary cells lacking GM1 and GD1a synthesize gangliosides upon transfection with human GM2 synthase. Biochim. Biophys. Acta, 1354, 153–158.[Medline]

Sambrook, J.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Sandrin, M.S. and McKenzie, I.F. (1999) Recent advances in xenotransplantation. Curr. Opin. Immunol., 11, 527–531.[CrossRef][Web of Science][Medline]

Sandrin, M.S., Vaughan, H.A., Dabkowski, P.L., and McKenzie, I.F. (1993) Anti-pig IgM antibodies in human serum react predominantly with Gal(alpha 1-3)Gal epitopes. Proc. Natl. Acad. Sci. USA, 90, 11391–11395.[Abstract/Free Full Text]

Sandrin, M.S., Dabkowski, P.L., Henning, M.M., Mouhtouris, E., and McKenzie, I.F.C. (1994a) Characterization of cDNA clones for porcine alpha(1,3)galactosyl transferase: the enzyme generating the Galalpha(1,3)Gal epitope. Xenotransplantation, 1, 81–88.

Sandrin, M.S., Vaughan, H.A., and McKenzie, I.F.C. (1994b) Identification of Gal(alpha1,3)Gal as the major epitope for pig-to-human vascularised xenografts. Transplant. Rev., 8, 134–149.[CrossRef]

Sandrin, M.S., Milland, J.A., Taylor, S.G., Lazarus, B.D. Dodson, H.C., Xing, P.-X., and McKenzie, I.F.C. (2001) A second galactosyltransferase which synthesizes the major xenoepitope Gala(1,3)Gal. Xenotransplantation, 8(suppl 1), 27.

Sandrin, M.S., Milland, J., Dodson, H.C., Lazarus, B.D., Taylor, S.G., and McKenzie, I.F.C. (2002) Gal{alpha}(1,3)Gal: description of a second gene and transgenic approaches to reduce Gal. Transplantation, 74, 31.

Schnaar, R.L. (1994) Isolation of glycosphingolipids. Methods Enzymol., 230, 348–370.[Web of Science][Medline]

Slomiany, B.L., Slomiany, A., and Horowitz, M.I. (1974) Characterization of blood-group-H-active ceramide tetrasaccharide from hog-stomach mucosa. Eur. J. Biochem., 43, 161–165.[Web of Science][Medline]

Vanhove, B., Goret, F., Soulillou, J.P., and Pourcel, C. (1997) Porcine alpha1,3-galactosyltransferase: tissue-specific and regulated expression of splicing isoforms. Biochim. Biophys. Acta, 1356, 1–11.

Williams, G.M., Hume, D.M., Hudson, R.P. Jr., Morris, P.J., Kano, K., and Milgrom, F. (1968) "Hyperacute" renal-homograft rejection in man. N. Engl. J. Med., 279, 611–618.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. ProteomicsHome page
R. Uematsu, Y. Shinohara, H. Nakagawa, M. Kurogochi, J.-i. Furukawa, Y. Miura, M. Akiyama, H. Shimizu, and S.-I. Nishimura
Glycosylation Specific for Adhesion Molecules in Epidermis and Its Receptor Revealed by Glycoform-focused Reverse Genomics
Mol. Cell. Proteomics, February 1, 2009; 8(2): 232 - 244.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
S. Watanabe, M. Misawa, T. Matsuzaki, T. Sakurai, T. Muramatsu, T.-a. Yokomine, and M. Sato
Production and Characterization of Transgenic Mice Systemically Expressing Endo- -Galactosidase C
Glycobiology, January 1, 2008; 18(1): 9 - 19.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A.-L. Turcot-Dubois, B. Le Moullac-Vaidye, S. Despiau, F. Roubinet, N. Bovin, J. Le Pendu, and A. Blancher
Long-term evolution of the CAZY glycosyltransferase 6 (ABO) gene family from fishes to mammals--a birth-and-death evolution model
Glycobiology, May 1, 2007; 17(5): 516 - 528.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. O. Speak, M. Salio, D. C. A. Neville, J. Fontaine, D. A. Priestman, N. Platt, T. Heare, T. D. Butters, R. A. Dwek, F. Trottein, et al.
From the Cover: Implications for invariant natural killer T cell ligands due to the restricted presence of isoglobotrihexosylceramide in mammals
PNAS, April 3, 2007; 104(14): 5971 - 5976.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Porubsky, A. O. Speak, B. Luckow, V. Cerundolo, F. M. Platt, and H.-J. Grone
From the Cover: Normal development and function of invariant natural killer T cells in mice with isoglobotrihexosylceramide (iGb3) deficiency
PNAS, April 3, 2007; 104(14): 5977 - 5982.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Milland, D. Christiansen, B. D. Lazarus, S. G. Taylor, P. X. Xing, and M. S. Sandrin
The Molecular Basis for Gal{alpha}(1,3)Gal Expression in Animals with a Deletion of the {alpha}1,3Galactosyltransferase Gene
J. Immunol., February 15, 2006; 176(4): 2448 - 2454.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Ketcham, F. Wang, S. Z. Fisher, A. Ercan, H. van der Wel, R. D. Locke, k. Sirajud-Doulah, K. L. Matta, and C. M. West
Specificity of a Soluble UDP-Galactose:Fucoside {alpha}1,3-Galactosyltransferase That Modifies the Cytoplasmic Glycoprotein Skp1 in Dictyostelium
J. Biol. Chem., July 9, 2004; 279(28): 29050 - 29059.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. C. Baumann, P. Forte, R. J. Hawley, R. Rieben, M. K. J. Schneider, and J. D. Seebach
Lack of Galactose-{alpha}-1,3-Galactose Expression on Porcine Endothelial Cells Prevents Complement-Induced Lysis but Not Direct Xenogeneic NK Cytotoxicity
J. Immunol., May 15, 2004; 172(10): 6460 - 6467.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A. L. Turcot, A. Blancher, B. Le Moullac-Vaidye, S. Despiau, J. Rocher, F. Roubinet, C. Szpirer, and J. Le Pendu
Cloning of a rat gene encoding the histo-blood group B enzyme: rats have more than one Abo gene
Glycobiology, December 1, 2003; 13(12): 919 - 928.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/5/327    most recent
cwg030v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (30)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?