Glycobiology Advance Access originally published online on January 3, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology, 2003, Vol. 13, No. 4 295-303
© 2003 Oxford University Press
Cloning and functional expression of a novel GDP-6-deoxy-D-talose synthetase from Actinobacillus actinomycetemcomitans
2 Department of Bacteriology and Immunology, Haartman Institute and Biomedicum, P.O. Box 63, FIN-00014 University of Helsinki, Helsinki, Finland
3 VTT Biotechnology and Programme for Structural Biology and Biophysics, P.O. Box 65, 00014 Helsinki, Finland
4 MediCel, Haartmaninkatu 8, FIN-00290 Helsinki, Finland
5 HUCH Laboratory Diagnostics, Helsinki University Central Hospital, P.O. Box 401, FIN-00029 HUCH, Helsinki, Finland
Received on September 30, 2002; revised on November 29, 2002; accepted on December 1, 2002
| Abstract |
|---|
|
|
|---|
Actinobacillus actinomycetemcomitans is a Gram-negative coccobacillus that can cause various forms of severe periodontitis and other nonoral infections in human patients. The serotype aspecific polysaccharide antigen of A. actinomycetemcomitans contains solely 6-deoxy-D-talose and its O-2 acetylated modification. This polysaccharide is synthesized from the donor GDP-6-deoxy-D-talose with the relevant talosylation enzyme(s). In the synthesis of GDP-6- deoxy-D-talose, GDP-D-mannose is first converted by GDP-mannose-4,6-dehydratase (GMD) to GDP-4-keto-6-deoxy-D-mannose and then reduced to GDP-6-deoxy-D-talose by GDP-6-deoxy-D-talose synthetase (GTS). In this study, we cloned and overexpressed in Escherichia coli the A. actinomycetemcomitans GTS enzyme responsible for the synthesis of GDP-6-deoxy-D-talose. The recombinant A. actinomycetemcomitans GTS enzyme expressed in E. coli converted the GDP-4-keto-6-deoxy-intermediate to a novel GDP-deoxyhexose. The synthesized GDP-deoxyhexose was shown to be GDP-6-deoxy-D-talose by HPLC, MALDI-TOF MS, and NMR spectroscopy. The functional expression of gts provides another enzymatically defined pathway for the synthesis of GDP-deoxyhexoses, which can be used as donors for the corresponding glycosyltransferases.
Key words: Actinobacillus actinomycetemcomitans / GDP-6-deoxy-D-talose / GDP-6-deoxy-D-talose synthetase (GTS) / specific polysaccharide antigen (SPA)
| Introduction |
|---|
|
|
|---|
Actinobacillus actinomycetemcomitans is a Gram-negative coccobacillus that can cause various forms of severe periodontitis (Buchmann et al., 2000
The serotype aspecific polysaccharide antigen (SPA) of A. actinomycetemcomitans has been characterized as 6-deoxy-D-talan, which is composed of a repeating disaccharide
1,3- (6-deoxy-D-talose)-
1,2-(6-deoxy-D-talose), where the O-2 position of
1,3-linked 6-deoxy-D-talose is acetylated (Perry et al., 1996
; Shibuya et al., 1991
). This glycan is rarely found in bacterial polysaccharides; currently Burkholderia (Pseudomonas) plantarii is the only other bacteria known to synthesize it (Zahringer et al., 1997
). Various strains of A. actinomycetemcomitans also harbor an isomer of 6-deoxy-D-talose, that is, 6-deoxy-L-talose (Nakano et al., 2000
) or other deoxyhexoses, such as L-rhamnose and/or D-fucose on their capsular polysaccharides (Shibuya et al., 1991
).
An epimer of 6-deoxy-D-talose, D-rhamnose is a deoxyhexose sugar, which differs from 6-deoxy-D-talose only in the orientation of the OH group at the C-4 position (Figure 1). Rhamnose is widely found in bacteria and plants but not in mammals. Of the two isomers, L- and D-rhamnose, the former is more common (Sadovskaya et al., 2000
). L-fucose is another deoxyhexose and the only representative of this glycan family also found in eukaryotic cells. Some fucosylated glycoproteins have been shown to be crucial both in bacterial adherence to host cells (Herron et al., 2000
; Karlsson, 2000
) and leukocyte trafficking in mammals (Lowe, 2001
; Satomaa et al., 2002
).
|
The synthetic pathways for closely related deoxyhexoses L-fucose, D-rhamnose, 6-deoxy-D-talose begin from GDP-D-mannose, which is first converted to the labile intermediate product GDP-4-keto-6-deoxy-D-mannose (Figure 1). This intermediate product is reduced to various GDP-deoxyhexoses (in the case of GDP-L-fucose, epimerization occurs prior to reduction). The enzymes GDP-4-keto-6-deoxy-D-mannose-3,5 epimerase/4-reductase (GMER) and GDP-4-keto-6-deoxy-D-mannose-4-reductase (RMD) synthesizing two of these sugar nucleotides, GDP-L-fucose and GDP-D-rhamnose, respectively, have already been described in detail (Butler and Elling, 1999
The aim of this study was to seek a reductase responsible for converting the labile intermediate product GDP-4-keto-6-deoxy-D-mannose to GDP-6-deoxy-D-talose. We searched for an amino acid sequence similar to the closely related reductases responsible for the synthesis of other GDP-deoxyhexoses. From the gene cluster associated with the serotype aSPA of A. actinomycetemcomitans (Suzuki et al., 2000
), we identified a putative GDP-6-deoxy-D-talose synthetase (gts) gene, which we cloned and overexpressed in Escherichia coli. GDP-4-keto-intermediate, produced by the recombinant Helicobacter pylori GDP-mannose-4,6-dehydratase (GMD) enzyme, was used as a substrate for the recombinant GDP-6-deoxy-D-talose synthetase (GTS) enzyme. The reaction product of the GTS enzyme was analyzed with high-pressure liquid chromatography (HPLC), matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), and nuclear magnetic resonance (NMR) spectroscopy. The results indicated that the GTS enzyme represents a novel reductase responsible for converting GDP-4-keto-6-deoxy-D-mannose to GDP-6-deoxy-D-talose.
| Results |
|---|
|
|
|---|
Sequence analysis
A gene cluster responsible for the biosynthesis of SPA has been sequenced from serotype a A. actinomycetemcomitans (the EMBL/GenBank/DDBJ accession number 9309318) (Suzuki et al., 2000
|
E. coli GMER has been crystallized, and the crystallographic studies have indicated that a catalytic mechanism of GMER is based on the concerted action of evolutionarily conserved residues Ser107, Tyr136, and Lys140 (Rizzi et al., 1998
The His179 residue of GMER enzymes was equivalent to Phe residue in RMD enzymes and GTS (Figure 2), which are acting only as reductases. The sequence alignment of GMERs, RMDs, and GTS also showed that the GMER Arg187 equivalent residue was Gln178 in RMDs and Ala173 in putative GTS (Figure 2). Amino acid residue variations between the GDP-4-keto-6-deoxy-D-mannose exploiting enzymes may be related to the different stereospecificity of the reduction reaction or the order of reaction cascade (in the case of GDP-L-fucose synthesis epimerization occurs prior reduction).
GMD is required to synthesize a GDP-4-keto-6-deoxy-D-mannose substrate for A. actinomycetemcomitans GTS. A putative gmd gene was found in the serotype aSPA gene cluster of A. actinomycetemcomitans. The corresponding gene product shared 20% identity with characterized GMD proteins, and it contained an amino acid sequence GILFNHES commonly found in GMD (Järvinen et al., 2001
; Kneidinger et al., 2001
; Mattila et al., 2000
). The characterization of A. actinomycetemcomitans GMD was not performed in this study.
Cloning and expression of the H. pylori GMD and A. actinomycetemcomitans GTS proteins in E. coli
H. pylori gmd, which was needed to generate labile GDP-4-keto-6-deoxy-D-mannose, and A. actinomycetemcomitans gts genes were expressed in frame with a short 8-amino-acid residue containing the Strep-tag under the anhydrotetracycline-inducible tet promoter of the pASK-IBA5 expression vector. The construction of the pASK-IBA5-derived expression plasmids and purification of the fusion proteins are described in detail under Materials and methods. The molecular masses of the partially purified denaturated proteins were determined by the sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE) and Strep-tagged GMD and GTS corresponded to the calculated molecular masses of 44.7 and 34.3 kDa, respectively (Figure 3), and no relevant bands could be detected from the vector control. As judged from the negative control experiments with the vector control, the few contaminating proteins were not responsible for the observed enzyme activity (Figure 4).
|
|
Characterization of enzymatic activities
Incubation of recombinant bacterial lysates containing GMD and GTS with GDP-D-mannose resulted in a new peak in Hypercarb HPLC profile (not shown). The new compound was pooled from several HPLC runs and subjected to further analysis. MALDI-TOF MS showed that the new molecule gave a single peak at m/z 588.08, which is identical to the mass of GDP-deoxyhexoses (calculated m/z for [M-H]- is 588.08). NMR analysis of 20 nmol of this GDP-deoxyhexose identified the structure of the reaction product as GDP-6-deoxy-D-talose (see later discussion).
Now having a standard preparation for GDP-6-deoxy-D-talose, we performed a thorough analysis of the sugar nucleotides formed in the reactions of purified Strep-tagged GMD and GTS with exogenously added GDP-D-mannose by using ion-pair reversed-phase HPLC (Figure 4). The vector control E. coli BL21 (pASK-IBA5) gave only a peak with the same retention time as GDP-D-mannose standard (M) at 17.3 min (Figure 4A and B). On the contrary, the reaction containing H. pylori GMD gave a novel peak (K) at 23.9 min, putatively representing the intermediate product GDP-4-keto-6-deoxy-D-mannose (Figure 4C). No standard is available for this labile intermediate product, but we have previously studied it further by reducing it chemically with NaBH4 (Räbinä et al., 2002
). After chemical reduction, two new peaks were detected with HPLC. The minor peak comigrated with GDP-D-rhamnose, and the major peak comigrates with GDP- 6-deoxy-D-talose synthesized in the present work. When both H. pylori GMD and A. actinomycetemcomitans GTS were present together with GDP-D-mannose, the HPLC analysis yielded a novel peak (T) at 24.9 min, whereas the GDP-4-keto-intermediate peak (K) at 23.9 min was not detected (Figure 4D). The retention time of this product (T) was exactly the same as of the GDP-6-deoxy-D-talose standard (Figure 4E).
The addition of NADPH as a cofactor was required for the GTS activity. Because no reverse reaction or other reaction products were detected in HPLC analysis, the conversion of GDP-4-keto-6-deoxy-D-mannose to GDP-6-deoxy-D-talose by GTS proceeded quantitatively and specifically. The yield of GDP-6-deoxy-D-talose after the purification steps was determined from HPLC runs. As calculated from the GMD reaction product, GDP-4-keto-6-deoxy-D-mannose, 79% of the substrate was converted to GDP-6-deoxy-D-talose. The remaining (21%) GDP-4-keto-6-deoxy-D-mannose was not detected in HPLC analysis probably due to the instability of GDP-4-keto-6-deoxy-D-mannose. This instability, which has been reported earlier (Bonin and Reiter, 2000
; Kneidinger et al., 2001
), prevented us from studying the further kinetic parameters of GTS.
NMR analysis
The structure of the novel nucleotide sugar purified by HPLC (Figure 4) was established as GDP-6-deoxy-D-talose by 1H NMR spectroscopy. Assignments of the proton signals (Figure 5) were obtained from a dqfcosy spectrum (Figure 6B), and protonproton coupling constants 3JH,H+1 (Table I) were determined by a first-order analysis. The 1H chemical shifts of the hexosyl unit (Table I) were clearly different from those previously obtained for GDP-D-rhamnose (Mäki et al., 2002
), whereas the chemical shifts of the ribosyl units were almost identical in the two nucleotides. The H6 signal of the deoxyhexosyl unit at 1.227 ppm was on the region of methyl protons and had the intensity of three protons. The small coupling constants between the ring protons of the hexosyl unit were characteristic of a mannoconfiguration at C2 and of a galactoconfiguration at C4 and thus confirm the hexosyl unit as 6-deoxy-talose. In addition, a cross peak was observed in the dqfcosy spectrum between H2 and H4 of the deoxytalosyl unit (Figure 6B). This four-bond coupling arises from the planar W orientation of the bonds (Figure 6A). Such long-range couplings are rarely observed in carbohydrates, because such a pair of equatorial protons does not exist in the most common monosaccharide units. However, in cyclohexanes 12 Hz four-bond couplings are commonly observed between equatorial protons. Therefore, the observed coupling further confirms the mutual orientation of H2 and H4 as equatorialequatorial.
|
|
|
| Discussion |
|---|
|
|
|---|
In this article, we describe the molecular identification of the A. actinomycetemcomitans gts gene and provide data that the corresponding recombinant enzyme purified from E. coli BL21 is responsible for the synthesis of GDP-6-deoxy-D-talose. This is the third member of the enzyme family able to convert the labile intermediate product GDP-4-keto-6-deoxy-D-mannose to GDP-6-deoxyhexoses. Previously, the first two members of this family have been cloned and characterized (Butler and Elling, 1999
The biological roles of L-fucose and D-rhamnose have been carefully studied. Some fucosylated glycans as part of the lipopolysaccharide structure on the bacteria or when decorating specific glycoproteins on the host cell membranes have been shown to be crucial in bacterial infections (Karlsson, 2000
) and leukocyte trafficking into sites of inflammation (Kirveskari et al., 2001
; Lowe, 2001
). Molecules decorated with D-rhamnose have been shown to be an essential extracellular and cell wall component of several pathogenic bacteria (Giraud and Naismith, 2000
).
A. actinomycetemcomitans is commonly isolated from the specimens obtained from saliva or tissue biopsies of patients with severe periodontitis (Buchmann et al., 2000
; Slots and Ting, 2000
; Wilson and Henderson, 1995
). The polysaccharides consisting of 6-deoxy-D-talose and 6-deoxy-L-talose have been suggested to contribute to the virulence and especially to the adherence of the A. actinomycetemcomitans to the host surfaces (Buchmann et al., 2000
; Doungudomdacha et al., 2000
; Fives-Taylor et al., 2000
; Haraszthy et al., 2000
; Muller et al., 2001
; Slots and Ting, 2000
; van Winkelhoff and Slots, 2000
; Wilson and Henderson, 1995
). Therefore, the biosyntheses of the corresponding nucleotide sugars have received increased interest. The reductase synthesizing dTDP-6-deoxy-L-talose has been cloned and characterized (Nakano et al., 2000
), and here we have identified the reductase that produces GDP-6-deoxy-D-talose. dTDP-4-keto-6-deoxy-L-glucose reductase converts dTDP-6-deoxy-L-talose, a precursor of 6-deoxy-L-talose, from dTDP-4-keto-6-deoxy-L-glucose. As compared to the GTS sequence to that of dTDP-4-keto- 6-deoxy-L-glucose reductase, the identity between the sequences was relatively low (23%). Even though 6-deoxy-D-talose and 6-deoxy-L-talose are each other's isomers, low identity between these enzymes exploiting different substrates seems reasonable. Identical amino acids between the sequences contained the conserved SDR protein family motif YXXXK (Jornvall et al., 1995
) as well as the GTS Ala173 residue, which differentiated GTS from GMERs and RMDs (Figure 2). The GTS Phe165 residue, which is also present in RMDs but not in GMERs (Figure 2), was not found from TDP-4-keto-6-deoxy-L-glucose reductase. In general, the identities between TDP-4-keto-6-deoxy-L-glucose reductase and the enzyme family using GDP-4-keto-6-deoxy-D-mannose as a substrate was relatively low.
Research groups studying the relevance of talosylation of various bacteria would benefit from the availability of building blocks required for the synthesis of talosylated molecules. Before these molecules can be synthesized in vitro, the activated sugar nucleotides, GDP-6-deoxy-D-talose and dTDP-deoxy-L-talose, and the corresponding talosyltransferases catalyzing the formation of specific glycosidic linkages are needed. Now the molecular identity for the genes coding for enzymes in the biosyntheses routes for both GDP-6-deoxy-D-talose and dTDP-6-deoxy-L-talose have been characterized, but the deoxytalosyltransferases remain to be identified. The same gene cluster harboring the gts gene most likely has also the corresponding enzyme(s) for the talosylation and synthesis of talan polymers in A. actinomycetemcomitans.
If the role of talosylation would be determined to be essential for the viability or virulence of this pathogenic bacteria suggested to play a key role in a very common disease, the enzymes involved in the biosynthesis of talosylated glycans could be suitable targets for the antibacterial chemotherapy. All mammals, including humans, lack talosylation and would thus most likely not suffer from the inhibition of the enzymes related to talosylation. Furthermore, the detailed studies of talosylation and especially GDP-6-deoxy-D-talose synthetase would also contribute an understanding of a catalytic mechanism of the enzyme family using GDP-4-keto-6-deoxy-D-mannose as a substrate. GMER and RMD enzymes synthesizing GDP-L-fucose and GDP-D-rhamnose are also potential targets for the antibacterial chemotherapy or therapy in leukocyte trafficking into sites of inflammation.
In conclusion, we have continued our previous studies on the identification of sugar nucleotide synthesizing enzymes that produce GDP-deoxyhexoses, such as GDP-L-fucose and GDP-D-rhamnose, used as donors in the enzymatic glycosylation reactions. In this study, we identified the enzyme GDP-6-deoxy-D-talose synthetase responsible for reducing specifically GDP-4-keto-6-deoxy-D-mannose to GDP-6-deoxy-D-talose. The identification of this novel enzyme should pave the way for new studies on defining the biological role of 6-deoxy-D-talose.
| Materials and methods |
|---|
|
|
|---|
Bacterial strains and culture conditions
A. actinomycetemcomitans ATCC 29523 was grown in Trypticase Soy Broth with Bacitracin and Vancomycin medium at 37°C for 5 days (Slots, 1982
[mrr-hsdRMS-mcrBC]
80lacZ
M15
lacX74 deoR recA1 araD139
[ara-leu]7697 galU galK rpsL[StrR] endA1 nupG) was used for DNA manipulations, and E. coli BL21 (F- dcm ompT hsdS[rB- mB-] gal) was used for enzyme overexpression. E. coli cells were grown in Luria broth at 30 or 37°C. When appropriate, antibiotic concentration for plasmid propagation was ampicillin 100 µg/ml.
Recombinant DNA techniques
Chromosomal DNA was isolated from A. actinomycetemcomitans ATCC 29523 using a QIAamp Tissue kit (Qiagen, Hilden, Germany). The gts gene (the EMBL/GenBank/DDBJ accession number 9309318) was amplified from A. actinomycetemcomitans chromosomal DNA using forward primer GTSF 5'GGAATTCGAAAATCTTAGTAACAGGTGGA (creating an EcoRI site) and reverse primer GTSR 3'AACTGCAGTTAAATCGAAAGCTCCAATAATC (creating a PstI site). The H. pylori gmd (HP0044, EMBL/GenBank/DDBJ accession number AE001443) gene was amplified from the pHP3 plasmid (Järvinen et al., 2001
) using forward primer HGMDF 5'GGAATTCGAAAGAAAAAATCGCTTTAATCA (creating an EcoRI site) and reverse primer HGMDR 3'CCGCTCGAGTCATAAAAATTCCTTAAAGT (creating a XhoI site). The amplified genes were subsequently digested with restriction enzymes EcoRI and PstI/XhoI and ligated into pASK-IBA5 vector (IBA GmbH, Göttingen, Germany) in frame with the N-terminal Strep-tag II, yielding the plasmids pTAL and pKETO, respectively. Recombinant plasmids were sequenced by an automated ABI 310 sequencer (PE Biosystems, Foster City, CA). The corresponding plasmids pKETO and pTAL were used for overexpression of the fusion proteins in E. coli BL21.
Sequence analysis
The tools used for homology searches were mostly BLAST (Altschul et al., 1997
), Fasta (Pearson, 1990
), and other programs available in the GCG package (Wisconsin Package, version 10.0; Genetics Computer Group, Madison, WI). Amino acid sequences were aligned with the program PILEUP (Wisconsin Package) using a Blosum32 protein weight matrix, a gap weight of 8, and a gap length weight of 2. The alignment was checked by eye and edited.
Enzyme purifications
To purify the Strep-tagged proteins produced by pASK-IBA5 derivates, 100-ml cultures of E. coli BL21 harboring the expression plasmids were grown at 37°C to an optical density at 550 nm of 0.5. Production of the fusion protein was induced by an addition of anhydrotetracycline to a final concentration of 0.2 µg/ml, and cultures were grown for an additional 3 h at 30°C. The cells were harvested and washed with 1 ml phosphate buffered saline), after which they were resuspended in 600 µl lysis buffer (50 mM 4-morpholine propane sulfonic acid/NaOH, pH 7.5, 1% Triton X-100, 10% glycerol) prior to probe sonication (Soniprep 150, MSE Scientific Instruments, Sussex, UNITED KINGDOM) for 3x15-s bursts on ice. After sonication, the cell debris were removed by centrifugation at 14,000xg for 10 min at 4°C. Purification using Strep-Tactin columns were performed as recommended by the manufacturer (IBA GmbH). The proteins were stored at +4°C. Purity of the proteins was checked by 12 % SDSPAGE.
Enzymatic reactions
Column eluate of vector control as well as Strep-tagged GMD were incubated at 37°C for 1 h in the presence of 500 µM GDP-D-mannose (Calbiochem, San Diego, CA) and 50 µM NADP+ (Calbiochem), after which the samples were divided into two parts, one of which was stored at 20°C prior to HPLC analysis. The other was supplemented with purified Strep-tagged GTS, 2.5 mM MgCl2, 250 µM NADP+ (Calbiochem), and/or 250 µM NADPH (Calbiochem) and incubated for an additional 1 h at 37°C. The reaction mixtures were subjected to alkaline phosphatase treatment and solid-phase extraction prior to HPLC analysis. Preparative synthesis of GDP-6-deoxy-D-talose was performed with cell lysates containing GMD and GTS. Enzymatic reactions for the cell lysates were performed as for the purified Strep-tagged GMD and GTS enzymes. The samples were then purified with solid-phase extraction, alkaline phosphatase treatment, and another solid-phase extraction step prior to isolation of reaction product from the HPLC runs.
Nucleotide sugar sample preparation
Samples were incubated for 30 min at 37°C with 30 U alkaline phosphatase (Finnzymes, Espoo, Finland), which removed the phosphate groups from nucleotides but left the nucleoside diphosphate sugars intact. Solid-phase extraction with single-use cartridges containing graphitized carbon (Envi-Carb 250 mg; Supelco, Bellafonte, PA) was used for purification of nucleotide sugars from reaction mixtures as in Räbinä et al. (2002)
. Prior to use, Envi-Carb carbon colums were conditioned with 80% acetonitrile in 0.1% trifluoroacetic acid (3 ml) followed by 3 ml water. The samples were diluted to volume of 1 ml with 10 mM NH4HCO3 and applied to Envi-Carb colums. To remove salts, detergents, and other unwanted materials, the packings were washed with 3 ml water, 3 ml 25% acetonitrile, and 3 ml 50 mM triethylammoniumacetate (TEAA) buffer (pH 7; Fluka, Buchs, Switzerland). Nucleotide sugars were then eluted with 2 ml 25% acetonitrile containing 50 mM TEAA buffer (pH 7). After drying in a vacuum centrifuge, nucleotide sugars were analyzed with HPLC.
HPLC methods
Nucleotide sugars were analyzed by ion-pair reversed-phase HPLC on a Discovery HS C18 column (0.46x25 cm; Supelco) at a flow rate of 1 ml/min. A linear gradient of 01.5% acetonitrile in 20 mM TEAA buffer (pH 7) over 35 min was used. The column was then washed with 5% acetonitrile in 20 mM TEAA buffer for 7 min.
Preparative HPLC runs were performed with a graphitized carbon HPLC column (Hypercarb 7 µ 0.46x10 cm; Hypersil, Runcorn, UNITED KINGDOM). Isocratic 10% acetonitrile in 20 mM TEAA buffer (pH 7) was used for 5 min; then a linear gradient of 1017.5% acetonitrile in 20 mM TEAA buffer over 25 min was used. The column was then washed with 25% acetonitrile in 20 mM TEAA buffer for 5 min.
In both HPLC methods the effluent was monitored at 254 nm, and the amount of GDP-6-deoxy-D-talose was calculated from the peak areas by reference to external standards GDP-D-mannose (Calbiochem) and GDP-L-fucose (Calbiochem). The putative GDP-6-deoxy-D-talose peak was collected from Hypercarb HPLC runs for structural analysis with MALDI-TOF MS and NMR.
MALDI-TOF MS
MALDI-TOF MS was performed with a Biflex III mass spectrometer (Bruker Daltonics, Germany). Nucleotide sugars were investigated in a 2,4,6-trihydroxyacetonephenone/acetonitrile/aqueous ammonium citrate matrix as described (Räbinä et al., 2002
), utilizing the reflector negative-ion mode with delayed extraction. External calibration was performed with dTDP-L-rhamnose, which was a kind gift from Dr. Paul Messner (University of Agricultural Sciences, Wien, Austria) and UDP-N-acetylglucosamine (Sigma; St. Louis, MO).
NMR experiments
A 20-nmol sample of GDP-6-deoxy-D-talose was twice lyophilized from 100 µl of D2O (99.996% atom, Cambridge Isotope Laboratories, Andover, MA). After that the sample was dissolved in 40 µl of D2O. All NMR experiments were carried out at 35°C on a 500 MHz Varian Inova spectrometer equipped with a nanoprobe. The 1D 1H NMR spectrum was recorded using a weft sequence for water suppression (Hård et al., 1992
). Three thousand transients were acquired with a spectral width of 6100 Hz. For the dqfcosy spectrum (Rance et al., 1983
) a total of 4000x512 complex data points were acquired, 128 transients per increment. Prior to Fourier transformation, the data matrix was multiplied by a cosine function in both dimensions. The 1H chemical shifts were referenced to external 3-(trimethylsilyl) propionic-2,2,3,3-d4 acid (
=0).
| Acknowledgements |
|---|
The work was supported in part by Research Grants of Academy of Finland; Research Grants from Technology Development Center (TEKES), Helsinki; and grants from Sigrid Juselius Foundation and the Helsinki University Central Hospital Fund all to R.R. and by grants from Farmos, Turku, to M.M. and to H.M. We thank Henna Vänskä and Sirkka-Liisa Kauranen for skilled technical assistance in molecular biology, Kati Venäläinen and Leena Penttilä for assistance in HPLC and MALDI-TOF MS analysis, and Jonna-Mari Mäki for the valuable help with the figures.
1 To whom correspondence should be addressed; e-mail: risto.renkonen{at}helsinki.fi ![]()
| Abbreviations |
|---|
GMD, GDP-mannose-4,6-dehydratase; GMER, GDP-4-keto-6-deoxy-D-mannose-3,5 epimerase/4-reductase; GTS, GDP-6-deoxy-D-talose synthetase; HPLC, high-performance liquid chromatography; MALDI-TOF MS, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry; NMR, nuclear magnetic resonance; RMD, GDP-4-keto-6-deoxy-D-mannose-4-reductase; SDR, short chain dehydrogenase/reductase; SDSPAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis; SPA, specific polysaccharide antigen; TEAA, triethylammoniumacetate.
| References |
|---|
|
|
|---|
Albermann, C. and Piepersberg, W. (2001) Expression and identification of the RfbE protein from Vibrio cholerae O1 and its use for the enzymatic synthesis of GDP-D-perosamine. Glycobiology, 11, 655661.
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res., 25, 33893402.
Bonin, C.P. and Reiter, W.D. (2000) A bifunctional epimerase-reductase acts downstream of the MUR1 gene product and completes the de novo synthesis of GDP-L-fucose in Arabidopsis. Plant J., 21, 445454.[CrossRef][Web of Science][Medline]
Buchmann, R., Muller, R.F., Heinecke, A., and Lange, D.E. (2000) Actinobacillus actinomycetemcomitans in destructive periodontal disease. Three-year follow-up results. J. Periodontol., 71, 444453.[CrossRef][Web of Science][Medline]
Butler, T. and Elling, L. (1999) Enzymatic synthesis of nucleotide sugars. Glycoconj. J., 16, 147159.[CrossRef][Web of Science][Medline]
Doungudomdacha, S., Rawlinson, A., and Douglas, C.W. (2000) Enumeration of Porphyromonas gingivalis, Prevotella intermedia and Actinobacillus actinomycetemcomitans in subgingival plaque samples by a quantitative-competitive PCR method. J. Med. Microbiol., 49, 861874.
Filling, C., Berndt, K.D., Benach, J., Knapp, S., Prozorovski, T., Nordling, E., Ladenstein, R., Jörnvall, H., and Oppermann, U. (2002) Critical residues for structure and catalysis in short-chain dehydrogenases/reductases. J. Biol. Chem., 277, 2567725684.
Fives-Taylor, P.M., Meyer, D.H., Mintz, K.P., and Brissette, C. (2000) Virulence factors of Actinobacillus actinomycetemcomitans. Periodontology, 20, 136167.[CrossRef]
Giraud, M.F. and Naismith, J.H. (2000) The rhamnose pathway. Curr. Opin. Struc. Biol., 10, 687696.[CrossRef][Web of Science][Medline]
Gmur, R., McNabb, H., van Steenbergen, T.J., Baehni, P., Mombelli, A., van Winkelhoff, A.J., and Guggenheim, B. (1993) Seroclassification of hitherto nontypeable Actinobacillus actinomycetemcomitans strains: evidence for a new serotype e. Oral Microbiol. Immun., 8, 116120.[Web of Science][Medline]
Graber, K.R., Smoot, L.M., and Actis, L.A. (1998) Expression of iron binding proteins and hemin binding activity in the dental pathogen Actinobacillus actinomycetemcomitans. FEMS Microbiol. Lett., 163, 135142.[CrossRef][Web of Science][Medline]
Haraszthy, V.I., Hariharan, G., Tinoco, E.M., Cortelli, J.R., Lally, E.T., Davis, E., and Zambon, J.J. (2000) Evidence for the role of highly leukotoxic Actinobacillus actinomycetemcomitans in the pathogenesis of localized juvenile and other forms of early-onset periodontitis. J. Periodontol., 71, 912922.[CrossRef][Web of Science][Medline]
Hård, K., van Zadelhoff, G., Moonen, P., Kamerling, J.P., and Vliegenthart, J.F.G. (1992) The Asn-linked carbohydrate chains of human Tamm-Horsfall glycoprotein of one male. Novel sulfated and novel N-acetylgalactosamine-containing N-linked carbohydrate chains. Eur. J. Biochem., 209, 895915.[Web of Science][Medline]
Herron, M.J., Nelson, C.M., Larson, J., Snapp, K.R., Kansas, G.S., and Goodman, J.L. (2000) Intracellular parasitism by the human granulocytic ehrlichiosis bacterium through the P-selectin ligand, PSGL-1. Science, 288, 16531656.
Järvinen, N., Mäki, M., Räbinä, J., Roos, C., Mattila, P., and Renkonen, R. (2001) Cloning and expression of Helicobacter pylori GDP-L-fucose synthesizing enzymes (GMD and GMER) in Saccharomyces cerevisiae. Eur. J. Biochem., 268, 64586464.[Web of Science][Medline]
Johansson, A., Claesson, R., Hanstrom, L., Sandstrom, G., and Kalfas, S. (2000) Polymorphonuclear leukocyte degranulation induced by leukotoxin from Actinobacillus actinomycetemcomitans. J. Periodontal Res., 35, 8592.[CrossRef][Web of Science][Medline]
Jornvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R., Jeffery, J., and Ghosh, D. (1995) Short-chain dehydrogenases/reductases (SDR). Biochemistry, 34, 60036013.[CrossRef][Medline]
Kaplan, J.B., Perry, M.B., MacLean, L.L., Furgang, D., Wilson, M.E., and Fine, D.H. (2001) Structural and genetic analyses of O polysaccharide from Actinobacillus actinomycetemcomitans serotype f. Infect. Immun., 69, 53755384.
Karlsson, K.A. (2000) The human gastric colonizer Helicobacter pylori: a challenge for hostparasite glycobiology. Glycobiology, 10, 761771.
Kirveskari, J., Vesaluoma, M.H., Moilanen, J.A.O., Tervo, T.M.T., Petroll, M.W., Linnolahti, E., and Renkonen, R. (2001) A novel non-invasive, in vivo technique for the quantification of leukocyte rolling and extravasation at sites of inflammation in human patients. Nat. Med., 7, 376379.[CrossRef][Web of Science][Medline]
Kneidinger, B., Graninger, M., Adam, G., Puchberger, M., Kosma, P., Zayni, S. and Messner, P. (2001) Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductases synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L42091T. J. Biol. Chem., 276, 55775583.
Kulekci, G., Ciftci, S., Keskin, F., Kilic, A.O., Turkoglu, S., Badur, S., Develioglu, O.N., Leblebicioglu, B., and Kulekci, M. (2001) PCR analysis of Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Treponema denticola and Fusorbacterium nucleatum in middle ear effusion. Anaerobe, 7, 241246.
Lowe, J.B. (2001) Glycosylation, immunity, and autoimmunity. Cell, 104, 809812.[CrossRef][Web of Science][Medline]
Mäki, M., Järvinen, N., Räbinä, J., Roos, C., Maaheimo, H., Mattila, P., and Renkonen, R. (2002) Functional expression and characterization of Pseudomonas aeruginosa GDP-4-keto-6-deoxy-D-mannose reductase (RMD) synthesizing GDP-D-rhamnose. Eur. J. Biochem., 269, 593601.[Web of Science][Medline]
Mattila, P., Räbinä, J., Hortling, S., Helin, J., and Renkonen, R. (2000) Functional expression of Escherichia coli enzymes synthesizing GDP-L-fucose from inherent GDP-D-mannose in Saccharomyces cerevisiae. Glycobiology, 10, 10411047.
Muller, H.P., Heinecke, A., Fuhrmann, A., Eger, T., and Zoller, L. (2001) Intraoral distribution of Actinobacillus actinomycetemcomitans in young adults with minimal periodontal disease. J. Periodontal Res., 36, 114123.[CrossRef][Web of Science][Medline]
Nakano, Y., Suzuki, N., Yoshida, Y., Nezu, T., Yamashita, Y., and Koga, T. (2000) Thymidine diphosphate-6-deoxy-L-lyxo-4-hexulose reductase synthesizing dTDP-6-deoxy-L-talose from Actinobacillus actinomycetemcomitans. J. Biol. Chem., 275, 68066812.
Oppermann, U.C., Filling, C., and Jornvall, H. (2001) Forms and functions of human SDR enzymes. Chem-Biol. Interact., 130132, 699705.
Pearson, W.R. (1990) Rapid and sensitive sequence comparison with FASTP and FASTA. Methods Enzymol., 183, 6398.[Web of Science][Medline]
Perry, M.B., MacLean, L.M., Brisson, J.R., and Wilson, M.E. (1996) Structures of the antigenic O-polysaccharides of lipopolysaccharides produced by Actinobacillus actinomycetemcomitans serotypes a, c, d and e. Eur. J. Biochem., 242, 682688.[Web of Science][Medline]
Räbinä, J., Mäki, M., Savilahti, E., Järvinen, N., Penttilä, L., and Renkonen, R. (2002) Ion-pair solid-phase extraction and reversed-phase high-performance liquid chromatography analysis of nucleotide sugars from cell lysates. Glycoconj. J., forthcoming.
Rance, M., Sorensen, O.W., Bodenhausen, G., Wagner, G., Ernst, R.R., and Wuthrich, K. (1983) Improved spectral resolution in cosy 1H NMR spectra of proteins via double quantum filtering. Biochem. Bioph. Res. Commun., 117, 479485.[CrossRef][Web of Science][Medline]
Rizzi, M., Tonetti, M., Vigevani, P., Sturla, L., Bisso, A., Flora, A.D., Bordo, D., and Bolognesi, M. (1998) GDP-4-keto-6-deoxy-D-mannose epimerase/reductase from Escherichia coli, a key enzyme in the biosynthesis of GDP-L-fucose, displays the structural characteristics of the RED protein homology superfamily. Structure, 6, 14531465.[Medline]
Rosano, C., Bisso, A., Izzo, G., Tonetti, M., Sturla, L., De Flora, A., and Bolognesi, M. (2000) Probing the catalytic mechanism of GDP-4-keto-6-deoxy-D-mannose epimerase/reductase by kinetic and crystallographic characterization of site-specific mutants. J. Mol. Biol., 303, 7791.[CrossRef][Web of Science][Medline]
Saarela, M., Asikainen, S., Alaluusua, S., Pyhälä, L., Lai, C.H., and Jousimies-Somer, H. (1992) Frequency and stability of mono- or poly-infection by Actinobacillus actinomycetemcomitans serotypes a, b, c, d or e. Oral Microbiol. Immun., 7, 277279.[Web of Science][Medline]
Saarela, M., Asikainen, S., Jousimies-Somer, H., Asikainen, T., von Troil-Linden, B., and Alaluusua, S. (1993) Hybridization patterns of Actinobacillus actinomycetemcomitans serotypes ae detected with an rRNA gene probe. Oral Microbiol. Immun., 8, 111115.[Web of Science][Medline]
Sadovskaya, I., Brisson, J.R., Thibault, P., Richards, J.C., Lam, J.S., and Altman, E. (2000) Structural characterization of the outer core and the O-chain linkage region of lipopolysaccharide from Pseudomonas aeruginosa serotype O5. Eur. J. Biochem., 267, 16401650.[Web of Science][Medline]
Satomaa, T., Renkonen, O., Helin, J., Kirveskari, J., Mäkitie, A., and Renkonen, R. (2002) O-glycans on human high endothelial CD34 putatively participating in L-selectin recognition. Blood, 99, 26092611.
Shibuya, N., Amano, K., Azuma, J., Nishihara, T., Kitamura, Y., Noguchi, T., and Koga, T. (1991) 6-Deoxy-D-talan and 6-deoxy-L-talan. Novel serotype-specific polysaccharide antigens from Actinobacillus actinomycetemcomitans. J. Biol. Chem., 266, 1631816323.
Slots, J. (1982) Selective medium for isolation of Actinobacillus actinomycetemcomitans. J. Clin. Microbiol., 15, 606609.
Slots, J. and Ting, M. (2000) Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in human periodontal disease: occurrence and treatment. Periodontology, 20, 82121.
Suzuki, N., Nakano, Y., Yoshida, Y., Nakao, H., Yamashita, Y., and Koga, T. (2000) Genetic analysis of the gene cluster for the synthesis of serotype aspecific polysaccharide antigen in Actinobacillus actinomycetemcomitans. Biochim. Bioph. Acta, 1517, 135138.[Medline]
van Winkelhoff, A.J. and Slots, J. (2000) Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in nonoral infections. Periodontology, 20, 122135.
Wilson, M. and Henderson, B. (1995) Virulence factors of Actinobacillus actinomycetemcomitans relevant to the pathogenesis of inflammatory periodontal diseases. FEMS Microbiol. Rev., 17, 365379.[CrossRef][Web of Science][Medline]
Zahringer, U., Rettenmaier, H., Moll, H., Senchenkova, S.N., and Knirel, Y.A. (1997) Structure of a new 6-deoxy-alpha-D-talan from Burkholderia (Pseudomonas) plantarii strain DSM 6535, which is different from the O-chain of the lipopolysaccharide. Carbohyd. Res., 300, 143151.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
F. Fruscione, L. Sturla, G. Duncan, J. L. Van Etten, P. Valbuzzi, A. De Flora, E. Di Zanni, and M. Tonetti Differential Role of NADP+ and NADPH in the Activity and Structure of GDP-D-mannose 4,6-Dehydratase from Two Chlorella Viruses J. Biol. Chem., January 4, 2008; 283(1): 184 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Turnock, L. Izquierdo, and M. A. J. Ferguson The de Novo Synthesis of GDP-fucose Is Essential for Flagellar Adhesion and Cell Growth in Trypanosoma brucei J. Biol. Chem., September 28, 2007; 282(39): 28853 - 28863. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. T. Thuy, K. Liou, T.-j. Oh, D. H. Kim, D. H. Nam, J. C. Yoo, and J. K. Sohng Biosynthesis of dTDP-6-deoxy-{beta}-D-allose, biochemical characterization of dTDP-4-keto-6-deoxyglucose reductase (GerKI) from Streptomyces sp. KCTC 0041BP Glycobiology, February 1, 2007; 17(2): 119 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maki and R. Renkonen Biosynthesis of 6-deoxyhexose glycans in bacteria Glycobiology, March 1, 2004; 14(3): 1R - 15R. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







