Skip Navigation


Glycobiology Advance Access originally published online on December 17, 2002
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/4/265    most recent
cwg028v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Silverman, H. S.
Right arrow Articles by Harris, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silverman, H. S.
Right arrow Articles by Harris, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 4 265-277
© 2003 Oxford University Press

The contribution of tandem repeat number to the O-glycosylation of mucins

Howard Scott Silverman2, Mark Sutton-Smith3, Kimberley McDermott4, Paul Heal2, Shih-Hsing Leir2, Howard R. Morris3, Michael A. Hollingsworth4, Anne Dell3 and Ann Harris1,2

2 Paediatric Molecular Genetics, Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford, OX3 9DS, UK
3 Department of Biological Sciences, Imperial College of Science, Technology and Medicine, South Kensington, London SW7 2AZ, UK
4 Eppley Institute, University of Nebraska Medical Center, Omaha, NE 68198–6805, USA

Received on August 5, 2002; revised on November 2, 2002; accepted on November 6, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 References
 
The serine- and threonine-rich tandem repeat (TR) units that make up the characteristic feature of mucin glycoproteins are often polymorphic with substantial genetic variation in TR number. The precise effect of TR number on O-glycosylation is not fully understood, although the TR number of several mucins may be associated with apparent susceptibility to certain human diseases. To evaluate the contribution of TR number to O-glycosylation, we generated a series of chimeric mucins carrying increasing numbers of TR units from the MUC5B mucin in the context of an epitope-tagged MUC1 mucin backbone. These mucins were expressed in Caco2 colon carcinoma cell clones and purified by immunoprecipitation. O-Glycosylation was investigated by western blotting with antibodies to known carbohydrate structures and by fast atom bombardment-mass spectrometry. Additional carbohydrate epitopes were detected with antibodies on chimeric mucins with a higher TR number in comparison to those with fewer TRs. Using mass spectrometry, higher-molecular-weight glycans were detected more frequently on the mucins with extended TRs compared to those with fewer TRs. However no novel carbohydrate structures were seen, suggesting that TR number does not affect the specificity of O-glycosylation.

Key words: MUC5B / mucin tandem repeat / O-glycosylation


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 References
 
The common feature shared by all mucin glycoproteins is a serine- and threonine-rich tandem repeat (TR) region that confers the characteristic biochemical and biophysical properties on these molecules. The precise amino acid sequence of the TR is unique to each of the human mucins described to date (reviewed in Hanisch and Muller, 2000Go). It is known that the TRs of these molecules are highly polymorphic, in many cases showing genetic variation in TR number (Swallow et al., 1987Go; Pigny et al., 1995Go; Gum et al., 1997Go; Vinall et al., 1998Go) and often significant sequence variation between TRs within the one mucin. It is not clear what effect the number of TRs has on the O-glycosylation and hence the biochemical properties of a mucin glycoprotein. However, the number of TRs may be associated with susceptibility to certain human diseases (Carvalho et al., 1997Go; Swallow et al., 1999Go; Kyo et al., 1999Go, 2001Go; Kirkbride et al., 2001Go; Vinall et al., 2000Go; Harris and Reid, 1998Go). The size of fully processed mucins (150 to >=7000 kDa) and the diversity of carbohydrate structures present on them have made it difficult to investigate many aspects of the molecular features of mucin glycosylation.

We have expressed different mucin TRs in the context of a common (MUC1) mucin protein that has been characterized previously because full-length cDNAs are not available for most mucins. Constructs were generated in which TR domains from a specific mucin were substituted for the native TRs of an epitope-tagged MUC1 cDNA (MUC1F) (Burdick et al., 1997Go; Reid et al., 1999Go). A series of chimeric mucins containing TRs from MUC2, MUC4, MUC5AC, and MUC5B were created and shown to be extensively O-glycosylated, associated with the cell surface, and released from epithelial cells into the culture medium (Silverman et al., 2001Go). Analysis of O-glycosylation of the chimeric mucins, by mass spectrometry (MS) and by their reactivity with antibodies against particular blood group and tumor-associated carbohydrate antigens, suggested that both common and distinct carbohydrates are attached to the substituted TR domains (Silverman et al., 2001Go).

We have now used the chimeric mucin expression system to evaluate the contribution of TR number to the O-glycosylation of the TR of the MUC5B gene product (Dufosse et al., 1993Go; Desseyn et al., 1997Go). The MUC1F/5BTR construct described previously (Silverman et al., 2001Go) contains 170 amino acids of the native MUC5B TR that consists of approximately 5 repeat units. MUC1F/5BTR(x2) contains two MUC5B TR domains (340 aa, about 10 repeat units) and MUC1F/5BTR(x3) contains 3 (510 aa, about 15 repeat units). In addition, a fourth hybrid MUC5B construct, MUC1F/5BLTR, was created that contains 465 aa of predominantly TR sequences from native MUC5B (Desseyn et al., 1997Go) and corresponds to approximately 14 MUC5B TR units. The O-glycans present on the MUC1F/5BTR chimeric mucin series were evaluated by using antibodies against blood group and tumor-associated carbohydrates and by fast atom bombardment (FAB)-MS. Novel epitopes that were not detected on the original MUC1F/5BTR glycoprotein were found on the iterated and extended MUC1F/5BTR TR domains. This could contribute to the significance of polymorphisms in TR number in human disease susceptibility. However, failure to detect novel glycans on mucins with greater numbers of TRs suggests that, within the limits of the number of TR units analyzed, TR number plays a lesser role in O-glycosylation.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 References
 
Iteration of MUC5B TR segment
A series of MUC1F/5BTR chimeric mucins was created in which the single 170-aa MUC5B TR segment of MUC1F/5BTR (about 5 TRs) was substituted with duplicate or triplicate MUC5B TR segments, generating MUC1F/5BTR(x2) (about 10 TRs) or MUC1F/5BTR(x3) (about 15 TRs), respectively (Table I). An additional construct, MUC1F/5BLTR, contains an extended, 465-aa portion of the native MUC5B TR cDNA (about 14 TRs) and encompasses sequence identical to the 170 aa of the original MUC5B TR segment (Figure 1, Table I).


View this table:
[in this window]
[in a new window]
 
Table I. Comparative description of the epitope-tagged MUC1F/5BTR chimeric mucin series

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1. Diagram of the epitope-tagged MUC1F/5BTR chimeric mucin series. MUC1F and MUC1F({Delta}TR) were described previously (Burdick et al., 1997Go). The position of the FLAG (M2) epitope is marked above MUC1F and is consistent for all other constructs. Gray rectangles indicate TR sequence, asterisks represent potential N-glycosylation sites, and the arrowhead shows the MUC1 cleavage site (CS). Signal sequence, membrane spanning, and cytoplasmic tail domains are also indicated. The 926 aas of the MUC1F TR sequence include both perfect and degenerate TR domains and some flanking sequence. MUC1F({Delta}TR) and the MUC1F/5BTR chimeric mucin series (MUC1F/5BTR [which contains one MUC1F/5BTR], MUC1F/5BTR[x2] [which contains two MUC5B TRs], MUC1F/5BTR[x3] [which contains three MUC5B TRs], and MUC1F/5BLTR [which contains one extended length MUC5B TR]) are illustrated below MUC1F. The figure is drawn to scale.

 
Analysis of the chimeric mucins by an algorithm that predicts O-glycosylation indicates numerous potential O-glycosylation sites along the substituted TR domains in addition to those present on the MUC1 backbone, MUC1F({Delta}TR) (Table I). The number of O-glycosylation sites evident in the members of the MUC1F/5BTR chimeric mucin series corresponds directly to the number of incorporated TR segments, each additional segment providing approximately 72 additional potential O-glycosylation sites.

Expression of chimeric mucins
The MUC1F/5BTR series of constructs was transfected into Caco2 cells, and clones were selected by culture with G418. For each chimeric mucin, two to four representative high-expressing clones were identified and epitope-tagged protein was immunoprecipitated. Cell surface localization of the MUC1F/5BTR glycoproteins was confirmed by confocal microscopy (data not shown). Western blot analysis using M2 anti-FLAG antibody indicated the presence of glycoforms with consistent molecular weights of approximately 200 kDa for MUC1F/5BTR (clones 1, 316, and 320) and >250 kDa for MUC1F/5BTR(x2) (clones 603 and 609), MUC1F/5BTR(x3) (clones 907, 915, 921, and 923), and MUC1F/5BLTR (clones 203, 221 and 227) (Figure 2).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2. Detection of the epitope-tagged MUC1F/5BTR chimeric mucin series. Western blot analysis of chimeric mucins immunoprecipitated from whole cell lysates separated by 3%/6% SDS–PAGE. Approximately 1 mg of whole cell lysate was immunoprecipitated with 50 µl of M2-agarose-beads for each sample. Detection was by M2 anti-FLAG antibody followed by rabbit anti-mouse IgG conjugated to horseradish peroxidase. Migration of Full Range Rainbow protein molecular weight markers is indicated in kDa. ECL and ECL-sensitive film were used for the final detection of antibodies. For ease of labeling in Figures 2, 3, and 4, MUC1F/5BTR and the reiterations are shortened to 5BTR, 5BTR(x2), 5BTR(x3), and 5BLTR.

 


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 3. Glycosylation of the epitope-tagged MUC1F/5BTR chimeric series mucins. Western blot analysis of chimeric mucins immunoprecipitated from 1 mg of whole cell lysate with 50 µl of M2-agarose-beads for each sample and probed with monoclonal antibodies against tumor-associated and blood-group carbohydrate antigens. Migration of Full Range Rainbow protein molecular weight markers is indicated in kDa. ECL and ECL sensitive film were used for the final detection of antibodies. (A) B67.4 (sialyl Lea [{alpha}2-3]); (B) M2 reprobe of B67.4 western blot from A; (C) GSLA2 (sialyl Lea [{alpha}2-3]); (D) M2 reprobe of GSLA2 western blot from C; (E) B72.3 (sialyl Tn); (F) M2 reprobe of sialyl Tn, + lanes denote MUC1F positive control.

 


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 4. Glycosylation of the epitope-tagged MUC1F/5BTR chimeric series mucins. Western blot analysis of chimeric mucins as described in Figure 3. (A, B) B230.1 (Tri-Tn); (C) M2 reprobe of B230.1 western blot from B.

 
The mobility of the major M2-reactive species on sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) was similar for each of the clones carrying the same construct. However, a single clone of MUC1F/5BTR(x3) (clone 921) demonstrated a 105-kDa glycoform that either represents an incompletely processed form of the chimeric mucin or one carrying greater charge. There was also some variability apparent in the relative migration of the other MUC1F/5BTR(x3) glycoproteins. The observed mobility of the chimeric mucins in SDS–PAGE, relative to the molecular weights predicted for the recombinant proteins (Table I), suggests they are highly glycosylated. As the migration of glycoproteins in SDS–PAGE is dramatically affected by charge (Tytgat et al., 1995Go), these findings suggest that the addition of charged moieties (i.e., sulfate and/or sialic acid) on the chimeric mucins is likely to be relatively consistent. It is not possible to estimate the precise amount of chimeric mucin generated by each of these clones, though each lane on the western blot contains material immunoprecipitated from 1 mg of whole cell lysate with an excess of M2 agarose beads. The extent and/or type of glycosylation or protein folding may influence the accessibility of the FLAG epitope on certain forms of the chimeric mucins.

O-Glycosylation of the MUC1F/5BTR chimeric mucin series
Previous studies have indicated that variation in clonal populations and cell culture growth conditions can contribute to the type and extent of O-glycans detected (Emery et al., 1997Go; Mack et al., 1998Go). Hence, we examined at least three clones of each chimeric mucin construct with the exception of MUC1F/5BTR(x2) for which only two high expressing clones were available. For all experiments the mucin was purified on multiple occasions for analysis and the results were consistent. Epitope-tagged chimeric mucins immunoprecipitated with M2 were evaluated for the presence of carbohydrate structures by western blotting followed by analysis with a panel of nine antibodies against tumor-associated and blood-group carbohydrate antigens (Figure 3, Table II). Each western blot probed with an antibody to carbohydrate structures was subsequently reprobed with M2 to confirm that adequate and approximately equivalent levels of each chimeric mucin were present on the blot and to further enable comparison between the mobilities of the M2-reactive species and the glycoforms reacting with the antibodies against carbohydrate structures. To control for nonspecific interactions of M2-agarose beads with other glycoproteins in the cell extracts, immunoprecipitated material from N30, a pHß-APr1-neo vector control–transfected Caco2 cell line (Reid et al., 1999Go), was evaluated for reactivity. No reactivity was observed in N30-derived material with the M2 antibody or anticarbohydrate antibodies that were reactive with MUC1F and the MUC1F/5BTR chimeric mucin series (Table II).


View this table:
[in this window]
[in a new window]
 
Table II. Reactivity of anticarbohydrate antibodies with the epitope-tagged MUC1F/5BTR chimeric mucin series

 
Four of the nine antibodies, B67.4 (sialyl Lea [{alpha}2-3]), GSLA2 (sialyl Lea [{alpha}2-3]), B72.3 (sialyl Tn), and B230.1 (Tri-Tn), were reactive with certain members of the MUC1F/5BTR chimeric mucin series but not MUC1F({Delta}TR) (Figures 3 and 4, Table II). Antibodies specific to sialyl Lea ({alpha}2-3) (B67.4 and GSLA2) (Figure 3A–D) were reactive with most of the MUC1F/5BTR series with the exception of MUC1F/5BTR(x2) clone 603 and MUC1F/5BTR(x3) clones 915 and 921 for B67.4 and MUC1F/5BTR(x2) clone 603 alone for GLSA2. The weak reactivity of MUC1F/5BTR clone 1 with both these antibodies had not been seen previously (Silverman et al., 2001Go). To establish the cause of these inconsistencies, the passage number of MUC1F/5BTR clone 1 at the time of analysis was investigated. The results showed that this clone lost reactivity with the antibodies against the sialyl Lea ({alpha}2-3) structure at the higher passage numbers (greater than 80) that were analyzed previously (Silverman et al., 2001Go). In the western blots presented here, MUC1F/5BTR clone 1 lysates were collected between passage number 9 and 40.

An antibody specific to sialyl Tn (B72.3) was weakly reactive with one MUC1F/5BTR clone (316), MUC1F/5BTR(x3) (clones 915, 921, 923), and MUC1F/5BLTR (clones 203, 227) but demonstrated limited or no reactivity with the remaining MUC1F/5BTR or MUC1F/5BTR(x2) clones (Figure 3E and F). The glycoforms reactive with B72.3 had a faster relative mobility in SDS–PAGE than the M2-reactive material and were not necessarily consistent between different clones expressing the same construct. It was of interest to note that a second antibody that binds to sialyl Tn and to sialyl T, CC49, was reactive with MUC1F but not with the MUC1F/5BTR chimeric mucin series or MUC1F({Delta}TR) (data not shown).

Tri-Tn (B230.1) was detected on MUC1F/5BTR(x2), MUC1F/5BTR(x3), and MUC1F/5BLTR but not MUC1F/5BTR (Figure 4A). The reactivity of B230.1 on material prepared from clones expressing MUC1F/5BTR(x2) was less than that demonstrated for MUC1F/5BTR(x3) or MUC1F/5BLTR, indicating a direct correlation between length of the substituted TR domain and the amount of B230.1 reactivity. Figures 4B and C show that the glycoforms of MUC1F/5BTR(x2), MUC1F/5BTR(x3), and MUC1F/5BLTR that react with the B230.1 antibody are faster migrating than the major M2 reactive glycoforms. Potential explanations for these differences in mobility will be discussed in the Discussion.

MS analysis strategy
O-linked oligosaccharides from the immunoprecipitated mucins were prepared and analyzed as described previously (Silverman et al., 2001Go). Whole cell lysates were prepared from multiple independent clones and analyzed by FAB-MS for each of the MUC1F/5BTR chimeric mucin series. We previously showed that individual clones analyzed by FAB-MS on different occasions showed consistent profiles (Silverman et al., 2001Go). In this series of experiments each clone was analyzed at least twice, and the results of the experiments were reproducible when the quality of the data indicated good release of glycans during the reductive elimination.

FAB-MS of methylated products of reductive elimination
The FAB-MS spectra of the permethylated products of reductive elimination are shown in Figures 5GoGo8, and the assignment of these ions is given in Table III. Pseudomolecular ions corresponding to the molecular weight of known O-glycan structures were observed for each mucin (Table IV). The ions detected in the spectra of the MUC1F/5BTR chimeric mucin series correspond closely with those previously found for the other chimeric mucins (Silverman et al., 2001Go). No pseudomolecular ions were generated by any derivative when analyzed in the mass range greater than m/z 2200, suggesting that either the O-glycans present on the epitope-tagged mucins are predominantly relatively short structures or that longer structures are in very low abundance.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. FAB-MS of permethylated O-glycans from the epitope-tagged MUC1F/5BTR chimeric mucin clones. Mucin O-glycans were released by reductive elimination, purified by Sep-Pak C18 columns, permethylated, and analyzed as mixtures by FAB-MS. The spectra correspond to O-glycans from: (A) clone 1, (B) clone 316, and (C) clone 320. To facilitate visualization the higher mass range of the spectra were magnified as shown above each panel. Magnification reductions have been used where common contaminating peaks occur in the low mass region of the spectrum (-). The peaks marked + near 1310 and 1500 in C correspond to hexose polymers.

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6. FAB-MS of permethylated O-glycans from the epitope-tagged MUC1F/5BTR(x2) chimeric mucin clones. Mucin O-glycans were released by reductive elimination, purified by Sep-Pak C18 columns, permethylated, and analyzed as mixtures by FAB-MS. The spectra correspond to O-glycans from: (A) clones 603 and (B) clone 609. To facilitate visualization, the higher mass range of the spectra was magnified as shown above each panel. Magnification reductions have been used where common contaminating peaks occur in the low mass region of the spectrum (–).

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7. FAB-MS of permethylated O-glycans from the epitope-tagged MUC1F/5BTR(x3) chimeric mucin clones. Mucin O-glycans were released by reductive elimination, purified by Sep-Pak C18 columns, permethylated, and analyzed as mixtures by FAB-MS. The spectra correspond to O-glycans from: (A) clone 907, (B) clone 915, and (C) clone 921. To facilitate visualization the higher mass range of the spectra was magnified as shown above each panel. Magnification reductions have been used where common contaminating peaks occur in the low mass region of the spectrum (-).

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 8. FAB-MS of permethylated O-glycans from the epitope-tagged MUC1F/5BLTR chimeric mucin clones. Mucin O-glycans were released by reductive elimination, purified by Sep-Pak C18 columns, permethylated, and analyzed as mixtures by FAB-MS. The spectra correspond to O-glycans from: (A) clone 203, (B) clone 221, and (C) clone 227. To facilitate visualization the higher mass range of the spectra was magnified as shown above each panel. Magnification reductions have been used where common contaminating peaks occur in the low mass region of the spectrum (-). The peaks marked + near 1310 and 1500 in C correspond to hexose polymers.

 

View this table:
[in this window]
[in a new window]
 
Table III. Assignment of pseudomolecular ions observed in FAB-MS spectra of permethylated O-glycans from epitope-tagged mucins

 

View this table:
[in this window]
[in a new window]
 
Table IV. Comparative summary of pseudomolecular ions from the epitope-tagged mucins and assignment of predicted structures

 
The oligosaccharide compositions in Table IV are consistent with the presence of the two families of O-glycans on the MUC1F/5BTR chimeric mucins that were identified on the original chimeric mucins (Silverman et al., 2001Go). Thus members of the first family have compositions of Hex1HexNAc1-ol, Fuc1Hex1HexNAc1-ol, NeuAc1Hex1 HexNAc1-ol, and NeuAc2Hex1HexNAc1-ol, which are consistent with type 1 core structures. Members of the second family of pseudomolecular ions have compositions Hex1 HexNAc2-ol, Hex2HexNAc2-ol, Fuc1Hex2HexNAc2-ol, NeuAc1Hex1HexNAc2-ol, NeuAc1Hex2HexNAc2-ol, Hex3 HexNAc3-ol, NeuAc1Hex3HexNAc-ol, NeuAc1Fuc1 Hex2HexNAc2-ol, NeuAc1Hex2HexNAc3-ol, Fuc1Hex3 HexNAc3-ol, Hex4HexNAc4-ol, Fuc1Hex4HexNAc4-ol, NeuAc2Hex2HexNAc2-ol, and NeuAc2Hex3HexNAc4-ol, indicating that other core structures may be present. The predominant structure in this family is m/z 983 (e.g., Figure 5B), which corresponds to Hex2HexNAc2-ol, a composition that precludes a core 4 structure. Mono- and disialyl variations of this composition occur at m/z 1344 and m/z 1705, as well as a fucosylated non- and monosialyl variations at m/z 1157 and m/z 1518, respectively.

Four pseudomolecular ions detected in spectra from the MUC1F/5BTR chimeric series, m/z 1590, m/z 1606, m/z 1951, and m/z 2196, were not identified on any of the epitope-tagged mucins expressed in Caco2 cells that were analyzed previously. These pseudomolecular ions have compositions of NeuAc1Hex2HexNAc3-ol, Fuc1Hex3 HexNAc3-ol, NeuAc2Hex2HexNAc3-ol, and NeuAc2Hex3 HexNAc3-ol, respectively. The peaks at m/z 1590, m/z 1606, m/z 1951, and m/z 2196 were more likely to be detected in MUC1F/5BTR(x3) and MUC1F/5BLTR than MUC1F/5BTR and MUC1F/5BTR(x2) (Table IV). The m/z 1606 peak was most evident in the MUC1F/5BTR(x3) clones and was weak or absent in the MUC1F/5B clones. Not surprisingly, the m/z 1432 precursor structure (Hex3HexNAc3-ol) for the m/z 1606 peak was also absent from the clones lacking the fucosylated structure.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 References
 
Evaluation of the MUC1F/5BTR chimeric mucin series expression in Caco2 by western blot analysis revealed the presence of M2-reactive glycoforms with a broad range of apparent molecular weight. This broad range of gel mobilities for the chimeric mucins is probably indicative of distinct, but overlapping states of glycosylation that represent fully mature as well as intermediately and/or incompletely processed forms. Though the Caco2 cell line does not normally express MUC5B, it does produce another secreted mucin, MUC2 (Hollingsworth et al., 1994Go), and so it is likely to be representative of a secretory mucin-producing cell line. The variation in the mobility of M2 reactive glycoforms in different clones expressing MUC1F/5BTR(x3) has been observed in previous analyses of both MUC1F and MUC1F/4TR (Burdick et al., 1997Go; Reid et al., 1999Go; Silverman et al., 2001Go) and may reflect clonal variations in the expression of glycoprotein processing enzymes. These differences, however, have not been directly correlated with either the presence or absence of particular carbohydrate structures or the prevalence of charged residues.

The individual TRs of MUC5B show significant sequence variation; however, they contain numerous serine and threonine residues that may serve as potential sites for O-glycosylation (Table I). Sequence analysis of the MUC1F/5BTR chimeric mucins, using a neural network trained to recognize O-glycosylation sites, indicates numerous potential sites along the substituted TR domains (Table I, data not shown; Hansen et al., 1995Go, 1998aGo,bGo). The number of potential O-glycosylation sites on the MUC1F/5BTR chimeric mucins is determined by the number/length of the substituted TR domain(s). For example, although MUC1F/5BTR has 71 putative O-glycosylation sites associated with the MUC1F/5BTR TR, MUC1F/5BTR(x3) has 217, approximately three times as many.

The presence of a number of blood group and tumor-associated carbohydrate antigens was evaluated by western blotting with specific antibodies. Some of the antibodies used in this study, such as B72.3 and CC49, are among the most intensively investigated immunological reagents available for diagnosis and treatment of a variety of adenocarcinomas. Although the minimal structure that is recognized by these antibodies is known (sialyl Tn for B72.3 and both sialyl Tn and sialyl T for CC49), their ability to bind to these structures on mucin-type core proteins of different sequence and structure is not known. The results presented here provide additional insight into core proteins on which these specific epitopes can be detected.

The epitope recognized by B72.3 is detected on both the native MUC1 TR and on constructs expressing the MUC5B TR (Table II, Figure 3), but the CC49 epitope has only been observed on the native MUC1 TR structure (Table II; Burdick et al., 1997Go; Silverman et al., 2001Go). Neither epitope was recognized on MUC1{Delta}TR, even though the FAB-MS data show that structures consistent with sialyl T (m/z 895 in Figures 5GoGo8) are found on virtually all of the recombinant constructs, suggesting that these antibodies do not bind effectively to these structures (at least on MUC1) when they are presented outside of TR domains. This finding is consistent with previous reports that B72.3 reacts most strongly with clustered sialyl Tn (Hanisch et al., 1989Go; Siddiki et al., 1993Go; Zhang et al., 1995Go). Our studies extend the previous findings by demonstrating that the B72.3 epitope can be carried by both MUC1 TR and MUC5B TR sequence, but the CC49 epitope has only been found to be specifically associated with the MUC1 TR to date.

Two of the antibodies, B67.4 and GSLA2 (sialyl Lea), showed reactivity with the majority of the MUC1F/5BTR chimeric mucin series expressed in Caco2. GLSA2 reacted with more of the mucins than did B67.4, suggesting that the precise conformation of the epitope detected by these antibodies is not identical and that the sequence context of the TRs is more important that their number.

The MUC1F/5BTR chimeric mucin series also carried a trimeric form of the Tn antigen detected by the B230.1 antibody. Tri-Tn was evident on the iterated MUC1F/5BTR chimeric mucin series and MUC1F/5BLTR, but not on clones expressing a single MUC1F/5BTR TR domain (i.e., MUC1F/5BTR). This pattern of reactivity indicates a direct relationship between the number of potential O-glycosylation sites and the ability to detect a particular antigen. Alternatively the backbone structure of the mucin TR affects the configuration of the antigenic epitopes. This finding may also be explained by an increase in avidity of antibody binding that is predicted to occur with increasing numbers of structures to which bivalent antibodies could bind.

As observed for the B72.3 reactive MUC1F/5B glycoforms, the major B230.1 reactive glycoforms show significantly greater mobility than the major M2-reactive material. Unlike B72.3, which reacts with different mobility forms within the same group of mucins (e.g., MUC1F/5BTR[x3]), B230.1 reacts primarily with a single glycoform in each group. Because the Tri-Tn represents a nonterminally glycosylated structure, this pattern of reactivity may indicate that the forms demonstrating greater mobility correspond to material from earlier stages in glycosylation. There are several potential explanations to account for the differences in mobility between the major M2-reactive and carbohydrate antibody-reactive glycoforms of the MUC1F/5B series: (1) the FLAG epitope is masked on certain glycoforms of the chimeric mucins during western blotting (a phenomenon that has been observed in other cell lines; Silverman et al., unpublished data); (2) the FLAG epitope is cleaved in some cases (Parry et al., 2001Go); (3) there are differences in sensitivity of the western blot assay between the anti-FLAG antibody, which binds to a single epitope per molecule, and the antibodies that bind to carbohydrate structures, which may be present at levels that are more than 100-fold higher per molecule in the chimeric constructs; and (4) other mucin-like molecules have associated or copurified with the products of the MUC1/5BTR constructs.

We have evidence of non-epitope-tagged MUC1 coimmunoprecipitating with epitope tagged MUC1F (Parry et al., 2001Go). However, previous analysis of purified material by high-performance liquid chromatography (Parry et al., 2001Go) and by silver staining (unpublished data) did not show evidence of significant non-mucin contaminants.

The MUC1F/5BTR chimeric series of mucins carries most but not all of the structures seen on MUC1F expressed in Caco2 cells (Reid et al., 1999Go; Silverman et al., 2001Go). The absence of reactivity between the chimeric mucins and certain antibodies may be accounted for in a number of ways. One possibility is that because the length of the TR sequence in these constructs is significantly shorter than in the native mucin, an insufficient number of epitopes are present for antibody reactivity. For instance, certain structures such as Tri-Tn and sialyl Tn were only detected in cell lines containing MUC1F/5BTR forms with iterated or extended TR constructs. Another possibility is that the antibodies interact with patches of O-linked carbohydrates that result from the primary sequence of the TRs and consequently may not be possible to generate on all of the chimeric TR domains. The direct correlation between the number of substituted mucin TR domains and greater intensity of Tri-Tn reactivity (B230.1) suggests that in some cases the lack of antibody reactivity may reflect the paucity of available epitopes on the shorter TRs.

Evaluation of the MUC1F/5BTR chimeric mucin series by analysis of the O-glycans detected through FAB-MS and the reactivity of antibodies to known carbohydrate epitopes confirms our previous descriptions of the structures carried on the epitope-tagged chimeric mucins (Silverman et al., 2001Go). In the previous studies we evaluated epitope-tagged MUC1, a form of MUC1 lacking TRs (MUC1F) TR and chimeric mucins carrying TRs from MUC2, MUC4, MUC5AC, and MUC5B in (MUC1F) TR (Silverman et al., 2001Go). In addition, considering data from the FAB-MS screening experiments, periodate oxidation of MUC1F, and linkage analysis (Silverman et al., 2001Go), we conclude that the same core 1 and core 2 O-glycan structures described previously are present on the MUC1F/5BTR chimeric mucin series evaluated here. Though normal colonic mucins contain core 3 and core 4 structures (Podolsky, 1985Go), these were not detected in the Caco2 colon carcinoma cell line in this or previous studies (Silverman et al., 2001Go).

Glycans with more extended polylactosamine structures were more likely to be detected on the MUC1F/5B mucins with increased numbers of TRs, suggesting that increasing the TR number makes it more likely that a particular structure present in low abundance on the short TR mucins will be detected. The presence of one pseudomolecular ion (m/z 1256) previously found to be unique to MUC1F/5ACTR and MUC1F/5BTR was confirmed on most of the MUC1F/5BTR and MUC1F/5BTR(x2) clones but was only present on one MUC1F/5B(x3) and two MUC1F/5BL clones (Figure 8 and Table IV). This structure (NeuAc2Hex1HexNAc1-ol) represents an additionally sialylated counterpart to the pseudomolecular ion at m/z 895 (NeuAc1Hex1HexNac1-ol), which is evident on each of the MUC1F/5BTR chimeric mucins that show the pseudomolecular ion at m/z 1256 (e.g., MUC1F/5BTR clone 316). Furthermore, the pseudomolecular ion at m/z 1432 (Hex3HexNAc3-ol), which was previously described as being associated only with MUC1F/4TR and in a single preparation out of six of MUC1F/5BTR (clone 1), was also detected in spectra from most of the MUC1F/5BTR chimeric mucin series carrying two or more segments of TR (though only one MUC1F/5BL mucin) (Figure 8). This structure contains an additional lactosamine extension relative to the Hex2HexNac2-ol (m/z 983) present in each of the chimeric mucins. The detection of m/z 1432 on the MUC1F/5BTR chimeric mucin series indicates that the structure represented by this pseudomolecular ion is not unique to the MUC4 TR but is also evident on the MUC5B TR. The previous inability to consistently detect this pseudomolecular ion in clones containing a single MUC5B TR may reflect the low abundance of this structure on the MUC5B TR. Iteration of the MUC5B TR may amplify this signal and as a consequence could account for the more consistent appearance of this structure in spectra from all three clones of MUC1F/5BTR(x3).

It is also possible that the iterated/extended TR domain of the MUC1F/5BTR chimeric mucin series and/or non-TR sequences within the MUC1F/5BLTR domain may enhance the accessibility of the TR to various glycosyltransferases. Due to their amino acid composition and the presence of numerous glycans, mucin TR domains typically assume a rigid, bottlebrush-like structure (Marianne et al., 1987Go; Rose et al., 1984Go). This characteristic feature of mucins and others structures associated with the polypeptide sequence may affect the activity of glycosyltransferases and contribute to the generation of specific carbohydrate structures. For instance, in MUC1F/5BLTR there are 6 cysteine residues within the first 40 aa of the substituted TR domain. This region corresponds to a cysteine-rich non-TR domain that interrupts the native MUC5B TR domain four times (Desseyn et al., 1997Go) and is associated with the multimerization of MUC5B. It is likely that these sequences contribute to the structure of polypeptide and perhaps may also affect the accessibility and apparent glycosylation of the chimeric TR domain.

It is of interest that a number of the carbohydrate structures that we have detected by FAB-MS on the iterated MUC1F/5BTR(x2/x3/LTR) clones (for example, the m/z 1256 [NeuAc2Hex1HexNAc1-ol], 1432 [Hex3HexNAc3-ol], 1590 [NeuAc1Hex2HexNAc3-ol], 1606 [Fuc1Hex3 HexNAc3-ol], 1951 [NeuAc2Hex2HexNAc3-ol], and 2196 [NeuAc2Hex3HexNAc3-ol] structures) are not evident on full-length MUC1F expressed in the same cell line (Caco2). The MUC1F-native TR contains 926 amino acids, nearly twice the number of residues in the MUC1F/5B(x3TR) repeat. Hence the appearance of certain carbohydrate structures on the iterated MUC1F/5B structure that are not seen on MUC1F strengthens our previous hypothesis (Silverman et al., 2001Go) that the primary amino acid sequence of the TR of different mucins contributes to their O-glycosylation, rather than the latter being solely a feature of the glycoprotein processing enzymes that are present in the cell line in which the mucins are expressed.

The intial hypothesis that we aimed to evaluate with this series of experiments was that the number of TRs within a mucin glycoprotein affected the O-glycosylation and hence the physical properties of that mucin. Polymorphisms in mucin TR number might then be directly associated with disease susceptibility. The best way to evaluate this question would be to isolate mucins from individuals carrying different mucin TR allele lengths; however, the reagents and techniques are not currently available to achieve this. The system we have developed allows some conclusions to be drawn, despite the fact that we are evaluating mucin glycoproteins minigenes that may not fully represent the biochemistry of the full-length native mucins. We have shown that increasing the number of TRs within the MUC1F/5B chimeric mucin generates novel epitopes detected by antibodies against carbohydrate epitopes. The differences we detected are subtle, but it is possible that when amplified to the full-length mucins these variations might have biological significance.


    Material and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 References
 
Generation of epitope-tagged chimeric MUC1 constructs
The epitope-tagged (FLAG) MUC1 cDNA (MUC1F) and a construct lacking the TR domain (MUC1F[{Delta}TR]) were described previously (Burdick et al., 1997Go; Silverman et al., 2001Go). Insertion of the FLAG sequence into MUC1F({Delta}TR) created two unique restriction enzyme sites, BglII and AspI immediately adjacent to the epitope. These two sites were used for generating the following chimeric mucins.

The MUC5B chimeras (MUC1F/5BTR, MUC1F/5BTRx2, and MUC1F/5BTRx3) include a 510-bp BamHI-BstEII fragment of the MUC5B cDNA clone S1239 (GenBank Z72496:1791–2300) kindly donated by Drs. Porchet, Laine, and Aubert (Desseyn et al., 1997Go). This fragment was cloned into a pBluescript (SK) vector containing a modified multiple cloning site consisting of KpnI and SacI restriction sites (5'CAGATCTATGGATCCGGTGACCGACATGGTCGGTAC3') generating pBSHS07/HS08 MUC5B. This cDNA was excised with BglII and AspI and cloned into MUC1F({Delta}TR) to generate MUC1F/5BTR. To generate MUC1F/5BTR(x2) and MUC1F/5BTR(x3), the same cDNA was blunt-ended after digestion with BamHI, creating a novel ClaI site. The 510-bp BamHI-BsteII MUC5B cDNA fragment was cloned into two pBluescript (SK) vectors containing modified multiple cloning sites (5'GTGACCAGAATTCATCGATGGTAC3') and (5'CGAATTCATGGATCCGGTGACCTATCGATGGTAC3'), generating pBSHS16/17 MUC5B(A) and pBSHS18/HS19 MUC5B. An EcoRI-ClaI MUC5B fragment derived from pBSHS18/HS19 MUC5B was cloned into the corresponding sites of pBSHS16/HS17 MUC5B(A) generating pBSHS16/HS17 MUC5B(B). BglII-ClaI fragments of pBSHS16/HS17 MUC5B(A) and pBSHS16/HS17 MUC5B(B) were cloned into pBSHS07/HS08 MUC5B and subsequently cloned into MUC1F({Delta}TR) using Bgl II and Asp I, generating MUC1F/5BTR(x2) (pBS) and MUC1F/5BTR(x3) (pBS).

The long MUC5B chimera (MUC1F/5BLTR) includes a 1417-bp BglII-EcoNI fragment of the MUC5B cDNA clone Jer 57 (GenBank X74955: 65–1473) kindly donated by Drs. Porchet, Laine, and Aubert (Dufosse et al., 1993Go). This fragment is an EcoRI subclone of Jer 57 in pBR322 that was modified by mutagenesis to generate flanking BglII (5') and a EcoNI (3') sites. The 1417-bp BglII-EcoNI fragment was subsequently cloned into the corresponding sites of MUC1F({Delta}TR) (pBS), generating MUC1F/MUC5BL. MUC1F/MUC5BL was cloned into the EcoRI site of the pcDNA3.1/Zeo expression vector. MUC1F/5BLTR was excised from pcDNA3.1/Zeo using KpnI and NotI and cloned into a pBluescript (SK) vector containing a modified multiple cloning site (5'CGTCGACAGCGGCCGCAGTCGACACTAGTGGTA3' pBSHS14/HS15), generating MUC1F/5BLTR (pBS). All constructs were subcloned into the expression vector pHß-APr1-neo (Gunning et al., 1987Go) at the SalI site and confirmed by sequence analysis.

Expression of epitope-tagged chimeric mucins
The Caco2 colon adenocarcinoma cell line (Fogh et al., 1977Go) was cultured in Dulbecco's modified Eagle medium (Gibco BRL, Paisley, Scotland) supplemented with 10% fetal bovine serum. A control transfected cell line (pHß-APr1-neo) and clones expressing MUC1F in Caco2 were described previously (Reid et al., 1999Go). The chimeric constructs and MUC1F({Delta}TR) were transfected into Caco2 cells by standard calcium phosphate transfection (Graham and van der Eb, 1973Go), and clones carrying integrated constructs were selected using G418 (Gibco BRL) at 600 µg/ml. Multiple clones were isolated for each construct and evaluated for expression of the chimeric mucins.

Preparation of cell lysates and immunopurification
Cell lysates were prepared from confluent flasks of cells with 10 µl/cm2 of lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 5 mM ethylenediamine tetra-acetic acid (EDTA), 1 mM phenylmethylsulfonyl fluoride, 1% [w/v] Triton X-100, 0.02% [w/v] NaN3). Lysates were cleared by centrifugation at 400 x g for 5 min and then at 15,000 x g for 5 min. Protein concentration of the cell lysates was assayed using the DC Protein Assay Kit (BioRad, Hemel Hempstead, UK) with bovine serum albumin standards. The samples were used immediately for immunopurification with M2 antibody conjugated to agarose beads (Sigma, St. Louis, MO) at 4°C for 15 h. The conjugated agarose beads were pelleted by centrifugation at 200 x g for 5 min and rinsed twice with NET buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 5 mM EDTA) containing 1% (w/v) Triton X-100.

For MS studies the rinsed pellets were subsequently washed in NET buffer without Triton X-100. For western blot analysis, immunoprecipitated mucin was eluted from the conjugated agarose beads with 500 µg/ml of FLAG peptide (Sigma) in NET buffer containing 1% (w/v) Triton X-100. The sample was heated to 80°C in sample loading buffer (2% [w/v] SDS, 62.5 mM Tris, pH 6.8, 5% [w/v] glycerol, 5% [v/v] 2-mercaptoethanol, 0.01% [w/v] bromophenol blue) for 5 min before loading on SDS–polyacrylamide gels. For MS, immunoprecipitated mucin was eluted as described but without Triton X-100, and the supernatant was collected and freeze-dried.

Western blotting
Immunoprecipitated mucins were resolved using SDS–PAGE (3% stacking gel and 6% resolving gel or 3% stacking gel and 10% resolving gel). Proteins were electrophoretically transferred to Hybond-C Super membranes (Amersham Pharmacia Biotech, Little Chalfont, United Kingdom), and blocked in 5% (w/v) fat-free dried skimmed milk (Marvel) in phosphate buffered saline (140 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO3, 1.4 mM KH2PO3, pH 7.3) for 1 h. Monoclonal antibodies were obtained from the following sources: M2 was purchased from Sigma; CO514, B67.4, CO431, B93.1, B32.4, and B230.1 were the gift of Mark Reddish of Biomira (Edmonton, Alberta); GSLA2 was provided by John Magnani (Glycotech, Rockville, MD); and B72.3 and CC49 were the gift of David Colcher (University of Nebraska Medical Center, Omaha, NE). Horseradish peroxidase–conjugated goat anti-rabbit and rabbit anti-mouse antibodies were purchased from Dako (High Wycombe, United Kingdom). Primary antibodies were diluted 1:500–1:2500 in phosphate buffered saline containing 1% (w/v) fat-free dried skimmed milk. Immunodetection was carried out as described previously (Reid et al., 1999Go). Enhanced chemiluminescence (ECL) reagents and ECL-sensitive film (Amersham Pharmacia) were used for the final detection of antibodies.

Positive controls for antibody reactivity comprised MUC1F in Caco2 or MUC1F in HT29 clones, where appropriate (Reid et al., 1999Go). To control for nonspecific interactions of M2 agarose beads with other glycoproteins in the cell extracts, immunoprecipitated material from N30, a pHß-APr1-neo vector control–transfected Caco2 cell line (Reid et al., 1999Go) was evaluated for antibody reactivity.

MS
Preparation of oligosaccharides
O-linked oligosaccharides were liberated from the immunoprecipitated mucins by reductive elimination (400 µl of 1 M NaBH4 in 0.05 M NaOH at 45°C for 16 h) and desalted through a Dowex 50W-X8(H) column. Removal of traces of detergent was achieved by passing the desalted eluate through a Sep-Pak C18 column (Waters, Elsivee, Hertsford, UK). Excess borates were removed by coevaporation with 10% (v/v) acetic acid in methanol under a stream of nitrogen.

Chemical derivatization for FAB-MS
Permethylation using a sodium hydroxide procedure was performed as described previously (Dell et al., 1994Go). After derivatization the reactions were purified on Sep-Pak C18 (Dell et al., 1994Go).

FAB-MS analysis
FAB-MS spectra were acquired using a ZAB-2SE 2FPD mass spectrometer fitted with a cesium ion gun operated at 30 kV. Data acquisition and processing were performed using the VG Analytical Opus software. Solvents and matrices were as described previously (Dell et al., 1994Go).


    Acknowledgements
 
We are grateful to Drs. Nicole Porchet, Anne Laine, and Jean-Pierre Aubert for the S1239 and Jer57 cDNA clones. This work was supported by the Cystic Fibrosis Trust (U.K.), the Biotechnology and Biological Sciences Research Council; and the Wellcome Trust, including a Biomedical Research Collaboration Grant. H.S.S. was supported by the Keasbey Memorial Foundation; M.S.-S. was a recipient of a Medical Research Council studentship.

1 To whom correspondence should be addressed; e-mail: aharris{at}molbiol.ox.ac.uk Back


    Abbreviations
 
ECL, enhanced chemiluminescence; EDTA, ethylenediamine tetra-acetic acid; FAB, fast atom bombardment; MS, mass spectrometry, SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; TR, tandem repeat


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 References
 
Burdick, M.D., Harris, A., Reid, C.J., Iwamura, T., and Hollingsworth, M.A. (1997) Oligosaccharides expressed on MUC1 produced by pancreatic and colon tumor cell lines. J. Biol. Chem., 272, 24198–24202.[Abstract/Free Full Text]

Carvalho, F., Seruca, R., David, L., Amorim, A., Seixas, M., Bennett, E., Clausen, H., and Sutton-Smith, M. (1997) MUC1 gene polymorphism and gastric cancer—an epidemiological study. Glycoconj. J., 14, 107–111.[CrossRef][Web of Science][Medline]

Dell, A., Reason, A.J., Khoo, K.H., Panico, M., McDowell, R.A., and Morris, H.R. (1994) Mass Spectrometry of carbohydrate-containing biopolymers. Methods Enzymol., 230, 108–132.[Web of Science][Medline]

Desseyn, J.L., Guyonnet Duperat, V., Porchet, N., Aubert, J.P., and Laine, A. (1997) Human mucin gene MUC5B, the 10.7-kb large central exon encodes various alternate subdomains resulting in a super-repeat. Structural evidence for a 11p15.5 gene family. J. Biol. Chem., 272, 3168–3178.[Abstract/Free Full Text]

Dufosse, J., Porchet, N., Audie, J.P., Guyonnet Duperat, V., Laine, A., Van Seuningen, I., Marrakchi, S., Degand, P., and Aubert, J.P. (1993) Degenerate 87-base-pair tandem repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides mapped to 11p15. Biochem. J., 293, 329–337.

Emery, N., Lo Guidice, J.M., Lafitte, J.J., Lhermitte, M., and Roussel, P. (1997) The fucosylation and secretion of mucins synthesized in human bronchial cells vary according to growth conditions. Glycobiology, 7, 95–101.[Abstract/Free Full Text]

Fogh, J., Wright, W.C., and Loveless, J.D. (1977) Absence of HeLa cell contamination in 169 cell lines derived from human tumors. J. Natl. Cancer Inst., 58, 209–214.[Web of Science][Medline]

Graham, F.L. and van der Eb, A.J. (1973) Transformation of rat cells by DNA of human adenovirus 5. Virology, 54, 536–539.[CrossRef][Web of Science][Medline]

Gum, J.R. Jr., Ho, J.J.L., Pratt, W.S., Hicks, J.W., Hill, A.S., Vinall, L.E., Roberton, A.M., Swallow, D.M., and Kim, Y.S. (1997) MUC3 human intestinal mucin. Analysis of gene structure, the carboxyl terminus, and a novel upstream repetitive region. J. Biol. Chem., 272, 26678–26686.[Abstract/Free Full Text]

Gunning, P., Leavitt, J., Muscat, G., Ng, S.Y., and Kedes, L. (1987) A human beta-actin expression vector system directs high-level accumulation of antisense transcripts. Proc. Natl. Acad. Sci. USA, 84, 4831–4835.[Abstract/Free Full Text]

Hanisch, F.G. and Muller, S. (2000) MUC1: the polymorphic appearance of a human mucin. Glycobiology, 10, 439–449.[Free Full Text]

Hanisch, F., Uhlenbruck, G., Egge, H., and Peter-Katalinic, J. (1989) A B72.3 second generation monoclonal antibody (CC49) defines the mucin-carried carbohydrate epitope Gal beta(1-3) [NeuAc alfa(2-6)] GalNAc. Biol. Chem. Hoppe-Seyler, 370, 21–26.[Web of Science][Medline]

Hansen, J.E., Lund, O., Engelbrecht, J., Bohr, H., and Nielsen, J.O. (1995) Prediction of O-glycosylation of mammalian proteins: specificity patterns of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase. Biochem. J., 308(3), 801–813.

Hansen, J.E., Lund, O., Nilsson, J., Rapacki, K., and Brunak, S. (1998a) O-GLYCBASE version 3.0: a revised database of O-glycosylated proteins. Nucleic Acids Res., 26, 387–389.[Abstract/Free Full Text]

Hansen, J.E., Lund, O., Tolstrup, N., Gooley, A.A., Williams, K.L., and Brunak, S. (1998b) NetOglyc: prediction of mucin type O-glycosylation sites based on sequence context and surface accessibility. Glycoconj. J., 15, 115–130.[CrossRef][Web of Science][Medline]

Harris, A. and Reid, C. (1998) Cystic fibrosis and mucins. J. Med. Genet., 35, 82–83.[Free Full Text]

Hollingsworth, M.A., Strawhecker, J.M., Caffrey, T.C., and Mack, D.R. (1994) Expression of MUC1, MUC2, MUC3 and MUC4 mucin mRNAs in human pancreatic and intestinal tumor cell lines. Int. J. Cancer, 57, 198–203.[Web of Science][Medline]

Kirkbride, H., Bolscher, J., Nazmi, K., Vinall, L., Nash, M., Moss, F., Mitchell, D., and Swallow, D. (2001) Genetic polymorphism of MUC7: allele frequencies and association with asthma. Eur. J. Hum. Genet., 9, 347–354.[CrossRef][Web of Science][Medline]

Kyo, K., Parkes, M., Takei, Y., Nishimori, H., Vyas, P., Satsangi, J., Simmons, J., Nagawa, H., Baba, S., Jewell, D., and others. (1999) Association of ulcerative colitis with rare VNTR alleles of the human intestinal mucin gene, MUC3. Hum. Mol. Genet., 8, 307–311.[Abstract/Free Full Text]

Kyo, K., Muto, T., Nagawa, H., Lathrop, G.M., and Nakamura, Y. (2001) Associations of distinct variants of the intestinal mucin gene MUC3A with ulcerative colitis and Crohn's disease. J. Hum. Genet., 46, 5–20.[CrossRef][Web of Science][Medline]

Mack, D.R., Cheng, P.W., Perini, F., Wei, S., and Hollingsworth, M.A. (1998) Altered expression of sialylated carbohydrate antigens in HT29 colonic carcinoma cells. Glycoconj. J., 15, 1155–1163.[CrossRef][Web of Science][Medline]

Marianne, T., Perini, J.M., Lafitte, J.J., Houdret, N., Pruvot, F.R., Lamblin, G., Slayter, H.S., and Roussel, P. (1987) Peptides of human bronchial mucus glycoproteins. Size determination by electron microscopy and by biosynthetic experiments. Biochem. J., 248, 189–195.[Web of Science][Medline]

Parry, S., Silverman, H.S., McDermott, K., Willis, A., Hollingsworth, M.A., and Harris, A. (2001) Identification of MUC1 proteolytic cleavage sites in vivo. Biochem. Biophys. Res. Commun., 283, 715–720.[CrossRef][Web of Science][Medline]

Pigny, P., Pratt, W.S., Laine, A., Leclercq, A., Swallow, D.M., Nguyen, V.C., Aubert, J.P., and Porchet, N. (1995) The MUC5AC gene: RFLP analysis with the Jer58 probe. Hum. Genetics, 96, 367–368.[Web of Science][Medline]

Podolsky, D.K. (1985) Oligosaccharide structures of human colonic mucin. J. Biol. Chem., 260, 8262–8271.[Abstract/Free Full Text]

Reid, C.J., Burdick, M.D., Hollingsworth, M.A., and Harris, A. (1999) CFTR expression does not influence glycosylation of an epitope-tagged MUC1 mucin in colon carcinoma cell lines. Glycobiology, 9, 389–398.[Abstract/Free Full Text]

Rose, M.C., Voter, W.A., Brown, C.F., and Kaufman, B. (1984) Structural features of human tracheobronchial mucus glycoprotein. Biochem. J., 222, 371–377.[Web of Science][Medline]

Siddiki, B., Ho, J.J., Huang, J., Byrd, J.C., Lau, E., Yuan, M., and Kim, Y.S. (1993) Monoclonal antibody directed against colon cancer mucin has high specificity for malignancy. Int. J. Cancer, 54, 467–474.[Web of Science][Medline]

Silverman, H.S., Parry, S., Sutton-Smith, M., Burdick, M.D., McDermott, K., Reid, C.J., Batra, S.K., Morris, H.R., Hollingsworth, M.A., Dell, A., and Harris, A. (2001) In vivo glycosylation of mucin tandem repeats. Glycobiology, 11, 459–471.[Abstract/Free Full Text]

Swallow, D.M., Gendler, S., Griffiths, B., Corney, G., Taylor, P.J., and Bramwell, M.E. (1987) The human tumour-associated epithelial mucins are coded by an expressed hypervariable gene locus PUM. Nature, 328, 82–84.[CrossRef][Medline]

Swallow, D.M., Vinall, L.E., Gum, J.R., Kim, Y.S., Yang, H., Rotter, J.I., Mirza, M., Lee, J.C., and Lennard Jones, J.E. (1999) Ulcerative colitis is not associated with differences in MUC2 mucin allele length [letter]. J. Med. Genet., 36, 859–860.[Free Full Text]

Tytgat, K.M., Swallow, D.M., Van, K.B., Buller, H.A., Einerhand, A.W., and Dekker, J. (1995) Unpredictable behaviour of mucins in SDS/polyacrylamide-gel electrophoresis [letter]. Biochem. J., 310, 1053–1054.

Vinall, L.E., Hill, A.S., Pigny, P., Pratt, W.S., Toribara, N., Gum, J.R., Kim, Y.S., Porchet, N., Aubert, J.P., and Swallow, D.M. (1998) Variable number tandem repeat polymorphism of the mucin genes located in the complex on 11p15.5. Hum. Genet., 102, 357–366.[CrossRef][Web of Science][Medline]

Vinall, L., Fowler, J., Jones, A., Kirkbride, H., de Bolos, C., Laine, A., Porchet, N., Gum, J., Kim, Y., Moss, F., and others. (2000) Polymorphism of human mucin genes in chest disease: possible significance of MUC2. Am. J. Respir. Cell Mol. Biol., 23, 678–686.[Abstract/Free Full Text]

Zhang, S., Walberg, L.A., Ogata, S., Itzkowitz, S.H., Koganty, R.R., Reddish, M., Gandhi, S.S., Longenecker, B.M., Lloyd, K.O., and Livingston, P.O. (1995) Immune sera and monoclonal antibodies define two configurations for the sialyl Tn tumor antigen. Cancer Res., 55, 3364–3368.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
JCBHome page
N. Vadaie, H. Dionne, D. S. Akajagbor, S. R. Nickerson, D. J. Krysan, and P. J. Cullen
Cleavage of the signaling mucin Msb2 by the aspartyl protease Yps1 is required for MAPK activation in yeast
J. Cell Biol., October 22, 2008; 181(7): 1073 - 1081.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. J. Swanson, K. M. McDermott, P. K. Singh, J. P. Eggers, P. R. Crocker, and M. A. Hollingsworth
MUC1 Is a Counter-Receptor for Myelin-Associated Glycoprotein (Siglec-4a) and Their Interaction Contributes to Adhesion in Pancreatic Cancer Perineural Invasion
Cancer Res., November 1, 2007; 67(21): 10222 - 10229.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. K. Singh, Y. Wen, B. J. Swanson, K. Shanmugam, A. Kazlauskas, R. L. Cerny, S. J. Gendler, and M. A. Hollingsworth
Platelet-Derived Growth Factor Receptor {beta}-Mediated Phosphorylation of MUC1 Enhances Invasiveness in Pancreatic Adenocarcinoma Cells
Cancer Res., June 1, 2007; 67(11): 5201 - 5210.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A. N. Round, T. J. McMaster, M. J. Miles, A. P. Corfield, and M. Berry
The isolated MUC5AC gene product from human ocular mucin displays intramolecular conformational heterogeneity
Glycobiology, June 1, 2007; 17(6): 578 - 585.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Fidalgo, R. R. Barrales, J. I. Ibeas, and J. Jimenez
Adaptive evolution by mutations in the FLO11 gene
PNAS, July 25, 2006; 103(30): 11228 - 11233.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Janssen, A. Kruit, J. C. Grutters, H. J. Ruven, W. B. Gerritsen, and J. M. van den Bosch
The Mucin-1 568 Adenosine to Guanine Polymorphism Influences Serum Krebs von den Lungen-6 levels
Am. J. Respir. Cell Mol. Biol., April 1, 2006; 34(4): 496 - 499.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S.-H. Leir, S. Parry, T. Palmai-Pallag, J. Evans, H. R. Morris, A. Dell, and A. Harris
Mucin Glycosylation and Sulphation in Airway Epithelial Cells Is Not Influenced by Cystic Fibrosis Transmembrane Conductance Regulator Expression
Am. J. Respir. Cell Mol. Biol., May 1, 2005; 32(5): 453 - 461.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/4/265    most recent
cwg028v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Silverman, H. S.
Right arrow Articles by Harris, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silverman, H. S.
Right arrow Articles by Harris, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?