Skip Navigation


Glycobiology Advance Access originally published online on November 26, 2002
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/3/159    most recent
cwg013v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Hardt, B.
Right arrow Articles by Bause, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hardt, B.
Right arrow Articles by Bause, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 3 159-168
© 2003 Oxford University Press

(Arg)3 within the N-terminal domain of glucosidase I contains ER targeting information but is not required absolutely for ER localization

Birgit Hardt, Burga Kalz-füller, Raquel Aparicio, Christof Völker and Ernst Bause1

Institut Für Physiologische Chemie, Universität Bonn Nussallee 11, 53115 Bonn, Germany

Received on May 17, 2002; revised on September 17, 2002; accepted on September 17, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results and discussion
 Conclusions
 Materials and methods
 References
 
Glucosidase I is an endoplasmic reticulum (ER) type II membrane enzyme that cleaves the distal {alpha}1,2-glucose of the asparagine-linked GlcNAc2-Man9-Glc3 precursor. To identify sequence motifs responsible for ER localization, we prepared a protein chimera by transferring the cytosolic and transmembrane domain of glucosidase I to the luminal domain of Golgi-Man9-mannosidase. The GIM9 hybrid was overexpressed in COS 1 cells as an ER-resident protein that displayed {alpha}1,2-mannosidase activity, excluding the possibility that the glucosidase I–specific domains interfere with folding of the Man9-mannosidase catalytic domain. After substitution of the Args in position 7, 8, or 9 relative to the N-terminus by leucine, the GIM9 mutants were transported to the cell surface indicating that the (Arg)3 sequence functions as an ER-targeting motif. Cell surface expression was also observed after substitution of Arg-7 or Arg-8 but not Arg-9 in GIM9 by either lysine or histidine. Thus the side chain structure, including its positive charge, appears to be essential for signal function. Analysis of the N-linked glycans suggests that the (Arg)3 sequence mediates ER localization through Golgi-to-ER retrograde transport. Glucosidase I remained localized in the ER after truncation or mutation of the N-terminal (Arg)3 signal, in contrast to comparable GIM9 mutants. ER localization was also observed with an M9GI chimera consisting of the cytosolic and transmembrane domain of Man9-mannosidase and the glucosidase I catalytic domain. ER-specific targeting information must therefore be provided by sequence motifs contained within the glucosidase I luminal domain. This structural information appears to direct ER localization by retention rather than by retrieval, as concluded from N-linked Man9-GlcNAc2 being the major glycan released from the wild-type enzyme.

Key words: arginine motif / endoplasmic reticulum / glucosidase I / type II membrane protein


    Introduction
 Top
 Abstract
 Introduction
 Results and discussion
 Conclusions
 Materials and methods
 References
 
The endoplasmic reticulum (ER) contains a population of resident proteins that perform a variety of organelle-specific functions, including protein and lipid modification, processing of N-linked glycans, vesicle formation, protein sorting, and transport. Localization of these proteins in the ER is achieved by retention and/or retrieval mechanisms involving defined sequence motifs and targeting domains within the polypeptide chain (Teasdale and Jackson, 1996Go). One of the best characterized localization signals is the C-terminal KDEL sequence of soluble ER-resident proteins (Lewis and Pelham, 1992Go; Yamamoto et al., 2001Go). Specific recognition of this tetrapeptide sequence by receptor proteins in post-ER compartments initiates formation of COPI-coated vesicles, which transport the KDEL-containing protein cargo selectively from the Golgi to the ER (Wieland and Harter, 1999Go). A similar coatomer-dependent transport pathway was shown to be functional for at least some ER-resident type I transmembrane proteins carrying a double lysine sequence near their cytoplasmically exposed C-terminus, whereas an arginine motif located near the cytoplasmic N-terminus serves as targeting signal for some type II membrane proteins (Cosson and Letourneur, 1994Go, 1997; Schutze et al., 1994Go). Evidence is accumulating that in addition to retrieval, ER residency can also be accomplished by direct retention involving association of protein subunits to give large oligomeric complexes via their transmembrane and/or luminal domains, as previously described in the kin-recognition model for Golgi-located membrane proteins (Nilsson et al., 1994Go; Opat et al., 2000Go). These large protein assemblies are assumed to escape packaging into transport vesicles, thus preventing their export from the organelle. This type of mechanism may be functional in the ER retention of subunit components of the membrane-associated translocation pore and/or the hetero-oligomeric oligosaccharyltransferase complex (Fu and Kreibich, 2000Go; Hardt et al., 2001Go).

Oligosaccharide maturation begins in the ER through successive removal of the distal {alpha}1,2- and the two inner {alpha}1,3-linked glucoses from the asparagine-linked Glc3-Man9-GlcNAc2 precursor, processes catalyzed by glucosidase I and glucosidase II, respectively (Herscovics, 1999Go). Whereas glucosidase I is a type II transmembrane N-glycoprotein, glucosidase II is a heterodimeric protein complex composed of a large catalytic {alpha}-subunit and a small ß-subunit, both lacking typical transmembrane domains (Kalz-Füller et al., 1995Go; Trombetta et al., 1996Go). The ß-subunit, although not directly involved in catalysis, was shown to be required for expression of catalytic activity as well as for retaining the dimeric enzyme complex in the ER lumen by means of a C-terminal KDEL-sequence (Treml et al., 2000Go).

Specific signal sequences conferring ER residency on glucosidase I have not been characterized. Based on the observation that the N-terminal cytosolic peptide domain of glucosidase I contains a surprisingly high number of arginines, we have studied their possible involvement and significance in ER targeting by mutational analysis and by preparing protein chimeras containing distinct domains of ER-resident glucosidase I and Golgi-located Man9-mannosidase. Our results point to the triple-arginine sequence located at position 7, 8, and 9 of the glucosidase I cytosolic N-terminus, defining a signal motif capable of conferring ER residency on type II membrane proteins. Several lines of evidence indicate, however, that glucosidase I is retained in the ER, involving structural information residing in the luminal domain of the enzyme rather than the (Arg)3 motif in its cytosolic domain.


    Results and discussion
 Top
 Abstract
 Introduction
 Results and discussion
 Conclusions
 Materials and methods
 References
 
The triple-arginine sequence in the cytosolic domain of glucosidase I contains ER localization information
Human hippocampal glucosidase I is an ER-resident type II membrane protein, consisting of a short cytosolic peptide tail, an ~21-residue transmembrane domain and a large ~85-kDa catalytic domain directed toward the lumen (Kalz-Füller et al., 1995Go). The 38-amino-acid cytosolic peptide domain of the enzyme is very polar and, in addition to 4 acidic amino acids, contains 12 arginines, including a tetra-arginine block at position 6–9 relative to the N-terminus (Figure 1). To analyze whether these arginines encode ER trafficking information, and if so which are involved, we constructed a protein chimera (GIM9) consisting of the N-terminal and transmembrane domain of glucosidase I and the luminal domain of human kidney Man9-mannosidase, previously shown to be Golgi-located (Bieberich and Bause, 1995Go). The Man9-mannosidase luminal domain was selected as the reporter structure because this domain (1) lacks ER-specific targeting information (unpublished data) and (2) contains an N-linked oligosaccharide chain whose extent of processing was expected to indicate access and transport of protein chimeras to distinct subcellular compartments. Specific arginine residues in the N-terminal region of the cytosolic domain of GIM9 were then either removed by truncation ({Delta}M-GIM9) or replaced stepwise by leucine, lysine, and histidine using site-directed mutagenesis, followed by analysis of the GIM9 mutants after overexpression in COS 1 cells by immunoblotting and measuring their catalytic activity as well as by determining their subcellular location using indirect immunofluorescence microscopy (Figures 1 and 2).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Schematic diagram showing the domain structure of glucosidase I, Man9-mannosidase, and experimental chimeras. The regions shown in white represent wild-type glucosidase I (WT-GI), those in gray Man9-mannosidase (WT-M9). The amino acid sequence of the two enzymes are indicated, with residues 38–59 and 11–35 representing the transmembrane domain of WT-GI and WT-M9, respectively. The amino acid sequence of the cytosolic peptide tail of glucosidase I (residues 1–38) is given in full, with those arginines that have been replaced by other amino acids shown in bold. A black star denotes the internal KpnI site in the glucosidase I cDNA; an open star indicates the KpnI site introduced in the Man9-mannosidase cDNA by site-directed mutagenesis.

 


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. Subcellular localization and catalytic acitivity of GIM9 mutants. Position and nature of amino acid substitutions introduced in the glucosidase I-derived peptide domain of GIM9 are shown as white on black. Plus sign indicates that the {alpha}1,2-mannosidase activity of the overexpressed GIM9 mutants was within ±20% of the wild-type Man9-mannosidase value based on the same amount of cell protein.

 
Consistent with previous results (Kalz-Füller et al., 1995Go), transfection of COS 1 cells with the cDNA encoding for wild-type glucosidase I gave rise to overexpression of a catalytically active ~95-kDa protein, recognized specifically by a polyclonal antibody against glucosidase I (Figure 3A, lane 1 and Figure 4A). Man9-mannosidase, on the other hand, was expressed as a catalytically active enzyme consisting of two distinct protein species having molecular masses of ~66 and ~63 kDa (Figure 3B, lane 2) (Bieberich and Bause, 1995Go). A typical time dependency of [14C]Man9-GlcNAc2 hydrolysis, obtained by incubating detergent-extracts from COS 1 cell overexpressing the wild-type enzyme, is shown in Figure 4B. The anti-Man9-mannosidase antibody also stained two protein bands in detergent extracts from COS 1 cells transfected with either GIM9- or {Delta}M-GIM9-specific cDNA (Figure 3B, lane 3 and lane 4). The molecular mass of the GIM9 and {Delta}M-GIM9 protein doublets differed slightly due to their different N-termini (Figure 1).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 3. Immunoblot analysis of glucosidase I, Man9-mannosidase, and chimeric proteins. Transfected COS 1 cells were solubilized with 1% Triton X-100 and aliquots of detergent extracts analysed by SDS–PAGE, followed by immunoblotting using a polyclonal antibody raised against glucosidase I (A) or Man9-mannosidase (B). (A) Lane 1, cells transfected with pSV.SPORT1 (control); lane 2, wild-type glucosidase I; lane 3, GI-L6; lane 4, GI-L9; lane 5, {Delta}M-GI; lane 6, M9GI. (B) Lane 1, control; lane 2, wild-type Man9-mannosidase; lane 3, GIM9; lane 4, {Delta}M-GIM9.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Catalytic activity residing in the luminal domain of glucosidase I and Man9-mannosidase is not affected by exchange of their cytosolic and membrane domains. Glucosidase I (A) and Man9-mannosidase (B) activity were measured by incubating aliquots of transfected COS 1 cells containing the same amount of cell protein in the presence of [14C]Glc3-Man9-GlcNAc2 and [14C]Man9-GlcNAc2, respectively. At given times, substrate hydrolysis was determined by paper chromatography as described in Materials and methods. (A) Open circles, cells transfected with pSV.SPORT1 (control); closed circles, wild-type glucosidase I; triangles, M9GI hybrid. (B) Open circles, control; closed circles, wild-type Man9-mannosidase; triangles, GIM9 hybrid.

 
The reason for the occurrence of two protein species, which were generally seen when Man9-mannosidase, GIM9 or {Delta}M-GIM9 were overexpressed in COS 1 cells, is unknown. Because both protein bands were Endo H susceptible, it appears unlikely that they differ simply in their N-glycosylation status (data not shown). Analysis of detergent-permeabilized cells transfected with the glucosidase I cDNA revealed an intensive fluorescence labelling of perinuclear and tubular structures typical for the ER (Figure 5A), whereas a Golgi-specific staining was seen for wild-type Man9-mannosidase (Figure 5C). No staining of cell surface structures was detectable with nonpermeabilized cells (Figure 5B and D). All images shown are representative of the cell populations examined (total number of cells 50–70). As in wild-type glucosidase I, the GIM9 hybrid was overexpressed exclusively as an ER-resident protein with nonpermeabilized cells remaining unstained (Figure 5E and F). On the other hand, in case of {Delta}M-GIM9, which lacked the amino acid residues 2–11 at the N-terminus, nonpermeabilized cells showed an intense cell surface fluorescence (Figure 5H). In addition to cell surface fluorescence, ER- and/or Golgi-specific staining was seen in general when cells were detergent-permeabilized; this is probably due to considerable overexpression (Figure 5G).



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 5. The (Arg)3 motif in the N-terminal decapeptide sequence of the glucosidase I cytosolic domain contains ER localization information. COS 1 cells overexpressing glucosidase I (A, B), Man9-mannosidase (C, D), GIM9 (E, F), or {Delta}M-GIM9 (G, H) were fixed with formaldehyde (B, D, F, and H) or fixed and then permeabilized with Triton X-100 (A, C, E, and F). Immunofluorescence labeling was carried out by using a polyclonal rabbit antibody raised against glucosidase I (A, B) or Man9-mannosidase (C, D, E, F, G, and H), followed by detection of the antigen-antibody complex with a goat anti-rabbit-IgG-antibody tagged with DTAF.

 
Retention of GIM9 in the ER and transport of {Delta}M-GIM9 to the plasma membrane is best explained by assuming that ER-specific localization information is contained within the N-terminal decapeptide sequence of GIM9 but not in the residual C-terminal portion (amino acid 11–38) of the cytosolic peptide tail and/or in the transmembrane domain, both originating from glucosidase I. Overexpressed GIM9 and {Delta}M-GIM9 displayed {alpha}1,2-mannosidase activity similar to that of wild-type Man9-mannosidase, as shown by the time course of [14C]Man9-GlcNAc2 degradation measured with detergent extracts of COS 1 cells overexpressing GIM9 (Figure 4B). Thus the presence of the glucosidase I cytosolic and transmembrane domain in GIM9 does not interfere with or prevent folding of the Man9-mannosidase luminal domain into its catalytically active conformation, excluding the explanation that retention of GIM9 in the ER is caused by misfolding.

To investigate further the ER-targeting information contained in the N-terminal decapeptide sequence, we prepared a number of GIM9 mutants by replacing individual arginine residues by leucine, lysine, or histidine (Figure 2). All GIM9 mutants were overexpressed in COS 1 cells as catalytically active proteins with molecular masses identical with that of GIM9, confirming their correct structure. Immunofluorescence analysis of permeabilized and nonpermeabilized cells transfected with the corresponding cDNAs revealed that substitution of either Arg-3 (GIM9-L3) or Arg-6 (GIM9-L6) against leucine resulted in fluorescence staining typical of the ER (Figure 6A–D). An essentially identical staining pattern was obtained when both Arg-3 and Arg-6 in GIM9 were replaced by leucine, indicating that these two arginine residues do not contain ER-specific targeting information (data not shown). An intense immunofluorescence of cell surface structures was detected, on the other hand, when either Arg-7, Arg-8, or Arg-9 in GIM9 were replaced by leucine, as shown for the GIM9-L7 and GIM9-L9 mutants in Figure 6F and H. These observations indicate that unlike Arg-3 and Arg-6, the three arginine residues located at position 7–9 relative to the N-terminus are likely to encode for structural information responsible for ER residency of GIM9. The ER-directing signal function in GIM9 was lost when Arg-7 or Arg-8 but not Arg-9 in GIM9 were replaced with lysine (Figure 7A–D).



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 6. The arginine residues located at position 7–9 confer ER residency on GIM9. COS 1 cells were transfected with the cDNA encoding for the GIM9 mutants in which distinct arginine residues located in the glucosidase I-derived N-terminal decapeptide sequence were replaced by leucine (for structures, see Figures 1 and 2). Immunofluorescence staining was carried out using an anti-Man9-mannosidase antibody for detection.

 


View larger version (96K):
[in this window]
[in a new window]
 
Fig. 7. Replacement of GIM9 Arg-7 and Arg-8 but not Arg-9 by either lysine or histidine causes destruction of ER targeting information. COS 1 cells overexpressing GIM9 containing either lysine or histidine substitutions in different positions of the triple-arginine motif (for structures, see Figure 2) were processed as described in Figure 5 using an anti-Man9-mannosidase antibody for staining.

 
Identical effects on subcellular localization were also seen after substitution of these particular arginines by histidine, as shown for GIM9-H7 and GIM9-H9 in Figure 7E–H. We conclude from these observations that not only the presence of a positive charge but also the particular amino acid side chain are critical determinants for signal recognition, with some structural variations apparently being tolerated at the Arg-9 position so long as the side chain of the amino acid in this position can acquire a positive charge. The various GIM9 mutants displayed normal {alpha}1,2-mannosidase activity, indicating that the observed differences in subcellular localization do not result from polypeptide misfolding.

Does (Arg)3 act as a retrieval signal?
COS 1 cells transfected with cDNA encoding for ER-glucosidase I, Golgi-Man9-mannosidase, the ER-resident GIM9 hybrid or the surface expressed GIM9-L9 mutant, were cultured for 48 h in the presence of [3H]mannose. Overexpressed [3H]labeled enzyme proteins were isolated by immunoprecipitation using either a polyclonal antibody against glucosidase I or against Man9-mannosidase, followed by treatment with Glyco F and separation of the released [3H]glycans using high-performance liquid chromatography (HPLC). The results of these experiments are summarized in Figure 8. As can be seen, the [3H]glycan fraction from the Golgi-located Man9-mannosidase consists of a pattern of high mannose intermediates ranging in size from Man5-GlcNAc2 to Glc2-Man9-GlcNAc2 with Man5-GlcNAc2 and Man9-GlcNAc2 being the predominant species (Figure 8A). A comparable spectrum of [3H]oligosaccharides was found to be released from the ER-resident GI-M9 hybrid (Figure 8B), as well as from the GIM9-L9 mutant expressed as a cell surface protein (Figure 8C). On the other hand, the glucosidase I-specific [3H]glycan composition differed substantially from these three fractions containing Man9-GlcNAc2 as the major intermediate, with less than 15% of Man8-GlcNAc2 and Man5-GlcNAc2 at the limit of detectability (Figure 8D). There are two possibilities for explaining these differences.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 8. Structural analysis of N-linked glycan chains. COS 1 cells were transfected with the cDNA encoding for wild-type Man9-mannosidase (A), GIM9 (B), GIM9-L9 (C), or wild-type glucosidase I (D) and cultured in the presence of [2-3H]mannose. After 48 h cells were harvested and solubilized in phosphate buffered saline containing 1% Triton X-100, and the overexpressed glycoproteins were isolated by immunoprecipitation using a polyclonal antibody against Man9-mannosidase (A, B, and C), or against glucosidase I (D). The [2-3H]oligosaccharide fraction released by Glyco F treatment from the radiolabeled glycoproteins was separated by HPLC. The relative ratio of [2-3H]intermediates was normalized based on the total radioactivity (100% relative) applied to the column. M5–M9 indicate Man5–9-GlcNAc2; G1, G2, and G3 represent M9 containing one, two, or three glucose residues. Alignment of glycan intermediates is based on their elution positions relative to [14C]-labeled M5, M9, and G3, added as internal standards; X, nonidentified compound.

 
First, degradation of Man9-GlcNAc2 to Man5 and Man6 intermediates involving distinct Golgi-{alpha}1,2-mannosidases. This would mean that, in contrast to glucosidase I, GIM9 (ER-resident) as well as the GIM9-L9 mutant and wild-type Man9-mannosidase must all have had access to the corresponding post-ER compartment. This would imply that the triple-arginine motif is able to direct ER-localization of GIM9 and type II transmembrane proteins, respectively, by a Golgi-to-ER retrograde transport mechanism in an analogous way to the double-lysine motif in the cytosolic domain of type I membrane proteins (Cosson and Letourneur, 1994Go, 1997Go; Hardt et al., 2001Go).

Second, the GIM9-linked Man9-GlcNAc2 structure is degraded to Man6 and/or Man5 involving "self-processing" by the catalytically active GIM9 hybrid in combination with ER-located mannosidase(s) that are known to process Man9-GlcNAc2 giving different Man8-isomers (Bause et al., 1992Go; Herscovics, 1999Go). In this case GIM9, which is retained in the ER by the (Arg)3 motif, would not have to leave this compartment.

Although our current data do not allow us to distinguish clearly between these possibilities, we favor the first explanation, namely, that (Arg)3 may function as a retrieval rather than as a retention signal for the following reason. Compared with that of wild-type Man9-mannosidase (Golgi-located) for which the ratio {sum}(Man5-Man7)/ {sum}(Man8-Man9)<1, the ratio for both GIM9 (ER-resident) and GIM9-L9 (cell surface–located) is considerably greater than 1 (Figure 8). It does not appear likely, a priori, that modification of GIM9 glycans by "self-processing" in the ER would be more extensive than for the Golgi-resident wild-type Man9-mannosidase. The differences in the extent of oligosaccharide processing may be explained by assuming that transport and/or access to post-ER compartments follow different routes depending on whether the membrane protein is Golgi-resident (as the wild-type enzyme) or subject to Golgi-to-ER retrograde transport, as postulated for GIM9. The accumulation of Man9-GlcNAc2 indicates that glucosidase I does not leave the ER, pointing to the triple-arginine motif 's not playing an essential role in ER targeting of the wild-type enzyme (see later discussion).

The N-terminal arginine motif is not the key determinant for ER retention of glucosidase I
Based on the observation that replacement of Arg-7, Arg-8, or Arg-9 by leucine resulted in disruption of ER-directing information in case of the GIM9 construct, these mutations were introduced into the sequence of wild-type glucosidase I (GI-L7, GI-L8, and GI-L9) to evaluate the significance of the triple-arginine retrieval signal in ER targeting of the wild-type enzyme. In addition, a glucosidase I deletion mutant ({Delta}M-GI) was synthesized lacking the amino acid residues 2–11 at the N-terminus, which included the triple-arginine sequence (Figure 1).

As expected, the molecular mass of the glucosidase I mutants overexpressed in COS 1 cells was identical with that of the wild-type enzyme (Figure 3A, lanes 3 and 4); a slightly smaller molecular size was observed for {Delta}M-GI, associated with the lack of the N-terminal decapeptide (Figure 3A, lane 5). In contrast to the {Delta}M-GIM9 and GIM9-L9 protein hybrids, which were detected at the cell surface (Figures 5H and 6H), both {Delta}M-GI and GI-L9 were expressed as ER-resident proteins (Figure 9A and C) with essentially no fluorescence labeling being detectable at the plasma membrane of nonpermeabilized cells (Figure 9B and D). Similar results were obtained with GI mutants containing leucine in either the Arg-7 or Arg-8 position (data not shown). Overexpressed GI-L9 and {Delta}M-GI degraded [14C]Glc3-Man9-GlcNAc2 with time kinetics comparable to that of the wild-type enzyme, excluding the explanation that the adoption of the catalytically active peptide conformation is affected severely by the amino acid exchanges in the cytosolic domain of glucosidase I and by truncation of the N-terminal decapeptide. These observations, together with the finding that Man9-GlcNAc2 was the major processing intermediate released from the wild-type enzyme by Glyco F (Figure 8D), support the view that (1) ER residency of glucosidase I occurs most likely by retention and (2) the essential structural information for ER targeting is contained in domains of the glucosidase I polypeptide other than the cytosolic peptide tail including the (Arg)3 sequence.



View larger version (116K):
[in this window]
[in a new window]
 
Fig. 9. Retention of glucosidase I in the ER is determined by structural motifs in the luminal domain rather than by the cytosolic (Arg)3 sequence motif. COS 1 cells overexpressing GI-L9, {Delta}M-GI, or M9GI (for structures, see Figure 1) were processed as described in Figure 5. Immunofluorescence staining of permeabilized and nonpermeabilized cells was carried out with a polyclonal anti–glucosidase I-antibody followed by treatment with a DTAF-conjugated second antibody.

 
To decide whether the glucosidase I transmembrane domain contributes to ER localization as previously suggested (Tang et al., 1997Go), we have constructed a protein hybrid (M9GI) in which the N-terminal and transmembrane domain of glucosidase I were replaced by corresponding domains of Man9-mannosidase (Figure 1). Transfection of COS 1 cells with M9GI-specific cDNA resulted in overexpression of an ~78 kDa protein (Figure 3A, lane 6) which displayed normal glucosidase I activity (Figure 4A). Analysis of detergent-permeabilized cells overexpressing M9GI revealed ER-specific fluorescence staining, whereas nonpermeabilized cells remained unstained (Figure 9E and F). This suggests that the key information determining ER localization must be contained in the luminal polypeptide chain of glucosidase I rather than in its cytosolic and transmembrane domain.


    Conclusions
 Top
 Abstract
 Introduction
 Results and discussion
 Conclusions
 Materials and methods
 References
 
By preparing chimeric model proteins and conducting mutational analysis, we have studied structural parameters in the glucosidase I polypeptide chain responsible for directing ER localization. Replacement of distinct arginine residues in the cytosolic peptide tail of a chimeric construct containing the N-terminal and transmembrane of glucosidase I and the luminal domain of the Golgi-located Man9-mannosidase (GIM9) showed that the three arginine residues located in position 7–9 relative to the N-terminus function as a targeting signal conferring ER residency on type II transmembrane proteins, presumably by Golgi-to-ER retrograde transport. The ER localization information was lost after substitution of either Arg-7 or Arg-8 in the triple-arginine motif but not of Arg-9 by lysine and histidine, respectively. This indicates that Arg-7 and Arg-8 are invariant residues and that, in addition to positive charge, the side chain structure is also essential for signal functionality.

A similar but reversed situation has been described for the cytosolically exposed double-lysine motif in ER-resident type I transmembrane proteins, whose retrieval information was lost when both lysines were replaced by arginines but not by histidines (Hardt and Bause, 2002Go). Assuming that ER targeting occurs by means of a retrieval mechanism, a plausible explanation for these differential effects is that the arginine motif in type II proteins and the double-lysine/double-histidine motif in type I proteins are recognized by and bound to different receptor proteins in the coatomer complex. This could mean that distinct populations of COPI-coated vesicles are involved in Golgi-to-ER retrograde transport and that formation of specific transport vesicles may depend on the nature of the signal amino acids, as well as on the membrane topology of the protein concerned.

In apparent contrast to the data obtained for GIM9, ER residency of wild-type glucosidase I was neither affected by destruction nor by truncation of the cytosolic triple-arginine signal. This indicates that the (Arg)3 signal is unlikely to be functionally relevant for ER targeting of the wild-type enzyme and that additional localization information must be contained in the glucosidase I polypeptide. Results obtained with the various hybrid proteins support the view that ER localization of glucosidase I occurs by direct retention and that ER residency is mediated by structural determinants residing in the luminal domain rather than in the cytosolic and transmembrane domain. (1) The GIM9 chimera containing the cytosolic and transmembrane domain of glucosidase I is expressed as a cell surface protein when the arginine motif in the cytosolic peptide is either destroyed by mutation or completely removed, making a critical contribution to and involvement of the glucosidase I cytosolic and transmembrane in ER targeting unlikely. (2) ER residency was maintained after replacement of the cytosolic and transmembrane domain of glucosidase I by the corresponding domains of Man9-mannosidase (M9GI), in line with this interpretation. Although the Man9-mannosidase transmembrane domain itself lacks ER targeting information (unpublished data), it cannot be excluded that both the transmembrane and luminal domain of glucosidase I are essential, acting in a concerted manner, and that the mannosidase transmembrane domain simply mimics the function of the glucosidase I transmembrane domain; this is, however, unlikely. (3) ER localization caused by retention rather than by retrieval is consistent with Man9-GlcNAc2 being the major glycan structure released by Glyco F. The occurrence of this processing intermediate is best explained by assuming that glucosidase I fails to leave the ER, in contrast to GIM9-L9, wild-type Man9-mannosidase, and presumably G1M9, whose N-linked glycan chains are processed down to the Man5-GlcNAc2-stage. The apparent lack of dominant signal information contributed by the transmembrane domain contradicts previous observations that the plasma membrane located dipeptidylpeptidase IV becomes ER resident after replacing its transmembrane domain by that of glucosidase I (Tang et al., 1997Go). The reason for this apparent discrepancy is not known.

The nature of the amino acids and/or peptide regions in the luminal domain of glucosidase I, as well as the specific mechanism by which the enzyme is retained in the ER, remain to be established. A possible mechanism could be that according to the kin-recognition model as previously proposed for Golgi-resident membrane proteins (Nilsson et al., 1994Go; Opat et al., 2000Go), glucosidase I subunits interact via their luminal domains, giving rise to the formation of large homo- or hetero-oligomeric protein assemblies. Due to their size, these protein complexes may not be able to enter or to be packaged into transport vesicles; this would prevent their export from the ER. Some evidence supporting this view is provided by the observation that glucosidase I purified from pig liver microsomes was found to elute from a Sephacryl S-300 column as a catalytically active protein complex consisting of at least four to six subunits (Hettkamp et al., 1984Go) and that even larger oligomers seem to be formed when detergent extracts of microsomes were subjected to gel chromatography. Assuming that ER retention of glucosidase I occurs by this kin-recognition type mechanism, the function of the triple-arginine motif could be to recapture and retransport those subunits from pre-Golgi compartments that have escaped from the ER before being integrated into the multimeric protein assemblies.


    Materials and methods
 Top
 Abstract
 Introduction
 Results and discussion
 Conclusions
 Materials and methods
 References
 
Materials
Materials and chemicals were obtained from the following sources: DEAE dextran and [2-3H]mannose, specific activiy 26 Ci/mmol (Amersham Biosciences, Freiburg); synthetic oligonucleotides, Taq polymerase, Dulbecco's Modified Eagle Medium and pSV.SPORT1 (Invitrogen, Karlsruhe); restriction endonucleases (MBI Fermentas, St. Leon-Rot); ABI PRISM Big dye terminator cycle sequencing kit (Applied Biosystems, Darmstadt); COS 1 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig); goat anti-rabbit IgG alkaline phosphatase conjugate and Triton X-100 (Sigma; St. Louis, MO); fluorescein (DTAF)-conjugated AffiniPure goat anti-rabbit IgG (Dianova, Hamburg); Nucleosil-NH2 (Machery-Nagel, Düren); nitrocellulose membranes (Schleicher & Schuell, Dassel).

Vector construction and preparation of protein mutants
The glucosidase I- and Man9-mannosidase-specific cDNAs were subcloned into the mammalian expression vector pSV.SPORT1 as previously described (Kalz-Füller et al., 1995Go; Bieberich and Bause, 1995Go). The GIM9- and M9GI-specific vector plamids were prepared by mutual exchange of the cDNA sequences for the cytosolic and transmembrane domain, taking advantage of an internal KpnI restriction site located downstream from the glucosidase I transmembrane domain, as well as of an artificial KpnI site introduced by site-directed mutagenesis on the 3'-site of the membrane domain of Man9-mannosidase using the oligonucleotide tccaagctgctcagcgggtacctgttccactccagcccc as primer.

Truncation of the N-terminal decapeptide ({Delta}M-GIM9; {Delta}M-GI) and replacement of specific arginine residues in the cytosolic domain of glucosidase I and GIM9 by leucine, lysine, or histidine were carried out using in vitro oligonucleotide directed mutagenesis with glucosidase I cDNA as template and the sense/antisense primers summarized in Table I (Ausubel et al., 1987Go). Note that the GI-as primer is located downstream from the internal KpnI site in the glucosidase I cDNA. The corresponding cDNA fragments obtained by polymerase chain reaction (PCR) amplification were digested with KpnI, followed by their ligation into KpnI sites generated by restriction cleavage of the glucosidase I- or Man9-mannosidase-specific plasmids. The structures of hybrid and mutant proteins were confirmed by DNA sequencing.


View this table:
[in this window]
[in a new window]
 
Table I. Oligonucleotides used for generation of glucosidase I and GIM9 mutants

 
Cell culture and transfection
COS 1 cells were grown at 37°C and 5% CO2 as monolayer cultures in Dulbecco's modified Eagle medium containing 10% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin. After having reached ~60% confluency, the cells were transfected with the various vector plasmids using the DEAE-dextran/chloroquine method (Sambrook et al., 1989Go).

Metabolic labeling and immunoprecipitation
COS 1 cells were transfected with the vector constructs encoding for either glucosidase I, Man9-mannosidase, GIM9, or GIM9-L9, followed by culturing in the presence of 1 mCi [2-3H]mannose (specific activity 26 Ci/mmol). Forty-eight hours after transfection, the cells were harvested and washed with phosphate buffered saline to remove excess of [2-3H]mannose. Solubilization of the resulting cell pellets and isolation of overexpressed [2-3H]labeled glycoproteins by immunoprecipitation using a polyclonal antibody against glucosidase I and Man9-mannosidase, have been described previously (Hardt et al., 2001Go). After treatment of the [2-3H]glycoprotein fractions with Glyco F, the released radiolabeled oligosaccharides were separated from the incubation mixture by Wessel–Flügge extraction (Wessel and Flügge, 1984Go) and analyzed by HPLC on a Nucleosil-NH2 column (Schweden et al., 1986Go; Bause et al., 1992Go).

Determination of glucosidase I and Man9-mannosidase activity
Transfected COS 1 cells were cultured on 100-mm dishes and, after 48 h, isolated by centrifugation. The cell pellets were resuspended in 300 µl of either 50 mM phosphate buffer, pH 6.5, containing 1% Triton X-100 (glucosidase I assay) or 50 mM phosphate buffer, pH 6.0, containing 1% Triton X-100 and 1 mM CaCl2 (Man9-mannosidase assay). Aliquots of the detergent extracts (30–50 µl) containing equal amounts of cell protein were incubated in the presence of 500 cpm of either [14C]Glc3-Man9-GlcNAc2 or [14C]Man9-GlcNAc2 as enzyme-specific substrates. After given times, reactions were terminated by the addition of 30–50 µl acetic acid, followed by analysis of substrate cleavage as release of [14C]glucose and [14C]mannose, respectively, using paper chromatography as described previously (Hettkamp et al., 1984Go; Schweden and Bause, 1989Go).

Immunofluorescence microscopy
Transfected cells were transferred onto sterile coverslips and, after 24 h, either fixed with 8% formaldehyde or fixed and then permeabilized with 0.2% Triton X-100 in 200 mM HEPES, pH 7.2. The cells were incubated in a 1:10 dilution of an affinity-purified anti–glucosidase I or anti–Man9-mannosidase antibody, and the antigen/antibody complexes were visualized by using a 1:100 dilution of a DTAF-conjugated goat anti-rabbit IgG antibody (Kalz-Füller et al., 1985; Bieberich and Bause, 1995Go).

General methods
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis and immunoblotting was carried out as described previously (Laemmli, 1970Go; Blake et al., 1984Go; Knecht and Dimond, 1984Go). PCR, vector construction, site-directed mutagenesis, and other cloning procedures were performed as detailed elsewhere (Ausubel et al., 1987Go; Sambrook et al., 1989Go; White, 1993Go). Glyco F cleavage and synthesis of [14C]Glc3-Man9-GlcNAc2 and [14C]Man9-GlcNAc2 have been detailed in other articles (Hettkamp et al., 1984Go; Schweden et al., 1986Go; Schweden and Bause, 1989Go). Preparation and purification of polyclonal antibodies against glucosidase I and Man9-mannosidase have been described (Schweden and Bause, 1989Go; Bause et al., 1989Go).


    Acknowledgements
 
This work was supported by the Deutsche Forschungsgemeinschaft (Sonderforschungsbereich 284). The authors are indebted to R.A. Klein (University Bonn) for critical reading of the manuscript.

1 To whom correspondence should be addressed; e-mail:bause{at}institut.physiochem.uni-bonn.de Back


    Abbreviations
 
ER, endoplasmic reticulum; HPLC, high-performance liquid chromatography; PCR, polymerase chain reaction.


    References
 Top
 Abstract
 Introduction
 Results and discussion
 Conclusions
 Materials and methods
 References
 
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (1987) Current protocols in molecular biology. John Wiley and Sons, New York.

Bause, E., Breuer, W., Schweden, J., Roeser, R., and Geyer, R. (1992) Effect of substrate structure on the activity of Man9-mannosidase from pig liver involved in N-linked oligosaccharide processing. Eur. J. Biochem., 208, 451–457.[Web of Science][Medline]

Bause, E., Schweden, J., Gross, A., and Orthen, B. (1989) Purification and characterization of glucosidase I from pig liver. Eur. J. Biochem., 183, 661–669.[Web of Science][Medline]

Bieberich, E. and Bause, E. (1995) Man9-mannosidase from human kidney is expressed in COS cells as a Golgi resident type II transmembrane N-glycoprotein. Eur. J. Biochem., 233, 644–649.[Web of Science][Medline]

Blake, M.S., Johnson, K.H., Russel-Jones, G.J., and Gotschlich, E.C. (1984) A rapid, sensitive method for detection of alkaline phosphatase-conjugated anti-antibody on western blots. Anal. Biochem., 136, 175–179.[CrossRef][Web of Science][Medline]

Cosson, P. and Letourneur, F. (1994) Coatomer interaction with di-lysine endoplasmic reticulum retention motifs. Science, 263, 1629–1631.[Abstract/Free Full Text]

Cosson, P. and Letourneur, F. (1997) Coatomer (COPI)-coated vesicles: role in intracellular transport and protein sorting. Curr. Opin. Cell Biol., 9, 484–487.[CrossRef][Web of Science][Medline]

Fu, J. and Kreibich, G. (2000) Retention of subunits of the oligosaccharyltransferase complex in the endoplasmic reticulum. J. Biol. Chem., 275, 3984–3990.[Abstract/Free Full Text]

Hardt, B., Aparicio, R., Breuer, W., and Bause, E. (2001) Analysis of structural signals conferring localisation of pig OST48 to the endoplasmic reticulum. Biol. Chem., 382, 1039–1047.[CrossRef][Web of Science][Medline]

Hardt, B. and Bause, E. (2002) Lysine can be replaced by histidine but not by arginine as the ER retrieval motif for type I membrane proteins. Biochem. Biophys. Res. Commun., 291, 751–757.[CrossRef][Web of Science][Medline]

Herscovics, A. (1999) Importance of glycosidases in mammalian glycoprotein biosynthesis. Biochim. Biophys. Acta, 1473, 96–107.[Medline]

Hettkamp, H., Legler, G., and Bause, E. (1984) Purification by affinity chromatography of glucosidase I, an endoplasmic reticulum hydrolase involved in the processing of asparagine-linked oligosaccharides. Eur. J. Biochem., 142, 85–90.[Web of Science][Medline]

Kalz-Füller, B., Bieberich, E., and Bause, E. (1995) Cloning and expression of glucosidase I from human hippocampus. Eur. J. Biochem., 231, 344–351.[Web of Science][Medline]

Knecht, D.A. and Dimond, R.L. (1984) Visualization of antigenic proteins on western blots. Anal. Biochem., 136, 180–184.[CrossRef][Web of Science][Medline]

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head bacteriophage T4. Nature, 227, 680–685.[CrossRef][Medline]

Lewis, M.J. and Pelham, H.R. (1992) Ligand-induced redistribution of a human KDEL receptor from the Golgi complex to the endoplasmic reticulum. Cell, 68, 353–364.[CrossRef][Web of Science][Medline]

Nilsson, T., Hoe, M.H., Slusarewicz, P., Rabouille, C., Watson, R., Hunte, F., Watzele, G., Berger, E.G., and Warren, G. (1994) Kin recognition between medial Golgi enzymes in HeLa cells. EMBO J., 13, 562–574.[Web of Science][Medline]

Opat, A.S., Houghton, F., and Gleeson, P.A. (2000) Medial Golgi but not late Golgi glycosyltransferases exist as high molecular weight complexes. Role of luminal domain in complex formation and localization. J. Biol. Chem., 275, 11836–11845.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E.F., and Maniatis T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York.

Schutze, M.-P., Peterson, P.A., and Jackson, M.R. (1994) An N-terminal double-arginine motif maintains type II membrane proteins in the endoplasmic reticulum. EMBO J., 13, 1696–1705.[Web of Science][Medline]

Schweden, J., and Bause, E. (1989) Characterization of trimming Man9-mannosidase from pig liver: purification of a catalytically active fragment and evidence for the transmembrane nature of the intact 65 kDa enzyme. Biochem. J., 264, 347–355.[Web of Science][Medline]

Schweden, J., Legler, G., and Bause, E. (1986) Purification and characterization of a neutral processing mannosidase from calf liver acting on (Man)9(GlcNAc)2 oligosaccharides. Eur. J. Biochem., 157, 563–570.[Web of Science][Medline]

Tang, B.L., Low, S.H., and Hong, W. (1997) Endoplasmic reticulum retention mediated by the transmembrane domain of type II membrane proteins Sec12p and glucosidase I. Eur. J. Cell Biol., 73, 98–104.[Web of Science][Medline]

Teasdale, R.D. and Jackson M.R. (1996) Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the Golgi apparatus. Annu. Rev. Cell. Dev. Biol., 12, 27–54.[CrossRef][Web of Science][Medline]

Treml, K., Meimaroglou, D., Hentges, A., and Bause, E. (2000) The {alpha}- and ß-subunits are required for expression of catalytic activity in the hetero-dimeric glucosidase II complex from human liver. Glycobiology, 10, 493–502.[Abstract/Free Full Text]

Trombetta, S.E., Simons, J.F., and Helenius, A. (1996) Endoplasmic reticulum glucosidase II is composed of a catalytic subunit, conserved from yeast to mammals, and a tightly bound noncatalytic HDEL-containing subunit. J. Biol. Chem., 271, 27509–27516.[Abstract/Free Full Text]

Wessel, D. and Flügge, U.I. (1984) A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem., 138, 141–143.[CrossRef][Web of Science][Medline]

White, B.A. (1993) PCR-protocols—current methods and applications. Human Press, Ottawa.

Wieland, F. and Harter, C. (1999) Mechanisms of vesicle formation: insights from the COP system. Curr. Opin. Cell Biol., 11, 440–446.[CrossRef][Web of Science][Medline]

Yamamoto, K., Fujii, R., Toyofuka, Y., Saito, T., Koseki, H., Hsu, V.W., and Aoe, T. (2001) The KDEL receptor mediates a retrieval mechanism that contributes to quality control at the endoplasmic reticulum. EMBO J., 20, 3082–3091.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant CellHome page
C. Saint-Jore-Dupas, A. Nebenfuhr, A. Boulaflous, M.-L. Follet-Gueye, C. Plasson, C. Hawes, A. Driouich, L. Faye, and V. Gomord
Plant N-Glycan Processing Enzymes Employ Different Targeting Mechanisms for Their Spatial Arrangement along the Secretory Pathway
PLANT CELL, November 1, 2006; 18(11): 3182 - 3200.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Heine, B. Koch, S. Storch, A. Kohlschutter, D. N. Palmer, and T. Braulke
Defective Endoplasmic Reticulum-resident Membrane Protein CLN6 Affects Lysosomal Degradation of Endocytosed Arylsulfatase A
J. Biol. Chem., May 21, 2004; 279(21): 22347 - 22352.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/3/159    most recent
cwg013v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Hardt, B.
Right arrow Articles by Bause, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hardt, B.
Right arrow Articles by Bause, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?