Glycobiology Advance Access originally published online on November 26, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology, 2003, Vol. 13, No. 3 159-168
© 2003 Oxford University Press
(Arg)3 within the N-terminal domain of glucosidase I contains ER targeting information but is not required absolutely for ER localization
Institut Für Physiologische Chemie, Universität Bonn Nussallee 11, 53115 Bonn, Germany
Received on May 17, 2002; revised on September 17, 2002; accepted on September 17, 2002
| Abstract |
|---|
|
|
|---|
Glucosidase I is an endoplasmic reticulum (ER) type II membrane enzyme that cleaves the distal
1,2-glucose of the asparagine-linked GlcNAc2-Man9-Glc3 precursor. To identify sequence motifs responsible for ER localization, we prepared a protein chimera by transferring the cytosolic and transmembrane domain of glucosidase I to the luminal domain of Golgi-Man9-mannosidase. The GIM9 hybrid was overexpressed in COS 1 cells as an ER-resident protein that displayed
1,2-mannosidase activity, excluding the possibility that the glucosidase Ispecific domains interfere with folding of the Man9-mannosidase catalytic domain. After substitution of the Args in position 7, 8, or 9 relative to the N-terminus by leucine, the GIM9 mutants were transported to the cell surface indicating that the (Arg)3 sequence functions as an ER-targeting motif. Cell surface expression was also observed after substitution of Arg-7 or Arg-8 but not Arg-9 in GIM9 by either lysine or histidine. Thus the side chain structure, including its positive charge, appears to be essential for signal function. Analysis of the N-linked glycans suggests that the (Arg)3 sequence mediates ER localization through Golgi-to-ER retrograde transport. Glucosidase I remained localized in the ER after truncation or mutation of the N-terminal (Arg)3 signal, in contrast to comparable GIM9 mutants. ER localization was also observed with an M9GI chimera consisting of the cytosolic and transmembrane domain of Man9-mannosidase and the glucosidase I catalytic domain. ER-specific targeting information must therefore be provided by sequence motifs contained within the glucosidase I luminal domain. This structural information appears to direct ER localization by retention rather than by retrieval, as concluded from N-linked Man9-GlcNAc2 being the major glycan released from the wild-type enzyme. Key words: arginine motif / endoplasmic reticulum / glucosidase I / type II membrane protein
| Introduction |
|---|
|
|
|---|
The endoplasmic reticulum (ER) contains a population of resident proteins that perform a variety of organelle-specific functions, including protein and lipid modification, processing of N-linked glycans, vesicle formation, protein sorting, and transport. Localization of these proteins in the ER is achieved by retention and/or retrieval mechanisms involving defined sequence motifs and targeting domains within the polypeptide chain (Teasdale and Jackson, 1996
Oligosaccharide maturation begins in the ER through successive removal of the distal
1,2- and the two inner
1,3-linked glucoses from the asparagine-linked Glc3-Man9-GlcNAc2 precursor, processes catalyzed by glucosidase I and glucosidase II, respectively (Herscovics, 1999
). Whereas glucosidase I is a type II transmembrane N-glycoprotein, glucosidase II is a heterodimeric protein complex composed of a large catalytic
-subunit and a small ß-subunit, both lacking typical transmembrane domains (Kalz-Füller et al., 1995
; Trombetta et al., 1996
). The ß-subunit, although not directly involved in catalysis, was shown to be required for expression of catalytic activity as well as for retaining the dimeric enzyme complex in the ER lumen by means of a C-terminal KDEL-sequence (Treml et al., 2000
).
Specific signal sequences conferring ER residency on glucosidase I have not been characterized. Based on the observation that the N-terminal cytosolic peptide domain of glucosidase I contains a surprisingly high number of arginines, we have studied their possible involvement and significance in ER targeting by mutational analysis and by preparing protein chimeras containing distinct domains of ER-resident glucosidase I and Golgi-located Man9-mannosidase. Our results point to the triple-arginine sequence located at position 7, 8, and 9 of the glucosidase I cytosolic N-terminus, defining a signal motif capable of conferring ER residency on type II membrane proteins. Several lines of evidence indicate, however, that glucosidase I is retained in the ER, involving structural information residing in the luminal domain of the enzyme rather than the (Arg)3 motif in its cytosolic domain.
| Results and discussion |
|---|
|
|
|---|
The triple-arginine sequence in the cytosolic domain of glucosidase I contains ER localization information
Human hippocampal glucosidase I is an ER-resident type II membrane protein, consisting of a short cytosolic peptide tail, an
21-residue transmembrane domain and a large
85-kDa catalytic domain directed toward the lumen (Kalz-Füller et al., 1995
M-GIM9) or replaced stepwise by leucine, lysine, and histidine using site-directed mutagenesis, followed by analysis of the GIM9 mutants after overexpression in COS 1 cells by immunoblotting and measuring their catalytic activity as well as by determining their subcellular location using indirect immunofluorescence microscopy (Figures 1 and 2).
|
|
Consistent with previous results (Kalz-Füller et al., 1995
95-kDa protein, recognized specifically by a polyclonal antibody against glucosidase I (Figure 3A, lane 1 and Figure 4A). Man9-mannosidase, on the other hand, was expressed as a catalytically active enzyme consisting of two distinct protein species having molecular masses of
66 and
63 kDa (Figure 3B, lane 2) (Bieberich and Bause, 1995
M-GIM9-specific cDNA (Figure 3B, lane 3 and lane 4). The molecular mass of the GIM9 and
M-GIM9 protein doublets differed slightly due to their different N-termini (Figure 1).
|
|
The reason for the occurrence of two protein species, which were generally seen when Man9-mannosidase, GIM9 or
M-GIM9 were overexpressed in COS 1 cells, is unknown. Because both protein bands were Endo H susceptible, it appears unlikely that they differ simply in their N-glycosylation status (data not shown). Analysis of detergent-permeabilized cells transfected with the glucosidase I cDNA revealed an intensive fluorescence labelling of perinuclear and tubular structures typical for the ER (Figure 5A), whereas a Golgi-specific staining was seen for wild-type Man9-mannosidase (Figure 5C). No staining of cell surface structures was detectable with nonpermeabilized cells (Figure 5B and D). All images shown are representative of the cell populations examined (total number of cells 5070). As in wild-type glucosidase I, the GIM9 hybrid was overexpressed exclusively as an ER-resident protein with nonpermeabilized cells remaining unstained (Figure 5E and F). On the other hand, in case of
M-GIM9, which lacked the amino acid residues 211 at the N-terminus, nonpermeabilized cells showed an intense cell surface fluorescence (Figure 5H). In addition to cell surface fluorescence, ER- and/or Golgi-specific staining was seen in general when cells were detergent-permeabilized; this is probably due to considerable overexpression (Figure 5G).
|
Retention of GIM9 in the ER and transport of
M-GIM9 to the plasma membrane is best explained by assuming that ER-specific localization information is contained within the N-terminal decapeptide sequence of GIM9 but not in the residual C-terminal portion (amino acid 1138) of the cytosolic peptide tail and/or in the transmembrane domain, both originating from glucosidase I. Overexpressed GIM9 and
M-GIM9 displayed
1,2-mannosidase activity similar to that of wild-type Man9-mannosidase, as shown by the time course of [14C]Man9-GlcNAc2 degradation measured with detergent extracts of COS 1 cells overexpressing GIM9 (Figure 4B). Thus the presence of the glucosidase I cytosolic and transmembrane domain in GIM9 does not interfere with or prevent folding of the Man9-mannosidase luminal domain into its catalytically active conformation, excluding the explanation that retention of GIM9 in the ER is caused by misfolding. To investigate further the ER-targeting information contained in the N-terminal decapeptide sequence, we prepared a number of GIM9 mutants by replacing individual arginine residues by leucine, lysine, or histidine (Figure 2). All GIM9 mutants were overexpressed in COS 1 cells as catalytically active proteins with molecular masses identical with that of GIM9, confirming their correct structure. Immunofluorescence analysis of permeabilized and nonpermeabilized cells transfected with the corresponding cDNAs revealed that substitution of either Arg-3 (GIM9-L3) or Arg-6 (GIM9-L6) against leucine resulted in fluorescence staining typical of the ER (Figure 6AD). An essentially identical staining pattern was obtained when both Arg-3 and Arg-6 in GIM9 were replaced by leucine, indicating that these two arginine residues do not contain ER-specific targeting information (data not shown). An intense immunofluorescence of cell surface structures was detected, on the other hand, when either Arg-7, Arg-8, or Arg-9 in GIM9 were replaced by leucine, as shown for the GIM9-L7 and GIM9-L9 mutants in Figure 6F and H. These observations indicate that unlike Arg-3 and Arg-6, the three arginine residues located at position 79 relative to the N-terminus are likely to encode for structural information responsible for ER residency of GIM9. The ER-directing signal function in GIM9 was lost when Arg-7 or Arg-8 but not Arg-9 in GIM9 were replaced with lysine (Figure 7AD).
|
|
Identical effects on subcellular localization were also seen after substitution of these particular arginines by histidine, as shown for GIM9-H7 and GIM9-H9 in Figure 7EH. We conclude from these observations that not only the presence of a positive charge but also the particular amino acid side chain are critical determinants for signal recognition, with some structural variations apparently being tolerated at the Arg-9 position so long as the side chain of the amino acid in this position can acquire a positive charge. The various GIM9 mutants displayed normal
1,2-mannosidase activity, indicating that the observed differences in subcellular localization do not result from polypeptide misfolding.
Does (Arg)3 act as a retrieval signal?
COS 1 cells transfected with cDNA encoding for ER-glucosidase I, Golgi-Man9-mannosidase, the ER-resident GIM9 hybrid or the surface expressed GIM9-L9 mutant, were cultured for 48 h in the presence of [3H]mannose. Overexpressed [3H]labeled enzyme proteins were isolated by immunoprecipitation using either a polyclonal antibody against glucosidase I or against Man9-mannosidase, followed by treatment with Glyco F and separation of the released [3H]glycans using high-performance liquid chromatography (HPLC). The results of these experiments are summarized in Figure 8. As can be seen, the [3H]glycan fraction from the Golgi-located Man9-mannosidase consists of a pattern of high mannose intermediates ranging in size from Man5-GlcNAc2 to Glc2-Man9-GlcNAc2 with Man5-GlcNAc2 and Man9-GlcNAc2 being the predominant species (Figure 8A). A comparable spectrum of [3H]oligosaccharides was found to be released from the ER-resident GI-M9 hybrid (Figure 8B), as well as from the GIM9-L9 mutant expressed as a cell surface protein (Figure 8C). On the other hand, the glucosidase I-specific [3H]glycan composition differed substantially from these three fractions containing Man9-GlcNAc2 as the major intermediate, with less than 15% of Man8-GlcNAc2 and Man5-GlcNAc2 at the limit of detectability (Figure 8D). There are two possibilities for explaining these differences.
|
First, degradation of Man9-GlcNAc2 to Man5 and Man6 intermediates involving distinct Golgi-
1,2-mannosidases. This would mean that, in contrast to glucosidase I, GIM9 (ER-resident) as well as the GIM9-L9 mutant and wild-type Man9-mannosidase must all have had access to the corresponding post-ER compartment. This would imply that the triple-arginine motif is able to direct ER-localization of GIM9 and type II transmembrane proteins, respectively, by a Golgi-to-ER retrograde transport mechanism in an analogous way to the double-lysine motif in the cytosolic domain of type I membrane proteins (Cosson and Letourneur, 1994
Second, the GIM9-linked Man9-GlcNAc2 structure is degraded to Man6 and/or Man5 involving "self-processing" by the catalytically active GIM9 hybrid in combination with ER-located mannosidase(s) that are known to process Man9-GlcNAc2 giving different Man8-isomers (Bause et al., 1992
; Herscovics, 1999
). In this case GIM9, which is retained in the ER by the (Arg)3 motif, would not have to leave this compartment.
Although our current data do not allow us to distinguish clearly between these possibilities, we favor the first explanation, namely, that (Arg)3 may function as a retrieval rather than as a retention signal for the following reason. Compared with that of wild-type Man9-mannosidase (Golgi-located) for which the ratio
(Man5-Man7)/
(Man8-Man9)<1, the ratio for both GIM9 (ER-resident) and GIM9-L9 (cell surfacelocated) is considerably greater than 1 (Figure 8). It does not appear likely, a priori, that modification of GIM9 glycans by "self-processing" in the ER would be more extensive than for the Golgi-resident wild-type Man9-mannosidase. The differences in the extent of oligosaccharide processing may be explained by assuming that transport and/or access to post-ER compartments follow different routes depending on whether the membrane protein is Golgi-resident (as the wild-type enzyme) or subject to Golgi-to-ER retrograde transport, as postulated for GIM9. The accumulation of Man9-GlcNAc2 indicates that glucosidase I does not leave the ER, pointing to the triple-arginine motif 's not playing an essential role in ER targeting of the wild-type enzyme (see later discussion).
The N-terminal arginine motif is not the key determinant for ER retention of glucosidase I
Based on the observation that replacement of Arg-7, Arg-8, or Arg-9 by leucine resulted in disruption of ER-directing information in case of the GIM9 construct, these mutations were introduced into the sequence of wild-type glucosidase I (GI-L7, GI-L8, and GI-L9) to evaluate the significance of the triple-arginine retrieval signal in ER targeting of the wild-type enzyme. In addition, a glucosidase I deletion mutant (
M-GI) was synthesized lacking the amino acid residues 211 at the N-terminus, which included the triple-arginine sequence (Figure 1).
As expected, the molecular mass of the glucosidase I mutants overexpressed in COS 1 cells was identical with that of the wild-type enzyme (Figure 3A, lanes 3 and 4); a slightly smaller molecular size was observed for
M-GI, associated with the lack of the N-terminal decapeptide (Figure 3A, lane 5). In contrast to the
M-GIM9 and GIM9-L9 protein hybrids, which were detected at the cell surface (Figures 5H and 6H), both
M-GI and GI-L9 were expressed as ER-resident proteins (Figure 9A and C) with essentially no fluorescence labeling being detectable at the plasma membrane of nonpermeabilized cells (Figure 9B and D). Similar results were obtained with GI mutants containing leucine in either the Arg-7 or Arg-8 position (data not shown). Overexpressed GI-L9 and
M-GI degraded [14C]Glc3-Man9-GlcNAc2 with time kinetics comparable to that of the wild-type enzyme, excluding the explanation that the adoption of the catalytically active peptide conformation is affected severely by the amino acid exchanges in the cytosolic domain of glucosidase I and by truncation of the N-terminal decapeptide. These observations, together with the finding that Man9-GlcNAc2 was the major processing intermediate released from the wild-type enzyme by Glyco F (Figure 8D), support the view that (1) ER residency of glucosidase I occurs most likely by retention and (2) the essential structural information for ER targeting is contained in domains of the glucosidase I polypeptide other than the cytosolic peptide tail including the (Arg)3 sequence.
|
To decide whether the glucosidase I transmembrane domain contributes to ER localization as previously suggested (Tang et al., 1997
78 kDa protein (Figure 3A, lane 6) which displayed normal glucosidase I activity (Figure 4A). Analysis of detergent-permeabilized cells overexpressing M9GI revealed ER-specific fluorescence staining, whereas nonpermeabilized cells remained unstained (Figure 9E and F). This suggests that the key information determining ER localization must be contained in the luminal polypeptide chain of glucosidase I rather than in its cytosolic and transmembrane domain. | Conclusions |
|---|
|
|
|---|
By preparing chimeric model proteins and conducting mutational analysis, we have studied structural parameters in the glucosidase I polypeptide chain responsible for directing ER localization. Replacement of distinct arginine residues in the cytosolic peptide tail of a chimeric construct containing the N-terminal and transmembrane of glucosidase I and the luminal domain of the Golgi-located Man9-mannosidase (GIM9) showed that the three arginine residues located in position 79 relative to the N-terminus function as a targeting signal conferring ER residency on type II transmembrane proteins, presumably by Golgi-to-ER retrograde transport. The ER localization information was lost after substitution of either Arg-7 or Arg-8 in the triple-arginine motif but not of Arg-9 by lysine and histidine, respectively. This indicates that Arg-7 and Arg-8 are invariant residues and that, in addition to positive charge, the side chain structure is also essential for signal functionality.
A similar but reversed situation has been described for the cytosolically exposed double-lysine motif in ER-resident type I transmembrane proteins, whose retrieval information was lost when both lysines were replaced by arginines but not by histidines (Hardt and Bause, 2002
). Assuming that ER targeting occurs by means of a retrieval mechanism, a plausible explanation for these differential effects is that the arginine motif in type II proteins and the double-lysine/double-histidine motif in type I proteins are recognized by and bound to different receptor proteins in the coatomer complex. This could mean that distinct populations of COPI-coated vesicles are involved in Golgi-to-ER retrograde transport and that formation of specific transport vesicles may depend on the nature of the signal amino acids, as well as on the membrane topology of the protein concerned.
In apparent contrast to the data obtained for GIM9, ER residency of wild-type glucosidase I was neither affected by destruction nor by truncation of the cytosolic triple-arginine signal. This indicates that the (Arg)3 signal is unlikely to be functionally relevant for ER targeting of the wild-type enzyme and that additional localization information must be contained in the glucosidase I polypeptide. Results obtained with the various hybrid proteins support the view that ER localization of glucosidase I occurs by direct retention and that ER residency is mediated by structural determinants residing in the luminal domain rather than in the cytosolic and transmembrane domain. (1) The GIM9 chimera containing the cytosolic and transmembrane domain of glucosidase I is expressed as a cell surface protein when the arginine motif in the cytosolic peptide is either destroyed by mutation or completely removed, making a critical contribution to and involvement of the glucosidase I cytosolic and transmembrane in ER targeting unlikely. (2) ER residency was maintained after replacement of the cytosolic and transmembrane domain of glucosidase I by the corresponding domains of Man9-mannosidase (M9GI), in line with this interpretation. Although the Man9-mannosidase transmembrane domain itself lacks ER targeting information (unpublished data), it cannot be excluded that both the transmembrane and luminal domain of glucosidase I are essential, acting in a concerted manner, and that the mannosidase transmembrane domain simply mimics the function of the glucosidase I transmembrane domain; this is, however, unlikely. (3) ER localization caused by retention rather than by retrieval is consistent with Man9-GlcNAc2 being the major glycan structure released by Glyco F. The occurrence of this processing intermediate is best explained by assuming that glucosidase I fails to leave the ER, in contrast to GIM9-L9, wild-type Man9-mannosidase, and presumably G1M9, whose N-linked glycan chains are processed down to the Man5-GlcNAc2-stage. The apparent lack of dominant signal information contributed by the transmembrane domain contradicts previous observations that the plasma membrane located dipeptidylpeptidase IV becomes ER resident after replacing its transmembrane domain by that of glucosidase I (Tang et al., 1997
). The reason for this apparent discrepancy is not known.
The nature of the amino acids and/or peptide regions in the luminal domain of glucosidase I, as well as the specific mechanism by which the enzyme is retained in the ER, remain to be established. A possible mechanism could be that according to the kin-recognition model as previously proposed for Golgi-resident membrane proteins (Nilsson et al., 1994
; Opat et al., 2000
), glucosidase I subunits interact via their luminal domains, giving rise to the formation of large homo- or hetero-oligomeric protein assemblies. Due to their size, these protein complexes may not be able to enter or to be packaged into transport vesicles; this would prevent their export from the ER. Some evidence supporting this view is provided by the observation that glucosidase I purified from pig liver microsomes was found to elute from a Sephacryl S-300 column as a catalytically active protein complex consisting of at least four to six subunits (Hettkamp et al., 1984
) and that even larger oligomers seem to be formed when detergent extracts of microsomes were subjected to gel chromatography. Assuming that ER retention of glucosidase I occurs by this kin-recognition type mechanism, the function of the triple-arginine motif could be to recapture and retransport those subunits from pre-Golgi compartments that have escaped from the ER before being integrated into the multimeric protein assemblies.
| Materials and methods |
|---|
|
|
|---|
Materials
Materials and chemicals were obtained from the following sources: DEAE dextran and [2-3H]mannose, specific activiy 26 Ci/mmol (Amersham Biosciences, Freiburg); synthetic oligonucleotides, Taq polymerase, Dulbecco's Modified Eagle Medium and pSV.SPORT1 (Invitrogen, Karlsruhe); restriction endonucleases (MBI Fermentas, St. Leon-Rot); ABI PRISM Big dye terminator cycle sequencing kit (Applied Biosystems, Darmstadt); COS 1 cells (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig); goat anti-rabbit IgG alkaline phosphatase conjugate and Triton X-100 (Sigma; St. Louis, MO); fluorescein (DTAF)-conjugated AffiniPure goat anti-rabbit IgG (Dianova, Hamburg); Nucleosil-NH2 (Machery-Nagel, Düren); nitrocellulose membranes (Schleicher & Schuell, Dassel).
Vector construction and preparation of protein mutants
The glucosidase I- and Man9-mannosidase-specific cDNAs were subcloned into the mammalian expression vector pSV.SPORT1 as previously described (Kalz-Füller et al., 1995
; Bieberich and Bause, 1995
). The GIM9- and M9GI-specific vector plamids were prepared by mutual exchange of the cDNA sequences for the cytosolic and transmembrane domain, taking advantage of an internal KpnI restriction site located downstream from the glucosidase I transmembrane domain, as well as of an artificial KpnI site introduced by site-directed mutagenesis on the 3'-site of the membrane domain of Man9-mannosidase using the oligonucleotide tccaagctgctcagcgggtacctgttccactccagcccc as primer.
Truncation of the N-terminal decapeptide (
M-GIM9;
M-GI) and replacement of specific arginine residues in the cytosolic domain of glucosidase I and GIM9 by leucine, lysine, or histidine were carried out using in vitro oligonucleotide directed mutagenesis with glucosidase I cDNA as template and the sense/antisense primers summarized in Table I (Ausubel et al., 1987
). Note that the GI-as primer is located downstream from the internal KpnI site in the glucosidase I cDNA. The corresponding cDNA fragments obtained by polymerase chain reaction (PCR) amplification were digested with KpnI, followed by their ligation into KpnI sites generated by restriction cleavage of the glucosidase I- or Man9-mannosidase-specific plasmids. The structures of hybrid and mutant proteins were confirmed by DNA sequencing.
|
Cell culture and transfection
COS 1 cells were grown at 37°C and 5% CO2 as monolayer cultures in Dulbecco's modified Eagle medium containing 10% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin. After having reached
60% confluency, the cells were transfected with the various vector plasmids using the DEAE-dextran/chloroquine method (Sambrook et al., 1989
Metabolic labeling and immunoprecipitation
COS 1 cells were transfected with the vector constructs encoding for either glucosidase I, Man9-mannosidase, GIM9, or GIM9-L9, followed by culturing in the presence of 1 mCi [2-3H]mannose (specific activity 26 Ci/mmol). Forty-eight hours after transfection, the cells were harvested and washed with phosphate buffered saline to remove excess of [2-3H]mannose. Solubilization of the resulting cell pellets and isolation of overexpressed [2-3H]labeled glycoproteins by immunoprecipitation using a polyclonal antibody against glucosidase I and Man9-mannosidase, have been described previously (Hardt et al., 2001
). After treatment of the [2-3H]glycoprotein fractions with Glyco F, the released radiolabeled oligosaccharides were separated from the incubation mixture by WesselFlügge extraction (Wessel and Flügge, 1984
) and analyzed by HPLC on a Nucleosil-NH2 column (Schweden et al., 1986
; Bause et al., 1992
).
Determination of glucosidase I and Man9-mannosidase activity
Transfected COS 1 cells were cultured on 100-mm dishes and, after 48 h, isolated by centrifugation. The cell pellets were resuspended in 300 µl of either 50 mM phosphate buffer, pH 6.5, containing 1% Triton X-100 (glucosidase I assay) or 50 mM phosphate buffer, pH 6.0, containing 1% Triton X-100 and 1 mM CaCl2 (Man9-mannosidase assay). Aliquots of the detergent extracts (3050 µl) containing equal amounts of cell protein were incubated in the presence of 500 cpm of either [14C]Glc3-Man9-GlcNAc2 or [14C]Man9-GlcNAc2 as enzyme-specific substrates. After given times, reactions were terminated by the addition of 3050 µl acetic acid, followed by analysis of substrate cleavage as release of [14C]glucose and [14C]mannose, respectively, using paper chromatography as described previously (Hettkamp et al., 1984
; Schweden and Bause, 1989
).
Immunofluorescence microscopy
Transfected cells were transferred onto sterile coverslips and, after 24 h, either fixed with 8% formaldehyde or fixed and then permeabilized with 0.2% Triton X-100 in 200 mM HEPES, pH 7.2. The cells were incubated in a 1:10 dilution of an affinity-purified antiglucosidase I or antiMan9-mannosidase antibody, and the antigen/antibody complexes were visualized by using a 1:100 dilution of a DTAF-conjugated goat anti-rabbit IgG antibody (Kalz-Füller et al., 1985; Bieberich and Bause, 1995
).
General methods
Sodium dodecyl sulfatepolyacrylamide gel electrophoresis and immunoblotting was carried out as described previously (Laemmli, 1970
; Blake et al., 1984
; Knecht and Dimond, 1984
). PCR, vector construction, site-directed mutagenesis, and other cloning procedures were performed as detailed elsewhere (Ausubel et al., 1987
; Sambrook et al., 1989
; White, 1993
). Glyco F cleavage and synthesis of [14C]Glc3-Man9-GlcNAc2 and [14C]Man9-GlcNAc2 have been detailed in other articles (Hettkamp et al., 1984
; Schweden et al., 1986
; Schweden and Bause, 1989
). Preparation and purification of polyclonal antibodies against glucosidase I and Man9-mannosidase have been described (Schweden and Bause, 1989
; Bause et al., 1989
).
| Acknowledgements |
|---|
This work was supported by the Deutsche Forschungsgemeinschaft (Sonderforschungsbereich 284). The authors are indebted to R.A. Klein (University Bonn) for critical reading of the manuscript.
1 To whom correspondence should be addressed; e-mail:bause{at}institut.physiochem.uni-bonn.de ![]()
| Abbreviations |
|---|
ER, endoplasmic reticulum; HPLC, high-performance liquid chromatography; PCR, polymerase chain reaction.
| References |
|---|
|
|
|---|
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (1987) Current protocols in molecular biology. John Wiley and Sons, New York.
Bause, E., Breuer, W., Schweden, J., Roeser, R., and Geyer, R. (1992) Effect of substrate structure on the activity of Man9-mannosidase from pig liver involved in N-linked oligosaccharide processing. Eur. J. Biochem., 208, 451457.[Web of Science][Medline]
Bause, E., Schweden, J., Gross, A., and Orthen, B. (1989) Purification and characterization of glucosidase I from pig liver. Eur. J. Biochem., 183, 661669.[Web of Science][Medline]
Bieberich, E. and Bause, E. (1995) Man9-mannosidase from human kidney is expressed in COS cells as a Golgi resident type II transmembrane N-glycoprotein. Eur. J. Biochem., 233, 644649.[Web of Science][Medline]
Blake, M.S., Johnson, K.H., Russel-Jones, G.J., and Gotschlich, E.C. (1984) A rapid, sensitive method for detection of alkaline phosphatase-conjugated anti-antibody on western blots. Anal. Biochem., 136, 175179.[CrossRef][Web of Science][Medline]
Cosson, P. and Letourneur, F. (1994) Coatomer interaction with di-lysine endoplasmic reticulum retention motifs. Science, 263, 16291631.
Cosson, P. and Letourneur, F. (1997) Coatomer (COPI)-coated vesicles: role in intracellular transport and protein sorting. Curr. Opin. Cell Biol., 9, 484487.[CrossRef][Web of Science][Medline]
Fu, J. and Kreibich, G. (2000) Retention of subunits of the oligosaccharyltransferase complex in the endoplasmic reticulum. J. Biol. Chem., 275, 39843990.
Hardt, B., Aparicio, R., Breuer, W., and Bause, E. (2001) Analysis of structural signals conferring localisation of pig OST48 to the endoplasmic reticulum. Biol. Chem., 382, 10391047.[CrossRef][Web of Science][Medline]
Hardt, B. and Bause, E. (2002) Lysine can be replaced by histidine but not by arginine as the ER retrieval motif for type I membrane proteins. Biochem. Biophys. Res. Commun., 291, 751757.[CrossRef][Web of Science][Medline]
Herscovics, A. (1999) Importance of glycosidases in mammalian glycoprotein biosynthesis. Biochim. Biophys. Acta, 1473, 96107.[Medline]
Hettkamp, H., Legler, G., and Bause, E. (1984) Purification by affinity chromatography of glucosidase I, an endoplasmic reticulum hydrolase involved in the processing of asparagine-linked oligosaccharides. Eur. J. Biochem., 142, 8590.[Web of Science][Medline]
Kalz-Füller, B., Bieberich, E., and Bause, E. (1995) Cloning and expression of glucosidase I from human hippocampus. Eur. J. Biochem., 231, 344351.[Web of Science][Medline]
Knecht, D.A. and Dimond, R.L. (1984) Visualization of antigenic proteins on western blots. Anal. Biochem., 136, 180184.[CrossRef][Web of Science][Medline]
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head bacteriophage T4. Nature, 227, 680685.[CrossRef][Medline]
Lewis, M.J. and Pelham, H.R. (1992) Ligand-induced redistribution of a human KDEL receptor from the Golgi complex to the endoplasmic reticulum. Cell, 68, 353364.[CrossRef][Web of Science][Medline]
Nilsson, T., Hoe, M.H., Slusarewicz, P., Rabouille, C., Watson, R., Hunte, F., Watzele, G., Berger, E.G., and Warren, G. (1994) Kin recognition between medial Golgi enzymes in HeLa cells. EMBO J., 13, 562574.[Web of Science][Medline]
Opat, A.S., Houghton, F., and Gleeson, P.A. (2000) Medial Golgi but not late Golgi glycosyltransferases exist as high molecular weight complexes. Role of luminal domain in complex formation and localization. J. Biol. Chem., 275, 1183611845.
Sambrook, J., Fritsch, E.F., and Maniatis T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York.
Schutze, M.-P., Peterson, P.A., and Jackson, M.R. (1994) An N-terminal double-arginine motif maintains type II membrane proteins in the endoplasmic reticulum. EMBO J., 13, 16961705.[Web of Science][Medline]
Schweden, J., and Bause, E. (1989) Characterization of trimming Man9-mannosidase from pig liver: purification of a catalytically active fragment and evidence for the transmembrane nature of the intact 65 kDa enzyme. Biochem. J., 264, 347355.[Web of Science][Medline]
Schweden, J., Legler, G., and Bause, E. (1986) Purification and characterization of a neutral processing mannosidase from calf liver acting on (Man)9(GlcNAc)2 oligosaccharides. Eur. J. Biochem., 157, 563570.[Web of Science][Medline]
Tang, B.L., Low, S.H., and Hong, W. (1997) Endoplasmic reticulum retention mediated by the transmembrane domain of type II membrane proteins Sec12p and glucosidase I. Eur. J. Cell Biol., 73, 98104.[Web of Science][Medline]
Teasdale, R.D. and Jackson M.R. (1996) Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the Golgi apparatus. Annu. Rev. Cell. Dev. Biol., 12, 2754.[CrossRef][Web of Science][Medline]
Treml, K., Meimaroglou, D., Hentges, A., and Bause, E. (2000) The
- and ß-subunits are required for expression of catalytic activity in the hetero-dimeric glucosidase II complex from human liver. Glycobiology, 10, 493502.
Trombetta, S.E., Simons, J.F., and Helenius, A. (1996) Endoplasmic reticulum glucosidase II is composed of a catalytic subunit, conserved from yeast to mammals, and a tightly bound noncatalytic HDEL-containing subunit. J. Biol. Chem., 271, 2750927516.
Wessel, D. and Flügge, U.I. (1984) A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem., 138, 141143.[CrossRef][Web of Science][Medline]
White, B.A. (1993) PCR-protocolscurrent methods and applications. Human Press, Ottawa.
Wieland, F. and Harter, C. (1999) Mechanisms of vesicle formation: insights from the COP system. Curr. Opin. Cell Biol., 11, 440446.[CrossRef][Web of Science][Medline]
Yamamoto, K., Fujii, R., Toyofuka, Y., Saito, T., Koseki, H., Hsu, V.W., and Aoe, T. (2001) The KDEL receptor mediates a retrieval mechanism that contributes to quality control at the endoplasmic reticulum. EMBO J., 20, 30823091.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. Saint-Jore-Dupas, A. Nebenfuhr, A. Boulaflous, M.-L. Follet-Gueye, C. Plasson, C. Hawes, A. Driouich, L. Faye, and V. Gomord Plant N-Glycan Processing Enzymes Employ Different Targeting Mechanisms for Their Spatial Arrangement along the Secretory Pathway PLANT CELL, November 1, 2006; 18(11): 3182 - 3200. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Heine, B. Koch, S. Storch, A. Kohlschutter, D. N. Palmer, and T. Braulke Defective Endoplasmic Reticulum-resident Membrane Protein CLN6 Affects Lysosomal Degradation of Endocytosed Arylsulfatase A J. Biol. Chem., May 21, 2004; 279(21): 22347 - 22352. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










