Skip Navigation


Glycobiology Advance Access originally published online on November 26, 2002
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/2/87    most recent
cwg014v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Abe, H.
Right arrow Articles by Jigami, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abe, H.
Right arrow Articles by Jigami, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 2 87-95
© 2003 Oxford University Press

In vitro oligosaccharide synthesis using intact yeast cells that display glycosyltransferases at the cell surface through cell wall–anchored protein Pir

Hiroko Abe, Yoh-ichi Shimma and Yoshifumi Jigami1

Research Center for Glycoscience, National Institute of Advanced Industrial Science and Technology (aist), Aist Central 6, Tsukuba, Ibaraki 305-8566, Japan

Received on May 17, 2002; revised on September 13, 2002; accepted on September 14, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
A glycosyltransferase was fused to the yeast cell wall protein Pir, which forms the Pir1–4 protein family and is incorporated into the cell wall by an unknown linkage to be displayed at the yeast cell surface. We first expressed the PIR1-HA-gma12+ fusion, in which gma12+ encodes {alpha}-1,2-galactosyltransferase from the fission yeast Schizosaccharomyces pombe under the Saccharomyces cerevisiae GAPDH promoter. The {alpha}-1,2-galactosyltransferase activity was detected at the surface of the intact cells that produce Pir1-HA-Gma12 fusion. To further demonstrate sequential oligosaccharide synthesis, two plasmids containing PIR1-HA-KRE2 and PIR2-FLAG-MNN1 fusion genes were constructed in which KRE2 and MNN1 encode {alpha}-1,2-mannosyltransferase and {alpha}-1,3-mannosyltransferase from S. cerevisiae, respectively. The intact yeast cells transformed with these two plasmids added mannoses initially with an {alpha}-1,2 linkage and subsequently with an {alpha}-1,3 linkage to the {alpha}-1,2-mannobiose acceptor in the presence of a GDP-mannose donor, demonstrating that Pir1 and Pir2 can be used as anchors to simultaneously immobilize several glycosyltransferases at the yeast cell surface. Based on the high acceptor specificity of glycosyltransferases, we propose a simple in vitro method for oligosaccharide synthesis using the yeast intact cell as a biocatalyst.

Key words: glycosyltransferase / intact cell enzyme / oligosaccharide synthesis / Pir / S. cerevisiae


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Oligosaccharides attached to proteins and lipids play important roles in the early steps of many biological processes, such as signal transduction, cellular recognition, lectin and toxin binding, and viral infection (Varki, 1993Go). Therefore, the oligosaccharides themselves are anticipated to act as effective modulators and pharmaceuticals to protect host cells from pathogen infections. Although many chemical methods that require multiple protection and deprotection steps have been developed for oligosaccharide synthesis (Flowers, 1978Go), enzymatic synthesis by glycosyltransferases has recently been explored as a way to circumvent the drawbacks of the chemical synthesis (Ichikawa et al., 1992Go).

Koizumi et al. (1998)Go reported the enzymatic synthesis of oligosaccharides through the coupling of recombinant bacteria, which were engineered to express both sugar nucleotide biosynthetic enzymes and glycosyltransferases (Endo and Koizumi, 2000Go; Endo et al., 2000Go). However, in this coupled production system, the oligosaccharide products are possible to be contaminated by intracellular materials like endotoxins from bacteria because the permeabilization of bacterial membranes is indispensable for introducing acceptor oligosaccahrides and sugar nucleotides into the bacteria. Then further purification of the oligosaccharide products is therefore essential. The system also has the crucial drawback that the bacterial cells cannot be reused for the next reaction due to the killing of cells by the permeabilization. In general, the expression of glycosyltransferases of mammalian origin in Escherichia coli tends to form inclusion bodies, and thus it is difficult to obtain an active enzyme.

Large-scale production of glycosyltransferases has been reported in the budding yeast Saccharomyces cerevisiae and the methylotrophic yeast Pichia pastoris (Borsig et al., 1995Go; Herrmann et al., 1995Go; Lubineau et al., 1998Go; Malissard et al., 1999Go, 2000). These glycosyltransferases are secreted into the culture medium; therefore, purification of the enzymes from the culture broth is essential if they are to be used for the oligosaccharide synthesis. Some methods have also been reported in which the transformed whole yeast cells were used as an enzyme source (Herrmann et al., 1995Go; Gallet et al., 1998Go; Lubineau et al., 1998Go). The whole yeast cells used as an enzyme source can easily be separated from the reaction products and can be used repetitively. However, the enzymatic activity of the transformed yeast cells might decrease during the cultivation period because enzyme secretion into the medium might occur due to insufficient anchoring to the cell surface.

The methods for immobilizing a protein at the cell surface has been well studied using a part of {alpha}-agglutinin as an anchor (Schreuder et al., 1993Go, 1996Go; Murai et al., 1997Go, 1999Go; Nakamura et al., 2001Go; Shibasaki et al., 2001Go). {alpha}-Agglutinin is a cell wall protein involved in the sexual adhesion of mating-type {alpha} cells to mating-type a cells of S. cerevisiae (Lipke and Kurjan, 1992Go). It has a cell wall attachment signal of glycosylphosphatidylinositol (GPI) anchor, which contributes to the covalent linking of various mannoproteins to the cell surface (Lipke et al., 1989Go; Wojciechowicz et al., 1993Go). However, glycosyltransferases and lipases, whose active sites are located near their C-termini, are not suitable for this display system because the target proteins must be fused to the GPI anchor sequence at their C-terminal regions (Schreuder et al., 1996Go).

As an alternative approach, we used Pir proteins to immobilize target proteins at the yeast cell surface. The Pir proteins, which are encoded by four highly homologous genes, PIR1, PIR2, PIR3 (Toh-e et al., 1993Go), and PIR4 (Moukadiri et al., 1999Go), covalently bind to ß-1,3-glucan of the cell wall components, in spite of the absence of a GPI-anchoring signal at their C-termini. This binding occurs through an unknown linkage that is sensitive to a mild alkaline treatment (Mrsa et al., 1997Go). We constructed enzyme-displayed yeast cells using Pir1 and Pir2 proteins to immobilize glycosyltransferases on the cell wall. The intact yeast cells displaying two kinds of glycosyltransferases synthesized the desired oligosaccharide. Based on these results, we report a novel system for oligosaccharide synthesis by intact yeast cells using Pir proteins as a cell wall anchor.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Localization of the Pir1-HA-Gma12 fusion protein at the cell surface
To immobilize glycosyltransferases on the yeast cell wall, the Schizosaccharomyces pombe {alpha}-1,2-galactosyltransferase (Gal-T) encoded by gma12+ (Chappell et al., 1994Go) was used as a model enzyme. Generally, glycosyltransferase has a transmembrane domain near its N-terminus with which to anchor to the membrane. A transmembrane-domain-truncated Gma12 was fused after S. cerevisiae Pir1 through the HA-epitope tag (Figure 1A). This fusion gene was inserted into a multicopy plasmid, YEp352GAP-II, expressing under the control of the S. cerevisiae glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter (pAB4).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1. Expression of PIR1-HA-gma12+ fusion gene and the cellular localization of the fusion protein in S. cerevisiae. (A) The plasmid pAB4 used to express the PIR1-HA-gma12+fusion gene. (B) Immunofluorescent labeling of intact cells transformed with the expression plasmid and probed with fluorescent-conjugated IgG that recognizes anti-HA antibody. Immunofluorescence microphotographs (a and c) and phase-contrast microphotographs (b and d). (a and b) S. cerevisiae W303-1A/pAB4 (expression plasmid); (c and d) S. cerevisiae W303-1A/ YEp352GAP-II (control plasmid). (C) Western blot analysis of the Pir1-HA-Gma12fusion protein that was released by alkaline treatment from the cellwall of the transformed cells. The fusion protein was detected withthe anti-HA antibody. Lane 1, W303-1A/pAB4 (expression plasmid);lane 2, W303-1A/YEp352GAP-II (control plasmid). The numbers on the right refer to the sizes of standard proteins in kDa. The arrowhead and smears indicate Pir1-HA-Gma12 fusion proteins containing a different extent of glycosylation.

 
To examine whether the Pir1-HA-Gma12 fusion protein was correctly localized to the cell surface, the immunofluorescent labeling assay was carried out using an anti-HA antibody as a primary antibody and fluorescent-conjugated anti-rat IgG as a secondary antibody (see Materials and methods). In the cells harboring pAB4 plasmid, immunofluorescent signals were detected at the cell surface (Figure 1B, a and b), and no immunofluorescent signals were detected in the cells harboring a control plasmid. However, these cells were not stained uniformly. This result may be partly due to the differences in the protein expression level and the plasmid copy number in each cell. However, it is more likely that the property of Pir1 itself may contribute to this irregular distribution of fusion proteins at the cell surface, because the same staining pattern was observed for the native Pir1 (unpublished data).

It is possible that the Pir1-HA-Gma12 fusion protein could be released from the cell surface with the mild alkaline treatment, because Pir1 itself is reported to be liberated by the same treatment (Mrsa et al., 1997Go). As expected, Pir1-HA-Gma12 was detected in the soluble fraction by the mild alkaline treatment (Figure 1C). The Pir1-HA-Gma12 fusion showed a smear band with a molecular weight higher than that of the predicted protein size, implying that this fusion protein may be highly glycosylated.

These results indicate that the Pir1-HA-Gma12 fusions are localized and anchored to the cell wall in the same manner as the native Pir1 protein, demonstrating that the cell wall–anchoring property of Pir1 is not impaired by the fusion with an extra protein.

Gal-T activity of the intact cells
We examined whether the Gma12 fusion protein that was immobilized at the yeast cell surface through Pir1 may retain its Gal-T activity. To measure the enzymatic activity, the intact cells expressing Pir1-HA-Gma12 were used as an enzyme source, using pyridylamine (PA)-labeled mannobiose and UDP-galactose as acceptor and donor, respectively. It is known that S. pombe Gma12 adds an {alpha}-1,2-linked galactose to PA-mannobiose (Roy et al., 1998Go) (Figure 2A). The high-performance liquid chromatography (HPLC) analysis indicated that the intact cells harboring pAB4 retain enough Gal-T activity to convert all the PA-mannobiose acceptors (M2) to PA-galactomannobiose product (M2-Gal) (Figure 2B). In contrast, the cells harboring a control plasmid did not show any Gal-T activities. As shown in Figure 2C, the cells maintained their intact cell shapes without any cell lysis after a reaction.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2. {alpha}-1,2-Gal-T activity of intact cells that display Pir1-HA-Gma12. (A) The predicted structure of enzymatic reaction product. Gma12 is responsible for the addition of {alpha}-1,2-linked galactose to the PA-labeled mannobiose. (B) The intact cells harboring pAB4 (expression plasmid) (a) and the intact cells harboring YEp352GAP-II (control plasmid)(b) were used as an enzyme source for the Gal-T assay. After the enzyme reaction, the products were analyzed by HPLC. The dark arrowhead indicates the peak of the galactomannobiose product and the open arrowhead indicates the peak of the mannobiose acceptor. (C) The cells after enzyme reaction. (a) W303-1A/pAB4; (b) W303-1A/YEp352GAP-II.

 
To further examine whether all of the observed activity was derived from the enzymes immobilized on the cell wall, the cell wall fraction was prepared after mild breakage of the intact cells. The Gal-T activity was detected in the cell wall fraction, and the activity was approximately threefold higher in the total cell lysate than in the cell wall fraction (Figure 3). These data suggest that not only the cell surface but also the intracellular unimmobilized enzymes may be detected in the total activity. We also confirmed that the intact cells expressing the fusion protein, in which gma12+ was fused to the prepro leader sequence of the {alpha} factor precursor protein, exhibited only a small amount of Gal-T activity (data not shown). These results indicate that the Gma12 protein anchored to the cell wall through Pir1 has enough Gal-T activity to be used as an enzyme source.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Comparison of enzymatic activity after a differential cellular fractionation. Assays were carried out as described in Materials and methods. The following were used as an enzyme source in each assay: Intact cell, the intact cell fraction; cell wall, the cell wall fraction; total cell, the total cell lysate in which proteins of both the cell wall fractions and intracellular fractions are present.

 
Localization of Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 fusion proteins at the cell surface
As a model system for the sequential oligosaccharide synthesis, two kinds of plasmids were constructed to display two glycosyltransferases at the cell surface (see Materials and methods). The Pir1 protein that was fused to the HA-epitope at the C-terminus was further connected to the transmembrane domain–truncated Kre2, {alpha}-1,2-mannosyltransferase involved in the O-glycosylation of S. cerevisiae (Figure 4A) (Häusler et al., 1992Go; Häusler and Robbins, 1992Go). The Pir2 protein that was fused to the FLAG-epitope at the C-terminus was further connected to the transmembrane domain–truncated Mnn1, {alpha}-1,3-mannosyltransferase, which is involved in the terminal mannose transfer in O- and N-glycosylations of S. cerevisiae (Ballou, 1990Go; Graham et al., 1994Go; Yip et al., 1994Go) (Figure 4A). Pir2, a member of the Pir protein family, is also estimated to be covalently linked to ß-1,3-glucan, another yeast cell wall component (Mrsa et al., 1997Go; Kapteyn et al., 1999Go). The fusion genes were inserted into multicopy plasmid YEp352GAP-II (pAB30) or YEp351GAP-II (pAB31).



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4. Expression of PIR1-HA-KRE2 and PIR2-FLAG-MNN1 fusion genes and their cellular localization in S. cerevisiae. (A) The structure of plasmids pAB30 and pAB31 to express PIR1-HA-KRE2 and PIR2-FLAG-MNN1 fusion genes, respectively. (B) Immunofluorescent labeling of transformed cells. Imunofluorescence microphotographs (a, c, e, and g) and phase-contrast microphotographs (b, d, f, and h). (a, b, e, and f) kre2 ktr1 ktr3 triple null strain, SSY18/pAB30 + pAB31 (expression plasmids); (c, d, g, and h) SSY18/YEp352GAP-II (control plasmid). (C) Western blot analysis of Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 fusion proteins in the alkaline-treated cell wall extract of cotransformed cells. The twin membranes were detected with anti-HA antibody and anti-FLAG antibody, respectively. Lane 1, W303-1A/pAB30 + pAB31; lane 2, SSY18/pAB30 + pAB31; lane 3, SSY18/YEp352GAP-II. The numbers on the right refer to the sizes of standard proteins in kDa. The open and dark arrowheads indicate the positions of Pir1-HA-Kre2 and Pir2-FLAG-Mnn1, respectively.

 
These plasmids were cotransformed into the wild-type W303-1A cells and the isogenic mutant SSY18 cells, in which chromosomal KRE2, KTR1, and KTR3, encoding {alpha}-1,2-mannosyltransferase genes, were deleted. The SSY18 strain was used to measure the mannosyltransferase activities of the intact cells expressing these fusion proteins. To examine whether these fusion proteins were located at the yeast cell surface, the indirect immunofluorescent labeling assay was performed using anti-HA (12CA5) or anti-FLAG (M2) antibody as a primary antibody and the fluorescent-conjugated anti-rat IgG or anti-mouse IgG as a secondary antibody (Figure 4B). The fluorescence signals were detected (Figure 4B, a and e). In contrast, the cells harboring control plasmids were not labeled (Figure 4B, c and g).

To confirm that the fusion proteins Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 are coexpressed and displayed on the cell wall, we performed western blotting analysis after preparing the cell wall fraction by a mild alkaline treatment of the cells harboring both plasmids (see Materials and methods). The alkaline-treated cell wall fraction was subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and then analyzed by western blotting using anti-HA or anti-FLAG antibody. Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 were detected each as a discrete band shown by an arrow, together with the smears containing a different extent of glycosylation (Figure 4C, anti-HA, lane 1, anti-FLAG, lane 1), indicating that they were simultaneously displayed at the cell wall of wild-type cells.

In the western blotting of the cell wall fractions prepared from SSY18 cells harboring these two plasmids, Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 were also observed (Figure 4C, anti-HA, lane 2, anti-FLAG, lane 2). Considered together, these data indicate that the fusion proteins were expressed and anchored to the cell wall in the same manner as native Pir1and Pir2 proteins.

Sequential oligosaccharide synthesis by the intact cells immobilizing two kinds of glycosyltransferases
We addressed whether the intact SSY18 cells, in which both Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 were immobilized, retained both of the enzyme activities. To measure the mannosyltransferase activity of the fusion proteins, PA-labeled {alpha}-1,2-linked mannobiose was used as an acceptor. As shown in Figure 5A, Kre2 adds an {alpha}-1,2-linked mannose to the mannobiose to form mannotriose, and Mnn1 mainly adds an {alpha}-1,3-linked mannose to this product to form mannotetraose (Gemmill and Trimble, 1999Go; Romero et al., 1999Go). First, we used the cell wall fraction as an enzyme source and analyzed the reaction products by HPLC. As shown in Figure 5B, two peaks corresponding to PA-mannotriose and PA-mannotetraose were observed, in addition to the peak of PA-mannobiose acceptor, indicating that the immobilized fusions retained the mannosyltransferase activity on the cell wall. We further examined whether the intact cells could synthesize mannotetraose. HPLC analysis of the reaction products using intact cells (Figure 5B, right) showed that PA-labeled {alpha}-1,2-linked mannobiose was converted to PA-mannnotriose and PA-mannotetraose at the same ratio as that observed in the cell wall fraction (Figure 5B, left, cell walls). This result indicates that the two-step oligosaccharide synthesis was successfully achieved using intact yeast cells expressing two kinds of glycosyltransferases on the cell wall.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Sequential synthesis of O-linked oligosaccharides by intact cells coimmobilizing Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 fusion proteins. (A) Predicted products in the sequential synthesis of O-linked oligosaccharides. Kre2 is responsible for the addition of the third mannose with {alpha}-1,2 linkage, and Mnn1 is mainly responsible for the addition of the fourth mannose with {alpha}-1,3 linkage. However, Mnn1 also synthesizes a smaller amount of mannotriose with {alpha}-1,3 linkage. (B) The cell wall fractions (cell walls) and intact cells (intact cells) harboring both pAB30 and pAB31 were used as enzyme sources, together with the cell wall fractions and intact cells harboring YEp352-GAPII (control plasmid). After the enzyme reaction, the products were analyzed by HPLC. The dark arrowhead indicates the peak of PA-mannotriose, and the open arrowhead indicates the peak of PA-mannotetraose. The right panels show phase-contrast microphotographs of the cells after the reaction.

 
To confirm that the desired oligosaccharides were correctly synthesized, they were digested with several mannosidases and analyzed with HPLC. Each peak fraction was isolated and subsequently treated with {alpha}-1,2-mannosidase. About 80% of the PA-mannotriose peak was shifted to a PA-mannobiose (Figure 6A, {alpha}-1,2-mannosidase). Additional {alpha}-1,2-mannosidase treatment of the remaining PA-mannotriose did not digest any more. Furthermore, nonspecific {alpha}-mannosidase (jackbean) treatment of PA-mannotriose leaded to the digestion of its glycan (Figure 6A, {alpha}-mannosidase). The results suggested that both {alpha}-1,2-linked mannotriose (about 80%) and {alpha}-1,3-linked mannotriose (about 20%) were contained in the PA-mannotriose peak. The PA-mannotetraose was digested with {alpha}-mannosidase and {alpha}-1-2,3-mannosidase, but was resistant against {alpha}-1,2-mannosidase (Figure 6B) and {alpha}-1,6-mannosidase (data not shown). These results indicate that the terminal of PA-mannotetraose is an {alpha}-1,3-linked mannose.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6. Digestion of sequentially synthesized O-linked oligosaccharides by {alpha}-mannosidases. (A) PA-mannotriose was treated ({alpha}-1,2-mannosidase and {alpha}-mannosidase) or untreated (control) with A. saitoi{alpha}-1,2-mannosidase or nonspecific jackbean {alpha}-mannosidase. M3, PA-mannotriose; M2, PA-mannobiose; M1, PA-mannose. (B)PA-mannotetraose was treated ({alpha}-1,2-mannosidase, {alpha}-mannosidase,and {alpha}-1-2,3-mannosidase) or untreated (control) with A. saitoi {alpha}-1,2-mannosidase, nonspecific jackbean {alpha}-mannosidase, orrecombinant X. manihotis {alpha}-1-2,3-mannosidase. M4, PA-mannotetraose; M2, PA-mannobiose; M1, PA-mannose.

 
Furthermore, we addressed the reaction product synthesized by the cell wall fraction of yeast displaying each enzyme alone. PA-mannotriose peak was observed when not only Pir1-HA-Kre2 but also Pir2-FLAG-Mnn1 was used as an enzyme source (data not shown). This result agrees with the report on native Mnn1 substrate specificity of Häusler et al. (1992)Go that Mnn1 can add mannose with {alpha}-1,3 linkage to {alpha}-1,2-mannobiose. These results prove that the yeast cells expressing both the Pir1-HA-Kre2 and Pir2-FLAG-Mnn1 proteins are able to synthesize the O-linked oligosaccharides at their intact cell surface as well as in vivo.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
In this article, we demonstrated that the oligosaccharides were synthesized by incubating the intact recombinant yeast cells where the fusions of glycosyltransferases with cell wall Pir protein were displayed at the cell surface. So far, the GPI anchoring proteins were used as an anchor at the C-terminus of the target proteins (Schreuder et al., 1993Go, 1996Go; Murai et al., 1997Go, 1999Go), which was not available for the glycosyltransferases. To develop the alternative display system in which the N-terminus of the target proteins can be modified, we used Pir1 or Pir2 as a novel anchor protein. The hsp150{Delta}-carrier containing the N-terminal portion of Hsp150, which is identical to Pir2, was fused to the N-terminus-truncated rat liver {alpha}-2,3-sialyltransferase (ST3Ne), then the intact cells displaying Hsp150{Delta}-ST3Ne fusion were used as an enzyme (Mattila et al., 1996Go; Sievi et al., 1998Go). However, in this article, Pir2 is estimated to function as a chaperone to assist the folding and secretion of the fusion partner because several other Hsp150{Delta} fusion proteins and the Hsp150{Delta} fragment alone were secreted into the culture medium (Simonen et al., 1994Go, 1996Go; Jämsä et al., 1995Go). It has also been reported that Pir4 can target recombinant proteins at the cell surface through the construction of a fusion between Pir4 and a portion of the Staphylococcus aureus protein A (Moukadiri et al., 1999Go). Pir4 was liberated from the cell surface by ß-mercaptoethanol, indicating that, in contrast with the other Pir proteins, Pir4 is incorporated into the cell wall through a disulfide bond bridge (Moukadiri et al., 1999Go). In addition, because those researchers inserted protein A into the Pir4 protein sequence, it is unclear whether this system can be applied to immobilize enzymes, such as glycosyltransferases, that require the intact C-terminal region for their catalytic activi-ties. Our fusion constructs are the first example that uses Pir proteins to immobilize useful enzymes at the yeast cell surface, implying that our method is applicable for various types of proteins.

Two fusion proteins, Pir1-HA-Kre2 and Pir2-FLAG-Mnn1, were constructed to display two kinds of mannosyltransferases, which are involved in yeast O-linked oligosaccharide synthesis. The oligosaccharides were sequentially synthesized using intact cells where the two fusions were immobilized. The structural analysis of PA-mannotriose showed that it contained mainly {alpha}-1,2-linked mannose and a smaller amount of {alpha}-1,3-linked mannose. Based on the substrate specificity of Mnn1 and the results of {alpha}-, {alpha}-1,2-, {alpha}-1,6-, and {alpha}-1-2,3-mannosidase digestions, it was predicted that PA-mannotetraose contained two kinds of structures (Man{alpha}1,3Man{alpha}1,2Man{alpha}1, 2Man-PA and Man{alpha}1,3Man{alpha}1,3Man{alpha}1,2Man-PA). These results showed that O-linked oligosaccharides synthesized in vivo were also synthesized on the yeast cell surface. Our system may be useful for the enzymatic synthesis of many kinds of oligosaccharides in combination with several yeast cells displaying various glycosyltransferases.

Murai et al. (1999)Go reported that the yeast cells in which two amylolytic enzymes, glucoamylase and {alpha}-amylase, were immobilized at the cell surface catalyzed a sequential starch degradation. Although only {alpha}-agglutinin was used as an anchor to display these proteins at the cell surface in their system, the simultaneous usage of Pir1 and Pir2 in our system will provide a more effective utilization of the limited cell wall space.

It has been reported that Pir proteins are incorporated into the cell wall through an O-glycosidic linkage because they can be liberated from the cell wall by mild alkali (Mrsa et al., 1997Go; Kapteyn et al., 1999Go). However, because a direct linkage between O-linked sugar chains and cell wall components was not elucidated, the precise incorporation mechanism of Pir is still unclear. Our data suggest that the Pir domain that interacts with cell wall components was not involved in the C-terminus of Pir1 and Pir2, because Pir1 and Pir2 did not lose the ability to anchor to the cell wall, even when the target protein was fused to their C-terminal regions. To achieve a more effective localization of target proteins at the yeast cell surface, further study of the retention mechanism by which Pir proteins are anchored to the cell wall will be necessary.

Recently, it has been reported that Pir1 mediates a translocation of Apn1 endonuclease from the nucleus into the mitochondria to maintain genomic stability (Vongsamphanh et al., 2001Go), although the relationship between the Pir1 function and its cell wall localization remains to be elucidated. It has also been shown that a lack of Pir proteins causes the cell's sensitivity to heat stress (Toh-e et al., 1993Go) and tobacco osmotin (Yun et al., 1997Go). However, the precise role of Pir proteins in the cell wall assembly is still unclear (Mrsa and Tanner, 1999Go).

Finally, our system provides an attractive option to overcome a conventional biocatalyst in which a target protein cannot be modified at the C-terminus due to some interference in its catalytic activity, enabling a multistep bioconversion of various substrates to the desired products over a long reaction period.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Yeast strains, media, and genetic methods
We used S. cerevisiae strains W303-1A (MATa leu2-3, 112 his3-11 ade2-1 ura3-1 trp1-1 can1-100) (Thomas and Rothstein, 1989Go) and SSY18 (MATa leu2-3,112 his3-11 ade2-1 ura3-1 trp1-1 can1-100 kre2::hisG ktr1::hisG ktr3::hisG) (kindly provided by S. Sugioka) as hosts. YPD and SD media (Sherman, 1991Go) were used to cultivate yeast cells and to select yeast recombinant transformants, respectively. SD medium was maintained at pH 6.0 by the addition of 1 M KH2PO4 and K2HPO4 phosphate buffer (pH 6.0). Yeast transformation was carried out by the lithium-acetate method (Klebe et al., 1983Go).

Construction of the expression plasmid
The plasmid pAB4 was constructed as follows. The HA-gma12+ fusion gene derived from pYD1-HA-gma12+ (constructed by Takayama in our laboratory) was provided with the NotI and SmaI restriction sites at the 5'- and 3'-ends of the fusion gene, respectively, by polymerase chain reaction (PCR) using the oligonucleotides 5'-GGGGGGCGGCCGC (NotI) ATACCCATACGATGTTCCTGAC-3' and 5'-GGGCCCGGG (SmaI) CTAGGATGGTTTCAAAAGATTTTGAATATGATCC-3'. The amplified DNA fragment was digested with NotI and SmaI, and the product was inserted into the corresponding sites in the pBSIISK(–) (Stratagene, La Jolla, CA) (pAB2). The PIR1 gene was provided with the SacI and NotI sites at the 5'- and 3'-ends, respectively, by PCR using the oligonucleotides 5'-GGGGGGAGCTC (SacI) ATGCAATACAAAAAATCATTAGTTGCCTCCGCC-3' and 5'-CCCCCGCGGC-CGC (NotI) ACAGTGCAATCGATAGC-3'. The amplified DNA fragment was digested with SacI and NotI, and the product was inserted into the corresponding sites in pBSIISK(–) (pAB1). A PIR1 gene inserted into pAB1 plasmid was cleaved with SacI and NotI, then inserted into a SacI and NotI site of pAB2, thereby constructing pAB3. A PIRI-HA-gma12+ portion of the pAB3 was digested with SacI-SmaI. The product was then inserted into a SacI-SmaI site of expression vector YEp352GAP-II (provided by Nakayama in our laboratory) (pAB4).

pAB30 was constructed as follows. The KRE2 gene containing the SalI and XhoI sites at both ends of the KRE2 gene was prepared by PCR using the oligonucleotides 5'-GGGGGGTCGAC (SalI) AGCAATATATTCCGAG-TTCCATCTCCGA-3' and 5'-GGGGGCTCGAG (XhoI) CTACTCACGGAATTTTTTCCAGTTTTTTGGC-3'. The amplified DNA fragment was digested with SalI and XhoI, and the product was inserted into the corresponding sites in pBSIISK(–) (pAB25). The KRE2 gene inserted into pAB25 was digested with SalI-XhoI and then inserted into a SalI-XhoI site of pAB3, thereby constructing pAB27. A PIRI-HA-KRE2 portion of the pAB27 was digested with SacI-XhoI and was blunt-ended with Blunting high (Toyobo, Osaka, Japan). The product was then inserted into a SmaI site of expression vector YEp352GAP-II (pAB30).

pAB31 was constructed as follows. The FLAG-tagged PIR2 gene was prepared by PCR using the oligonucleotides containing the FLAG sequence and restriction sites, 5'-GGGGGGAGCTC (SacI) ATGCAATACAAAAAGACTTTGGTTGCC-3' and 5'-CCCCCGCGGCCGC (NotI) CTTGTCATCGTCATCCTTGTAGTC (FLAG sequence) ACAGTCTATCAAATCGATAGCTTCCAA-GTGG-3'. The amplified DNA fragment was digested with SacI and NotI, and the product was inserted into the corresponding sites in pBSIISK(–) (pAB22). The MNN1 gene containing NotI and SmaI sites at both ends was prepared by PCR using the oligonucleotides 5'-GGGGGGCGGCCGC (NotI) AAATGATGCGCTTATACGAT-CAAGCAATGTAAACAG-3' and 5'-GGGGGCCCGGG (SmaI) CTAGCTTTGTTCGTGTCTAGCCTTTTC-3'. The amplified DNA fragment was digested with NotI and SmaI, and the product was inserted into the corresponding sites in pBSIISK(–) (pAB26). A MNN1 gene inserted into pAB26 was digested with NotI-SmaI and then inserted into a NotI-SmaI site of pAB22, thereby constructing pAB28. A PIR2-FLAG-MNN1 portion of the pAB28 was digested with SacI-SmaI. The product was then inserted into a SacI-SmaI site of expression vector YEp352GAP-II (pAB29). To construct a plasmid having a leucine marker, a BglI fragment containing a promoter region, a PIR2-FLAG-MNN1 fusion, and a terminator region of pAB29 was inserted into a BglI site of YEp351 (Hill et al., 1986Go), thereby constructing pAB31.

Gal-T assay using 3H-labeled nucleotide sugar as a donor
The standard transferase assays were carried out according to Chappell and Warren (1989)Go and Yoko-o et al. (1998)Go. A 50-µl aliquot of samples containing intact cells, cell walls, and total cell lysates (OD600=1) was suspended in 10 µl of 100 mM HEPES/NaOH (pH 7.0), 100 mM HEPES/NaOH (pH 7.0), 1 mM MnCl2, 125 nmol UDP-[3H]galactose (specific activity 7.5 nCi/nmol, after dilution of commercially available UDP-[3H]galactose with unlabeled UDP-galactose), and 10 µmol of a methyl-D-mannoside and was incubated at 30°C for 2 h. The reaction was terminated by adding 200 µl ice-cold water, and the mixture was loaded onto a Dowex-1 (Cl- form, 200–400 dry mesh) anion exchange column packed in SEPACOL-MINI (Seikagaku, Tokyo, Japan). The column was washed twice with 1.0 ml water, and the combined eluents were mixed with 10 ml scintillation cocktail.

Glycosyltransferase assay using PA-labeled oligosaccharides as an acceptor
Gal-T activity was measured according to Yoko-o et al. (1998)Go with some modifications. A 50-µl aliquot of samples containing cell walls (OD600=10) that were suspended in 35 µl of 100 mM HEPES/NaOH (pH 7.2), 100 mM HEPES/NaOH (pH 7.2), 1 mM MnCl2, 5 mM UDP-galactose, and 325 pmol Man2-PA acceptor was incubated at 37°C for 8 h. Mannosyltransferase activities were measured essentially as described by Nakajima and Ballou (1975)Go and Lussier et al. (1996)Go with some modifications. A 50-µl aliquot of samples containing cell walls (OD600=10) that were suspended in 35 µl of 100 mM HEPES/NaOH (pH 7.2), 1 mM MnCl2, 5 mM GDP-mannose, and 325 pmol Man2-PA acceptor and incubated at 37°C for 8 h.

The reaction was terminated by adding 100 µl ice-cold water, and the reaction mixture was centrifuged at 1000xg for 5 min. The supernatant was filtered through an Ultrafree-MC membrane (10 K cut) (Millipore, Bedford, MA). A 5-µl aliquot of the filtrate was subjected to HPLC analysis.

HPLC analysis
PA-labeled oligosaccharide products were analyzed by TSKgel Amide-80 (4.6 mmx250 mm) (Tosoh, Tokyo, Japan) at a flow rate of 1.0 ml/min with solvent A (90% acetonitrile and 10% 200 mM acetic acid/triethylamine, pH 7.2) and solvent B (40% acetonitrile and 60% 200 mM acetic acid/triethylamine, pH 7.2). After sample injection, the proportion of solvent B was increased linearly for 60 min to 100%. The glycan structures were confirmed by the comparison of retention times with PA-labeled standard samples after mannosidase digestion (Nakayama et al., 1998Go).

Indirect immunofluorescence
Cells were cultivated for 2 days at 30°C, and a volume of cells equivalent to 1 OD600 unit was collected. Cells were suspended in 250 µl phosphate buffered saline (PBS) buffer (10 mM KH2PO4, 40 mM K2HPO4, 150 mM NaCl) with bovine serum albumin (BSA) (1 mg/ml) and primary antibody and incubated at 4°C for 30 min. The cells were then washed twice in PBS and were incubated in PBS buffer with BSA (1 mg/ml) and the second antibody at 0°C for 30 min. After washing, the images of cells were observed under a model BX50 (Olympus, Tokyo, Japan) fluorescence microscope. The Pir1-HA-Gma12 and Pir1-HA-Kre2 fusions were visualized by immunofluorescence microscopy using rat anti-HA antibody 3F10 (Boehringer Mannheim, Mannheim, Germany) and Alexa 488-conjugated goat anti-rat IgG (Molecular Probes, Eugene, OR) (dilution rate 1:125). The Pir2-FLAG-Mnn1 fusion was visualized by immunofluorescence microscopy using mouse anti-FLAG M2 monoclonal antibody (Sigma, St. Louis, MO) (dilution rate 1:50) and Alexa 488-conjugated goat anti-mouse IgG (Molecular Probes, Eugene, OR) (dilution rate 1:125).

Isolation of total proteins, cell wall fractions, and Pir fusion proteins
These proteins were isolated from cells cultured for 2 days at 30°C. The cells were washed three times in ice-cold wash buffer (10 mM Tris–HCl [pH 8.0], 1 mM phenylmethylsulfonyl fluoride, protease inhibitor complete, ethylenediamine tetra-acetic acid–free [Roche, Basel, Switzerland]) and were broken by vigorously mixing the cell suspension with glass beads (diameter, 0.45–5.0 mm). The cell lysates were used as total protein samples.

The cell wall fractions were isolated according to Schreuder et al. (1993)Go with some modifications. The cell wall fractions were prepared by centrifugation of the cell lysates described at 1000xg for 5 min. The cell walls were washed three times with ice-cold wash buffer and then were resuspended in an appropriate buffer for each reaction after the supernatant was removed.

Fusion proteins of Pir with the target protein were isolated according to Mrsa et al. (1997)Go with slight modifications. The cell wall described was extracted by heating the cells twice with 100 µl of the lysis buffer described by Masai et al. (1995)Go at 95°C for 10 min. The remaining cell wall fractions were washed three times with 1 ml 0.1 M Na-acetate buffer (pH 5.5). The fusion proteins were isolated by extracting the remaining cell walls with 30 mM NaOH overnight at 4°C.

Western analysis
Yeast protein samples were analyzed by western blotting according to Laemmli (1970)Go. Proteins were separated by SDS–PAGE in a 5–20% gradient gel (Atto, Tokyo, Japan) and then transferred to polyvinylidene difluoride membrane (Pall, East Hills, NJ). Pir1-HA-Gma12, Pir1-HA-Kre2, and Pir1-FLAG-Mnn1 were detected with the anti-HA monoclonal antibody HA.11 (Babco, Richmond, CA) and anti-FLAG M2 monoclonal antibody (Sigma, St. Louis, MO). Immunoreactive bands were visualized by staining with horseradish-conjugated goat anti-mouse IgG (Cell Signaling Technology, Beverly, MA) and chemiluminescence (NEN Life Science, Boston, MA).

{alpha}-Mannosidase treatments
The oligosaccharides were incubated with the following enzymes: Aspergillus saitoi {alpha}-1,2-mannosidase or jackbean {alpha}-mannosidase. The reaction mixture of 30 µl (5 mU {alpha}-1, 2-mannosidase in 20 mM sodium acetate buffer [pH 5.0] or 50 mU of jackbean {alpha}-mannosidase in 50 mM sodium acetate buffer [pH 5.0]) was incubated for 2 days at 37°C. Eight units of recombinant Xanthomonas manihotis {alpha}-1,6-mannosidase produced in E. coli (NEB) and 30 U of recombinant X. manihotis {alpha}-1-2,3-mannosidase produced in E. coli (NEB) were used according to the manufacturer.


    Acknowledgements
 
We are grateful to Samir Kumar Roy for technical advice on the Gal-T assay using 3H-labeled nucleotide sugar as a donor, to Shigemi Sugioka for providing us the yeast strain SSY18, and to Kenichi Nakayama and Yasunori Chiba for their advice on this manuscript. This work was supported in part by a grant-in-aid for the Research and Development Project of Basic Technologies for Future Industries, Ministry of Economy, Trade and Industry, Japan, and by a New Energy and Industrial Technology Development Organization postdoctoral fellowship (to H.A.).


    Footnotes

1 To whom correspondence should be addressed; e-mail: jigami.yoshi{at}aist.go.jp Back


    Abbreviations
 
BSA, bovine serum albumin; Gal-T, galactosyltransferase; GAPDH, glyceraldehyde phosphate-3-dehydrogenase; GPI, glycosylphosphatidylinositol; HPLC, high-performance liquid chromatography; PA, pyridylamine; PBS, phosphate buffered saline; PCR, polymerase chain reaction; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis.


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Ballou, C.E. (1990) Isolation, characterization and properties of Saccharomyces cerevisiae mnn mutant with nonconditional protein glycosylation defects. Methods Enzymol., 185, 440–472.[Medline]

Borsig, L., Ivanov, S.X., Herrmann, G.F., Kragl, U., Wandrey, C., and Berger, E.G. (1995) Scaled-up expression of human alpha 2, 6(N)sialyltransferase in Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun., 210, 14–20.[CrossRef][Web of Science][Medline]

Chappell, T.G. and Warren, G. (1989) A galactosyltransferase from the fission yeast Schizosaccharomyces pombe. J. Cell Biol., 109, 2693–2702.[Abstract/Free Full Text]

Chappell, T.G., Hajibagheri, M.A., Ayscough, K., Pierce, M., and Warren, G. (1994) Localization of an {alpha} 1, 2 galactosyltransferase activity to the Golgi apparatus of Schizosaccharomyces pombe. Mol. Biol. Cell, 5, 519–552.[Abstract]

Endo, T. and Koizumi, S. (2000) Large-scale production of oligosaccharides using engineered bacteria. Curr. Opin. Struct. Biol., 10, 536–541.[CrossRef][Web of Science][Medline]

Endo, T., Koizumi, S., Tabata, K., and Ozaki, A. (2000) Large-scale production of CMP-NeuAc and sialylated oligosaccharides through bacterial coupling. Appl. Microbiol. Biotechnol., 53, 257–261.[CrossRef][Web of Science][Medline]

Flowers, H. (1978) Chemical synthesis of oligosaccharides. Methods Enzymol., 50, 93–121.[Medline]

Gallet, P.F., Vaujour, H., Petit, J.M., Maftah, A., Oulmouden, A., Oriol, R., Le Narvor, C., Guilloton, M., and Julien, R. (1998) Heterologous expression of an engineered truncated form of human Lewis fucosyltransferase (Fuc-TIII) by the methylotrophic yeast Pichia pastoris. Glycobiology, 8, 919–925.[Abstract/Free Full Text]

Gemmill, T.R. and Trimble, R.B. (1999) Overview of N- and O-linked oligosaccharide structures found in various yeast species. Biochim. Biophys. Acta, 1426, 227–237.[Medline]

Graham, T.R., Seeger, M., Payne, G.S., Mackay, V.L., and Emr, S.D. (1994) Clathrin-dependent localization of {alpha}-1, 3-mannosyltransferase to the Golgi complex of Saccharomyces cerevisiae. J. Cell. Biol., 127, 667--678.

Häusler, A. and Robbins, P.W. (1992) Glycosylation in Saccharomyces cerevisiae: cloning and characterization of an {alpha}-1, 2-mannosyltransferase structural gene. Glycobiology, 2, 77–84.[Abstract/Free Full Text]

Häusler, A., Ballou, L., Ballou, C.E., and Robbins, P.W. (1992) Yeast glycoprotein biosynthesis: MNT1 encodes an {alpha}-1, 2-mannosyltransferase involved in O-glycosylation. Proc. Natl Acad. Sci. USA, 89, 6846–6850.[Abstract/Free Full Text]

Herrmann, G.F., Lothar, E., Krezdorn, C.H., Ralf, K., Berger, E.G., and Christian, W. (1995) Use of transformed whole yeast cells expressing ß-1, 4-galactosyltransferase for the synthesis of N-acetyllactosamine. Bioorg. Med. Chem. Lett., 5, 673–676.

Hill, J.E., Myers, A.M., Koerner, T.J., and Tzagoloff, A. (1986) Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast, 2, 163–167.[CrossRef][Web of Science][Medline]

Ichikawa, Y., Look, G., and Wong, C.-H. (1992) Enzyme-catalyzed oligosaccharide synthesis. Anal. Biochem., 202, 215–238.[CrossRef][Web of Science][Medline]

Jämsä, E., Holkeri, H., Vihinen, H., Wikström, M., Simonen, M., Walse, B., Kalkkinen, N., Paakkola, N., and Makarow, M. (1995) Structural features of a polypeptide carrier promoting secretion of a ß-lactamase fusion protein in yeast. Yeast, 11, 1381–1391.[CrossRef][Web of Science][Medline]

Kapteyn, J.C., Van Egmond, P., Sievi, E., Van Den Ende, H., Makarow, M., and Klis, F.M. (1999) The contribution of the O-glycosylated protein Pir2p/Hsp150 to the construction of the yeast cell wall in wild-type cells and ß1,6-glucan-deficient mutants. Mol. Microbiol., 31, 1835–1844.[CrossRef][Web of Science][Medline]

Klebe, R.J., Harriss, J.V., Sharp, Z.D., and Douglas, M.G. (1983) A general method for polyethylene-glycol-induced genetic transformation of bacteria and yeast. Gene, 25, 333–341.[CrossRef][Web of Science][Medline]

Koizumi, S., Endo, T., Tabata, K., and Ozaki, A. (1998) Large-scale production of UDP-galactose and globotriose by coupling metabolically engineered bacteria. Nature Biotechnol., 16, 847–850.[CrossRef][Web of Science][Medline]

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685.[CrossRef][Medline]

Lipke, P.N. and Kurjan, J. (1992) Sexual agglutination in budding yeasts: structure, function, and regulation of adhesion glycoproteins. Microbiol. Rev., 56, 180–194.[Abstract/Free Full Text]

Lipke, P.N., Wojciechowicz, D., and Kurjan, J. (1989) AGa1 is the structural gene for the Saccharomyces cerevisiae {alpha}-agglutinin, a cell surface glycoprotein involved in cell–cell interactions during mating. Mol. Cell. Biol., 9, 3155–3165.[Abstract/Free Full Text]

Lubineau, A., Narvor, C., Augé, C., Gallet, P., Petit, J., and Julien, R. (1998) Chemoenzymatic synthesis of a selectin ligand using recombinant yeast cells. J. Mol. Catal., 5, 229–234.[CrossRef]

Lussier, M., Sdicu, A.M., Camirand, A., and Bussey, H. (1996) Functional characterization of the YUR1, KTR1, and KTR2 genes as members of the yeast KRE2/MNT1 mannosyltransferase gene family. J. Biol. Chem., 271, 11001–11008.[Abstract/Free Full Text]

Malissard, M., Zeng, S., and Berger, E.G. (1999) The yeast expression system for recombinant glycosyltransferases. Glycoconj. J., 16, 125–139.[CrossRef][Web of Science][Medline]

Malissard, M., Zeng, S., and Berger, E.G. (2000) Expression of functional soluble forms of human ß-1, 4-galactosyltransferase I, {alpha}-2,6-sialyltransferase, and {alpha}-1,3-fucosyltransferase VI in the methylotrophic yeast Pichia pastoris. Biochem. Biophys. Res. Commun., 267, 169–173.[CrossRef][Web of Science][Medline]

Mattila, P., Joutsjoki, V., Kaitera, E., Majuri, M. L., Niittymäki, J., Saris, N., Maaheimo, H., Renkonen, O., Renkonen, R., and Makarow, M. (1996) Targeting of active rat {alpha}-2, 3-sialyltransferase to the yeast cell wall by the aid of the hsp150{Delta}-carrier: toward synthesis of sLex-decorated L-selectin ligands. Glycobiology, 6, 851–859.[Abstract/Free Full Text]

Masai, H., Miyake, T., and Arai, K. (1995) hsk1+, a Schizosaccharomyces pombe gene related to Saccharomyces cerevisiae CDC7, is required for chromosomal replication. EMBO J., 14, 3094–3104.[Web of Science][Medline]

Moukadiri, I., Jaafar, L., and Zueco, J. (1999) Identification of two mannoproteins released from cell walls of a Saccharomyces cerevisiae mnn1 mnn9 double mutant by reducing agents. J. Bacteriol., 181, 4741–4745.[Abstract/Free Full Text]

Mrsa, V. and Tanner, W. (1999) Role of NaOH-extractable cell wall proteins Ccw5p, Ccw6p, Ccw7p and Ccw8p (members of the Pir protein family) in stability of the Saccharomyces cerevisiae cell wall. Yeast, 15, 813–820.[CrossRef][Web of Science][Medline]

Mrsa, V., Seidl, T., Gentzsch, M., and Tanner, W. (1997) Specific labelling of cell wall proteins by biotinylation. Identification of four covalently linked O-mannosylated proteins of Saccharomyces cerevisiae. Yeast, 13, 1145–1154.[CrossRef][Web of Science][Medline]

Murai, T., Ueda, M., Yamamura, M., Atomi, H., Shibasaki, Y., Kamasawa, N., Osumi, M., Amachi, T., and Tanaka, A. (1997) Construction of a starch-utilizing yeast by cell surface engineering. Appl. Environ. Microbiol., 63, 1362–1366.[Abstract/Free Full Text]

Murai, T., Ueda, M., Shibasaki, Y., Kamasawa, N., Osumi, M., Imanaka, T., and Tanaka, A. (1999) Development of an arming yeast strain for efficient utilization of starch by co-display of sequential amylolytic enzymes on the cell surface. Appl. Microbiol. Biotechnol., 51, 65–70.[CrossRef][Web of Science][Medline]

Nakajima, T. and Ballou, C.E. (1975) Yeast manno-protein biosynthesis: solubilization and selective assay of four mannosyltransferases. Proc. Natl Acad. Sci. USA, 72, 3912–3916.[Abstract/Free Full Text]

Nakamura, Y., Shibasaki, S., Ueda, M., Tanaka, A., Fukuda, H., and Kondo, A. (2001) Development of novel whole-cell immunoadsorbents by yeast surface display of the IgG-binding domain. Appl. Microbiol. Biotechnol., 57, 500–505.[CrossRef][Web of Science][Medline]

Nakayama, K., Feng, Y., Tanaka, A., and Jigami, Y. (1998) The involvement of mnn4 and mnn6 mutations in mannosylphosphorylation of O-linked oligosaccharide in yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta, 1425, 255–262.[Medline]

Romero, P. A., Lussier, M., Veronneau, S., Sdicu, A. M., Herscovics, A., and Bussey, H. (1999) Mnt2p and Mnt3p of Saccharomyces cerevisiae are members of the Mnn1p family of {alpha}-1, 3-mannosyltransferase responsible for adding the terminal mannose residues of O-linked oligosaccharides. Glycobiology, 9, 1045–1051.[Abstract/Free Full Text]

Roy, S.K., Yoko-o, T., Ikenaga, H., and Jigami, Y. (1998) Functional evidence for UDP-galactose transporter in Saccharomyces cerevisiae through the in vivo galactosylation and in vitro transport assay. J. Biol. Chem., 273, 2583–2590.[Abstract/Free Full Text]

Schreuder, M.P., Brekelmans, S., van den Ende, H., and Klis, F.M. (1993) Targeting of a heterologous protein to the cell wall of Saccharomyces cerevisiae. Yeast, 9, 399–409.[CrossRef][Web of Science][Medline]

Schreuder, M.P., Mooren, A.T., Toschka, H.Y., Verrips, C.T., and Klis, F.M. (1996) Immobilizing proteins on the surface of yeast cells. Trends Biotechnol., 14, 115–120.[CrossRef][Web of Science][Medline]

Sherman, F. (1991) Getting started with yeast. Methods Enzymol., 194, 3–21.[CrossRef][Web of Science][Medline]

Shibasaki, S., Ueda, M., Iizuka, T., Hirayama, M., Ikeda, Y., Kamasawa, N., Osumi, M., and Tanaka, A. (2001) Quantitative evaluation of the enhanced green fluorescent protein displayed on the cell surface of Saccharomyces cerevisiae by fluorometric and confocal laser scanning microscopic analyses. Appl. Microbiol. Biotechnol., 55, 471–475.[CrossRef][Web of Science][Medline]

Sievi, E., Helin, J., Heikinheimo, R., and Makarow, M. (1998) Glycan engineering of proteins with whole living yeast cells expressing rat liver {alpha}-2,3-sialytransferase in the porous cell wall. FEBS Lett., 441, 177–180.[CrossRef][Web of Science][Medline]

Simonen, M., Jämsä, E., and Makarow, M. (1994) The role of the carrier protein and disulfide formation in the folding of ß-lactamase fusion proteins in the endoplasmic reticulum of yeast. J. Biol. Chem., 269, 13887–13892.[Abstract/Free Full Text]

Simonen, M., Vihinen, H., Jämsä, E., Arumäe, U., Kalkkinen, N., and Makarow, M. (1996) The hsp150{Delta}-carrier confers secretion competence to the rat nerve growth factor receptor ectodomain in Saccharomyces serevisiae. Yeast, 12, 457–466.[CrossRef][Web of Science][Medline]

Thomas, B.J. and Rothstein, R. (1989) Elevated recombination rates in transcriptionally active DNA. Cell, 56, 619–630.[CrossRef][Web of Science][Medline]

Toh-e, A., Yasunaga, S., Nisogi, H., Tanaka, K., Oguchi, T., and Matsui, Y. (1993) Three yeast genes, PIR1, PIR2 and PIR3, containing internal tandem repeats, are related to each other, and PIR1 and PIR2 are required for tolerance to heat shock. Yeast, 9, 481–494.[CrossRef][Web of Science][Medline]

Varki, A. (1993) Biological roles of oligosaccharides: all of the theories are correct. Glycobiology, 3, 97–130.[Abstract/Free Full Text]

Vongsamphanh, R., Fortier, P.K., and Ramotar, D. (2001) Pir1p mediates translocation of the yeast Apn1p endonuclease into the mitochondria to maintain genomic stability. Mol. Cell. Biol., 21, 1647–1655.[Abstract/Free Full Text]

Wojciechowicz, D., Lu, C.F., Kurjan, J., and Lipke, P.N. (1993) Cell surface anchorage and ligand-binding domains of the Saccharomyces cerevisiae cell adhesion protein {alpha}-agglutinin, a member of the immunoglobulin superfamily. Mol. Cell. Biol., 13, 2554–2563.[Abstract/Free Full Text]

Yip, C.L., Welch, S.K., Klebl, F., Gilbert, T., Seidel, P., Grant, F.J., O'Hara, P.J., and MacKay, V.L. (1994) Cloning and analysis of the Saccharomyces cerevisiae MNN9 and MNN1 genes required for complex glycosylation of secreted proteins. Proc. Natl Acad. Sci. USA, 91, 2723–2727.[Abstract/Free Full Text]

Yoko-o, T., Roy, S.K., and Jigami, Y. (1998) Differences in in vivo acceptor specificity of two galactosyltransferases, the gmh3+ and gma12+ gene products from Schizosaccharomyces pombe. Eur. J. Biochem., 257, 630–637.[Web of Science][Medline]

Yun, D.J., Zhao, Y., Pardo, J.M., Narasimhan, M.L., Damsz, B., Lee, H., Abad, L.R., D'Urzo, M.P., Hasegawa, P.M., and Bressan, R.A. (1997) Stress proteins on the yeast cell surface determine resistance to osmotin, a plant antifungal protein. Proc. Natl Acad. Sci. USA, 94, 7082–7087.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
H. Abe, Y. Takaoka, Y. Chiba, N. Sato, S. Ohgiya, A. Itadani, M. Hirashima, C. Shimoda, Y. Jigami, and K.-i. Nakayama
Development of valuable yeast strains using a novel mutagenesis technique for the effective production of therapeutic glycoproteins
Glycobiology, April 1, 2009; 19(4): 428 - 436.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Umemura, M. Fujita, T. Yoko-o, A. Fukamizu, and Y. Jigami
Saccharomyces cerevisiae CWH43 Is Involved in the Remodeling of the Lipid Moiety of GPI Anchors to Ceramides
Mol. Biol. Cell, November 1, 2007; 18(11): 4304 - 4316.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Fujita, M. Umemura, T. Yoko-o, and Y. Jigami
PER1 Is Required for GPI-Phospholipase A2 Activity and Involved in Lipid Remodeling of GPI-anchored Proteins
Mol. Biol. Cell, December 1, 2006; 17(12): 5253 - 5264.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
Y.-i. Shimma, F. Saito, F. Oosawa, and Y. Jigami
Construction of a Library of Human Glycosyltransferases Immobilized in the Cell Wall of Saccharomyces cerevisiae
Appl. Envir. Microbiol., November 1, 2006; 72(11): 7003 - 7012.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Fujita, T. Yoko-o, and Y. Jigami
Inositol Deacylation by Bst1p Is Required for the Quality Control of Glycosylphosphatidylinositol-anchored Proteins
Mol. Biol. Cell, February 1, 2006; 17(2): 834 - 850.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
T. Sumita, T. Yoko-o, Y.-i. Shimma, and Y. Jigami
Comparison of Cell Wall Localization among Pir Family Proteins and Functional Dissection of the Region Required for Cell Wall Binding and Bud Scar Recruitment of Pir1p
Eukaryot. Cell, November 1, 2005; 4(11): 1872 - 1881.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fujita, T. Yoko-o, M. Okamoto, and Y. Jigami
GPI7 Involved in Glycosylphosphatidylinositol Biosynthesis Is Essential for Yeast Cell Separation
J. Biol. Chem., December 10, 2004; 279(50): 51869 - 51879.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/2/87    most recent
cwg014v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Abe, H.
Right arrow Articles by Jigami, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abe, H.
Right arrow Articles by Jigami, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?