Skip Navigation


Glycobiology Advance Access originally published online on June 10, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/12/919    most recent
cwg087v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Turcot, A. L.
Right arrow Articles by Le Pendu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Turcot, A. L.
Right arrow Articles by Le Pendu, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 12 919-928
© 2003 Oxford University Press

Cloning of a rat gene encoding the histo-blood group B enzyme: rats have more than one Abo gene

Anne Laure Turcot2, Antoine Blancher3, Béatrice Le Moullac-Vaidye2, Stéphanie Despiau3, Jézabel Rocher2, Francis Roubinet3,4, Claude Szpirer5 and Jacques Le Pendu1,2

2 INSERM U419, Institut de Biologie, 9 Quai Moncousu, 44093, Nantes Cedex, France; 3 Laboratoire d'Immunogénétique Moléculaire, Université Paul Sabatier, Faculté de Médecine, Bâtiment A2, 133 Route de Narbonne, 31062, Toulouse, Cedex 4, France; 4 Laboratoire d'Immunohématologie, Etablissement Français du Sang Pyrénées-Méditerranée, Avenue de Grande Bretagne, BP 3210, 31027, Toulouse, Cedex 3, France; and 5 Université Libre de Bruxelles, IBMM, B-6041 Gosselies, Belgium

Received on April 11, 2003; revised on May 23, 2003; accepted on May 23, 2003


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
A genomic DNA fragment corresponding to exon 7 of the human ABO gene was amplified from rats of several inbred and outbred strains. Five different sequences were obtained, four of them corresponding to A-type sequences and one to a B-type sequence based on the amino acids equivalent to residues at positions 266 and 268 of the human enzymes. In rats from inbred strains, a single A-type sequence and the unique B-type sequence were found, whereas some animals of outbred strains presented two or three A-type sequences along with the B-type sequence. The complete coding sequence of the B-type gene was obtained; identification of the exon–intron boundaries, determined by comparison with rat genomic sequences from data banks, revealed that the rat B-type gene structure is identical with that of the mouse Abo gene. Compared with the human ABO gene and the rat A gene, it lacks exon 4. Like the rat A gene (symbol: Abo), the rat B gene (symbol: Abo2) is located on chromosome 3q11–q12. It could be shown by transfection experiments that the B-type cDNA encodes an active B transferase. A transcript of the B gene was found ubiquitously, whereas the B antigen was only detected in a restricted set of tissues. These data indicate that rats have at least two distinct Abo genes, one monomorphic gene encoding a B-specific enzyme and one or more genes in some cases encoding an A-specific enzyme.

Key words: ABO / antigen / galactosaminyltransferase / histo-blood group / rat


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
ABO blood group antigens were discovered by Karl Landsteiner over a century ago on human red cells. Since then, they have been evidenced on many other cell types and have been found to be secreted in biological fluids of humans as well as of many animal species (Watkins, 1999Go). Yet their expression at the surface of erythrocytes is restricted to humans and a few anthropoid apes (Blancher and Socha, 1997Go). The ABO and related antigens are carbohydrates that correspond to terminal structures of glycan chains of glycolipids and glycoproteins on cell surfaces and are also found as free oligosaccharides in some biological fluids, such as milk. In group A individuals the A enzyme adds an N-acetylgalactosamine on the H antigen to form the A antigen GalNAc{alpha}1,3[Fuc{alpha}1,2]Gal, whereas in B individuals a galactose is added by the B enzyme to give the B antigen Gal{alpha}1,3[Fuc{alpha}1,2]Gal. In humans, the A and B enzymes are encoded by different alleles at the single ABO locus. A third type of human ABO alleles, called O, is silent. Homozygous O individuals are of blood group O and display H presursor structures unmodified by A or B glycosyltransferase (Clausen and Hakomori, 1989Go).

The molecular genetic basis of the human ABO alleles has been elucidated. Although many mutations have been described to date, only some of these are functionally relevant (Olsson and Chester, 2001Go). Numerous silent O alleles have been evidenced (Kermarrec et al., 1999Go; Roubinet et al., 2001Go), other functional alleles coding for variants of A and B enzymes. The A and B alleles encode for very similar proteins, and functional analyses determined that the amino acids at positions 266 and 268 are critical in determining the enzyme donor substrate specificity, UDP-GalNAc versus UDP-Gal for the A and B enzymes, respectively. A enzymes are characterized by a leucine and a glycine at positions 266 and 268, respectively, whereas B enzymes have a methionine and an alanine, respectively, at these positions (Yamamoto, 2000Go). A recent analysis of the crystal structures and a modeling study of these enzymes showed that these two residues are positioned in the active site and contact the nucleotide-sugar donor; their relative size explains how the B enzyme accomodates UDP-Gal and how the A enzyme forms complementary interactions with UDP-GalNAc (Heissigerova et al., 2003Go; Patenaude et al., 2002Go).

The study of the molecular basis of A and B antigens expression in mammals other than humans could provide insights into the evolution of the ABO system and help decipher its biological meaning. The erythrocyte expression of ABO antigens is not constant in mammalian species. Among primates, erythrocyte expression is limited to humans and apes (chimpanzee, gorilla, orangutan, and gibbon). In other mammals, some pigs express A on erythrocytes due to passive absorption of A glycolipids in the red blood cell membrane. Contrary to the irregular expression of ABH antigen at the surface of red cells, tissue expression of ABH antigens has been evidenced in all mammalian species studied so far. The constant and main site of expression of ABO antigens appears to be the mucosae of the gut as well as of the upper respiratory and lower genitourinary tracts (Oriol et al., 1992Go). Because of this expression on tissues in contact with the external environment, it has been speculated that these polymorphic antigens could play a role in relationship with pathogens. In this line, many associations between the ABO phenotype and infectious diseases have been described; in some selected cases it has been possible to demonstrate a modulation of the adhesion ability of bacteria strains by the A or B antigens, suggesting that their host range is influenced by the ABO blood group phenotype (Black et al., 1987Go; Boren et al., 1993Go; Geisel et al., 1995Go; Glass et al., 1985Go; Lindstedt et al., 1991Go; Steuer et al., 1995Go; Swerdlow et al., 1994Go). Collectively these observations indicate that the ABO polymorphism could provide a mechanism of protection against pathogens at the level of the population and that there could exist a selective pressure to maintain diversity at the ABO locus (Marionneau et al., 2001Go).

In all primate species studied so far, a single polymorphic ABO locus has been found, and sequence analysis revealed at least three independent appearances of B alleles from ancestral A alleles (Doxiadis et al., 1998Go; Kominato et al., 1992Go; Martinko et al., 1993Go). In rats, genetic polymorphisms have been described with inbred strains expressing the A antigen throughout the intestine, other strains showing expression restricted to the large intestine, and yet other strains lacking A antigen expression in the gut (Bouhours et al., 1995Go; Breimer et al., 1980Go). In this species the B antigen can also be synthesized because it has been characterized on glycolipids (Hansson et al., 1987Go). Recently, we reported the sequence of a gene encoding an A transferase from BDIX rats, and Hansson and colleagues found two rat A sequences in Sprague-Dawley rats (Cailleau-Thomas et al., 2002Go; Olson et al., 2002Go). One of these was identical with the BDIX rat sequence, the other was 95% identical, and evidence was obtained suggesting that these two sequences were allelic. They will be referred to as rat A1 and A2. Homozygous rat strains showed only one of the two A sequences, yet these rats could express B antigen. In addition, the tissue distribution of the A and B antigens in rats is largely different (Cailleau-Thomas et al., 2002Go), strongly suggesting that in this species, unlike in humans, the A and B antigens cannot be synthesized by alleles of the same gene. Two distinct rat {alpha}1,3galactosyltransferases have already been described. These enzymes use as substrate nonfucosylated acceptors, N-aceyllactosamine units of glycoproteins and lactosylceramide, respectively (Taylor et al., 2003Go). They do not appear to be able to synthesize B histo-blood group epitopes. In this article, we report the cloning of a new rat gene, distinct from the A gene and from these {alpha}1,3galactosyltransferases, encoding a functional B enzyme.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Analysis of the rat A and B sequences polymorphisms
Using the pair of primers deduced from the A1 rat sequence (AB10 and 3'enzA), we amplified 630-bp amplicons from 29 animals, including 11 Wistar, 15 Sprague Dawley, 1 BN, 1 Lewis, and 1 rat from a Japanese laboratory.

Amplicons obtained from 24 animals displayed sequences without any ambiguity and identical with exon 7 of the rat A1 sequence (AF264018). As for the remaining five animals (four Wistars, W02, W14, W26, W25, and one Sprague Dawley, SD1), amplicon sequences exhibited ambiguities, suggesting that they have most probably more than one Abo gene (or allele, for details see Discussion). We cloned amplicons obtained from four of these five animals (W02, W14, W26, and W25). Sequencing of 20 clones per amplicon demonstrated that each of these four animals has more than one A sequence in its genome (Table I). The remaining Sprague Dawley SD1 animal was found identical with W25 by direct sequencing and was not studied by cloning. Two A-like sequences were found in animals W02 (A1/A3) and three in animals W14 and W26 (A3/A4/A2) as well as in animal W25 (A1/A3/A4). The A2 sequence differs from the previously reported A2 sequence (AF469946) by only one position on exon 7 (574 C->T). This could correspond to either a typing error or a variant A2 allele.


View this table:
[in this window]
[in a new window]
 
Table I. Comparison of the various rat A-type nucleotide sequences for exon 7

 
A BLAST search using the rat A gene sequence AF264018 revealed the existence of expressed sequence tags (ESTs) corresponding to B-like sequences because the putative deduced protein presented a methionine and an alanine at positions orthologous to positions 266 and 268 of the human A or B enzymes. These are characteristic of a B transferase activity. To verify if the B-like gene is present in all rats, we designed two primers (Rat.Ex7.D and Rat.Ex7.R) to specifically amplify this sequence. These two primers were used to amplify B-like sequences from seven different animals, two from inbred rat lines (one Lewis and one BN) and five animals (four Wistar, W02, 14, 25, 26, and one Sprague Dawley, SD1) which have from two to three different A-like sequences in their genome. We obtained 430-bp amplicons from the seven animals and characterized these amplicons by direct sequencing. All sequences were identical and without any ambiguity. Further comparison of these sequences with the B-like rat cDNA obtained later showed that they are identical with the rat B-like cDNA (AB081652).

Characterization of the rat B gene
The complete rat cDNA sequence was obtained by CE, rapid amplification of cDNA ends (RACE)-polymerase chain reaction (PCR) amplification using primers deduced from the B-like 435-bp sequence amplified with the Rat.Ex7.D and rat.Ex7.R primers. It possesses an open reading frame of 1005 bp. Comparison of this sequence with that of known A or B gene sequences confirmed high similarity. It is identical to the recently published B rat sequence AB081652 in the coding region. Yet the two sequences show four nucleotide differences in the noncoding 5' and 3' regions. At the protein level, it showed 84% and 83% identity with the two previously reported rat A enzymes (AF264018, rat A1 and AF469946, rat A2) and 66% identity with the human B enzyme. As shown in Figure 1A, it presents a short intracytoplasmic domain, a transmembrane domain followed by a stem region, and catalytic domain, as all glycosyltransferases do. It shows a deletion in the stem region when compared with the rat A enzymes. This deletion has been previously found in the mouse cis-AB enzyme (Yamamoto et al., 2001Go). Divergences from the A enzymes sequences are spread throughout the protein, yet they are more numerous in the N-terminal part. Previous studies underscored the importance of the amino acid at position 268 with a glycine determining A activity versus an alanine determining B activity (Patenaude et al., 2002Go; Yamamoto and McNeill, 1996Go). The new rat sequence presents an alanine at the orthologous position (position 249), suggesting a potential B enzyme activity.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1. Comparison of the amino acid sequences of the rat A and B transferases and genomic organization of the rat A and B genes. (A) Multiple alignment of the coding region of the B enzyme and of the A enzyme sequences AF264018 (A1) and AF469946 (A2). The predicted transmembrane domain is underscored. Amino acids of the B and A2 enzyme sequences that differ from the A1 enzyme sequence are boxed in black. Arrowheads represent the boundaries of exons. The arrows show the residues responsible for the A and B specificity of the human enzymes. The star denotes the conserved potential N-linked glycosylation site. (B) Organization of the rat A and B genes was obtained from analysis of rat genomic fragments (NW 043710, NW 043711, NW 043667). The coding A-type sequence corresponds to rat A1 (AF264018). Exons are boxed in black. The white box between exons 3 and 4 of the rat gene corresponds to a retroviral LTR sequence. Introns between exons 1 and 2 of the A and B genes are 9282 bp and 10,249 bp long, respectively.

 
Comparison of the nucleotide sequences of the rat A and putative B cDNAs with genomic sequences available in the rat genome data bank allowed complete determination of the genomic structure of both genes (Figure 1B). In both instances, all exon–intron boundaries conform to the GT-AG consensus rule. Unlike the human ABO gene and the rat A gene (Yamamoto et al., 1995Go), the rat putative B gene coding sequence is comprised within six exons. It lacks the exon corresponding to the fourth exon of the A gene, which is replaced by an long terminal repeat (LTR) retroviral sequence, explaining the shortening of the stem domain. We previously mapped the A gene (symbol: Abo) to rat chromosome 3q11–q12. The new rat genomic data available confirm its localization on chromosome 3 in a region corresponding to q11–q12.

Unlike the A (Abo) gene, the putative rat B gene (symbol: Abo2) could not be localized unambiguously in the available rat genome sequence. We localized it using somatic cell hybrids. The Abo2 gene was first assigned to rat chromosome 3, using a panel of 16 standard rat x mouse cell hybrid clones segregating rat chromosomes. No discordant clone was obtained for chromosome 3, but at least two discordant clones were counted for each other chromosome (data not shown). The Abo2 gene showed exactly the same distribution as the Abo gene. Chromosome placement by radiation hybrid mapping confirmed this result, with a precise localization close to the marker D3Rat54 (lod score = 8.39), like the Abo gene (Cailleau-Thomas et al., 2002Go). The two genes are thus closely linked in the 3q11–q12 region.

Determination of the enzyme activity
A soluble form of the putative B enzyme was produced using the pSecTag vector and deleting the transmembrane domain. COS cells were transfected with the vector containing the truncated sequence, and their supernatant was assayed for the presence of B and A enzyme activities using radiolabeled UDP-Gal and UDP-GalNAc, respectively, as sugar donors and two different acceptors, namely, 2'fucosyllactose and H type 3-Sp-biotin. No recovery of either [14C]galactose or [14C]N-acetylgalactosamine above background was obtained in absence of acceptor substrate or with a supernatant from mock-transfected COS cells. After transfection with the truncated putative B cDNA, a transfer of galactose was obtained on both substrates with a clear preference for H type 3-Sp-biotin over 2'fucosyllactose. A small transfer of N-acetylgalactosamine was also observed on both substrates (Figure 2A). After transfection with the truncated A enzyme cDNA, a transfer of N-acetylgalactosamine was obtained for both substrates, also with a clear preference for H type 3-Sp-biotin over 2'fucosyllactose (data not shown). These results indicate that the truncated form of the new rat enzyme is a B histo-blood group enzyme with a small A transferase activity. To confirm that the B gene encodes a truly functional enzyme, the complete coding sequence was inserted into an eukaryotic expression vector and transiently transfected into Chinese hamster ovary (CHO) cells expressing the H precursor. A clearly detectable subpopulation of cells expressed the B antigen after transfection with the putative B enzyme cDNA but not after transfection with the A enzyme cDNA. Inversely, a subpopulation of cells transfected with the A enzyme cDNA but not with the putative B enzyme cDNA, specifically expressed the A antigen (Figure 2B). The rat B enzyme is therefore functional because it contributes to the synthesis of cell surface B histo-blood group epitopes.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Determination of the rat B enzyme catalytic activity. (A) Supernatants from COS cells transfected with the pSecTag B plasmid were used as a source of enzyme. Enzyme activities were determined using UDP-[14C]Gal or UDP-[14C]GalNAc as donor substrates and either 2'fucosyllactose (gray bars) or H type 3-Sp-biotin (black bars) as acceptor substrates. The products of the reactions were separated on either AG1-X8 anion exchange columns or on Sep-Pak C18 cartridges according to the acceptor substrate. Background values were determined in absence of acceptor substrate and were deduced from those obtained in the presence of acceptors. Values of the enzyme activities are given in pmol/h of either [14C]galactose or [14C]N-acetylgalactosamine transferred. (B) CHO cells constitutively expressing H antigen after stable transfection with the rat FTB cDNA were transiently transfected with either the A or the putative B rat cDNAs. Forty-eight hours after transfection, cells were harvested and the A and B antigen expression was tested by flow cytometry using specific anti-A and anti-B mAbs.

 
Tissue expression of the B gene mRNA and of the A and B antigens
A reverse transcription (RT)-PCR analysis was performed to determine the tissue expression of the rat B gene. Primers were chosen to encompass several exons so as to exclude amplification of contaminating genomic DNA. To confirm specificity, the 786-bp fragment amplified from a stomach cDNA preparation was cloned and sequenced. As expected, the sequence was identical to that of the B gene. As illustrated in Figure 3 on a selected set of tissue preparations from BDIX rats, the cDNA was found at rather similar levels in all tissues examined including the stomach, small and large intestines, cecum, ovary, kidney, heart and striated muscle, submaxillary gland, liver, lung, skin, uterus, testis, lymph nodes, and brain. Notably, in some tissues (such as the heart), a minor band of smaller size was amplified. Although it has not been sequenced, this band could indicate expression of alternative splice variants. The same expression of mRNA was found in tissues from DA and WKY rats (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3. Expression of the rat B gene. The expression of the rat B gene was assessed by RT-PCR with the 18S rRNA as internal control (488 bp). One microgram of total RNA was reversed transcribed and amplified with primers designed to amplify specifically a 786-bp fragment of the B enzyme cDNA and with primers and competimers for the 18S rRNA. PCR product were separated on a 2% agarose gel and visualized by ethidium bromide staining. C-, control in absence of cDNA; St, stomach; Je, jejunum; Ov, ovary; Co, colon; Ca, cecum; He, heart; Ki, kidney; Mu, muscle.

 
We previously reported the tissue expression of the A and B antigens in BDIX rats (Cailleau-Thomas et al., 2002Go). Because the A antigen expression in the gut is known to vary among different strains of rats, we looked for the distribution of A and B antigens in two other strains, DA and WKY. Similar to what we previously observed in BDIX, DA rats expressed the A antigen in the large intestine but not in the small intestine. At variance the A antigen was present in both tissues of WKY rats. When detected, the A antigen was uniformely expressed throughout the mucosa. The B antigen expression was identical in the three strains of rats. It was present in the large intestine and the cecum but absent from the small intestine. In these tissues, B antigen expression was restricted to the surface epithelium (Figure 4). It was additionally found in the stomach, pancreas, and kidney. Yet it was never found in striated muscle, heart, liver, lung, skin, uterus, testis, lymph nodes, or brain. Therefore B antigen expression was restricted to a few tissues, although the B gene was expressed ubiquitously.



View larger version (127K):
[in this window]
[in a new window]
 
Fig. 4. Expression of the A and B antigens in the gut. Frozen tissue sections of the small and large intestine of DA and WKY rats were incubated with specific anti-A and anti-B mAbs. The binding was detected with an indirect peroxidase staining as described in Materials and methods. Both anti-A and anti-B give a positive staining of the large intestine of the two rat strains. In contrast, the A antigen is only detected in the small intestine of WKY rats, whereas the B antigen is not detected in the small intestine of either strain.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
It has been suggested that in the rat, the A and B histo-blood group antigens would not be synthesized by enzyme products of alleles at the same locus (Bouhours et al., 1995Go). Indeed, rats from inbred strains may express both A and B antigens, and the sequence of two rat cDNAs encoding active A specific enzymes have been reported (Olson et al., 2002Go), suggesting that unlike mice, rats do not synthesize the A and B antigen using a single enzyme with dual specificity. The presence of B-type ESTs in databases reinforced the hypothesis of two independent loci in rat, one with two alleles encoding the A-type enzymes, the putative second gene encoding a B-type glycosyltransferase. Additionally, this hypothesis could explain why the distribution of the A and B antigens is not completely superimposable in rat tissues: A and B antigens would be synthesized by two different enzymes encoded by two independent loci with different patterns of tissue expression (Cailleau-Thomas et al., 2002Go). This hypothesis, one A gene (Abo) and one B gene (Abo2), could also explain why rats of O type have never been observed, whereas rats not expressing A but expressing B antigen have been reported. Our specific aim was therefore to definitely prove the existence of the two Abo-type genes in rats and to characterize the gene encoding rat B enzyme.

From the ESTs available in databases, we were able to deduce primer pairs that allow specific amplification of either A-like or B-like sequences orthologous to exon 7 of the human ABO gene. These primer pairs were used on genomic DNA from either inbred or outbred rats. In animals from syngeneic lineages LEWIS and BN, two different amplicons were obtained; one was A-like, identical with the A gene sequence AF264018 (or rat A1), which we reported earlier, and one was B-like. In agreement with this observation, Olson et al. (2002)Go also reported that the rat A1 sequence was the only A-type sequence that they could amplify in these two strains of rats. In outbred animals (Wistar and Sprague Dawley), the rat A1 sequence was the only one that could be amplified in most animals. However we found that some animals have two or even three A-like sequences. These results are compatible with the presence of at least two A-type loci in rats being occupied by different alleles. The number of A-like genes would be variable in rats from chromosome to chromosome. The most common rat chromosome probably displays a single A locus occupied by the allele A1. This chromosome is so frequent that most rats are found homozygous A1/A1. In addition, the use of a B-like specific pair of primers led us to demonstrate the presence in their genome of a single B-like sequence identical with that found in LEWIS and BN rats.

Cloning the complete B-like open reading frame allowed us to determine that this gene codes for a functional B transferase. This study revealed four different A-like sequences (rat A1, A2, A3, and A4) in the group of animals tested indicating high variability of A-type sequences in the rat species. In contrast, no polymorphism of the B gene (Abo2) was found as judged from the partial sequence obtained from various animals. These results suggest that rats can present a variable number of Abo genes. All rats would have one B gene (Abo2). Inbred rats and the majority of outbred animals would have a single additional Abo gene encoding an A-type enzyme. In addition, some outbred animals would have two and possibly three genes encoding A-type enzymes because it is not clear in the case of animals that show three A-type sequences if two of them can be alleles of the same gene.

The genomic organization of the Abo2 gene is quite similar with that of the human ABO gene and the rat Abo gene (rat A1), except that it lacks exon 4 due to the insertion of a retroviral sequence. The mouse Abo gene, which encodes an enzyme with a dual cis-AB specificity, shared the same feature, suggesting that it could be orthologous to the rat Abo2 gene rather than to the rat Abo gene (Cailleau-Thomas et al., 2002Go; Yamamoto et al., 2001Go). The absence of exon 4 generates an enzyme with a shortened stem region. It is not clear if this affects the catalytic properties of the enzyme. However, it is interesting to note in this respect that the expression of the B antigen in rat tissues is much lower than that of the A antigen and similarly that a weak level of A and B antigens expression is also observed in the mouse (unpublished data). In humans, the A and B antigens are expressed at comparable levels as judged from the concentration of anti-A and anti-B monoclonal antibodies (mAbs) used to obtain a strong intensity of labeling. In rats, a comparable dilution of anti-A can be used to obtain a strong signal. Yet the anti-B must be used at least at a 50-fold higher concentration to obtain the same signal, indicating that the epitope density is much lower. In rats, like in humans, the presence of A antigen has been reported on both glycoproteins and glycolipids (Bouhours et al., 1995Go; Breimer et al., 1982Go; Hansson, 1983Go; Karlsson et al., 1997Go; Laferte et al., 1995Go; Ménoret et al., 1995Go). In contrast, the B antigen has only been detected so far on glycolipids (Bouhours et al., 1987Go; Breimer et al., 1982Go; Hansson et al., 1987Go). It is quite possible that the shortened stem region restricts accessibility of the catalytic domain to a smaller range of glycolipids and glycoprotein acceptors.

Expression of the B antigen is identical in the three strains of rats studied so far (BDIX, DA, WKY). It is restricted to some tissues, although the presence of the Abo2 gene mRNA appears to be ubiquitous. This contrasts with the expression of the A antigen, which varies among different strains (Bouhours et al., 1995Go; Breimer et al., 1980Go) and is nearly coincident with the presence of the Abo gene mRNA (Cailleau-Thomas et al., 2002Go; Iwamoto et al., 2002Go). The lack of B antigen expression in some tissues may be due to the absence of H antigen expression because it is a compulsory acceptor for the B enzyme. Yet this is not the case in all tissues. For example, there is a strong expression of H antigen in the small intestine and although the Abo2 gene mRNA is present, no B antigen can be detected, suggesting that the expression of the B antigen expression is regulated at a posttranscriptional level that has yet to be understood.

In total, we suggest that rats would possess a variable number of Abo genes—one gene encoding a B-type glycosyltransferase being present in all rats and the number of genes encoding an A-type glycosyltransferase being variable. Analysis of the rat genomic sequences revealed that the Abo and Abo2 genes are located in the same region of chromosome 3 (3q11–q12), suggesting that they arose by duplication. As is well known, the duplication of a locus gives rise to a cycle of expansion and contraction of the locus (Miller et al., 2002Go; Nei et al., 1997Go). Indeed, by asymetric crossing over favored by homologous recombination, it is very easy to obtain haplotypes with various numbers of homologous genes. This would explain why the rat A-like sequences diverge much more than expected for alleles of a single gene. It is therefore quite possible that rat Abo haplotypes can have a variable number of Abo genes. It was reported that some rat lineages are completely A negative (Bouhours et al., 1995Go). In such lineages, because of an asymetric crossing over, the complete Abo locus would encompass only the B-encoding gene (Abo2). Unfortunately, DNA samples of such rat lineages were not available to test this hypothesis.

The presence of at least two Abo loci in the rat genome with one locus differentiated in coding a B type enzyme and at least another locus differentiated in coding an A type enzyme is intriguing. Indeed, the differentiation of the two types of transferases is mainly based on two codons (codons 266 and 268 of human ABO transferases). It is well known that after duplication the two genes show a tendency to homogeneization through interlocus exchanges. Therefore, the maintenance of distinct A-type and B-type Abo genes in the rat genome suggests that there is some selective advantage for this species to maintain both types of genes. The second tendancy of duplicated genes is that one of the two genes evolves to a pseudogene because of functional redundancy. To prevent this functional invalidation, one of the duplicated gene has to mutate and specialize to a function different from that of the ancestral gene. In the case of rat Abo, one can hypothesize that the ancestral gene was of A-type because all rat A sequences reported so far possess all exons compared with human and other primates, contrary to the rat B gene (Abo2), which lacks exon 4. The latter would have derived from the ancestral gene by deletion of exon 4 and mutation of the two codons defining specificity of the enzyme. As a matter of fact, comparing primate B-type sequences with the rat B-type sequence, one can observe that in primates codons 266 and 268 differ between the two types of alleles by only one base. Yet in rats these two codons differ by two bases. This in agreement with the hypothesis of an independent appearance of A-type and B-type ABO genes in rat and humans and reinforces the notion that ABO gene evolution is characterized by convergent evolution with the recurrrent and independent appearance of A and B mutations in various mammalian species. It remains to be discovered what type of selective pressure leads to maintenance in rat of two differentiated Abo genes, whereas humans, as other primates, evolved to maintain an allelism at the ABO locus. The restricted tissue expression of the B antigen and the apparent lack of polymorphism of the Abo2 gene suggest that in rats the B molecule might not be involved in host–pathogen interactions. Instead, it might have cellular functions. In this respect, it is interesting to note that unlike the A antigen, it is expressed by rat primary sensory neurons at the time of synaptogenesis, pointing toward a potential role in this fundamental cellular process (Astic et al., 1989Go; Mollicone et al., 1985Go).

A recent study, published while this article was in preparation, reported the existence of four different Abo gene sequences in a single outbred animal (Iwamoto et al., 2002Go). These sequences correspond to rat A1, A3, A2, and B sequences reported here, confirming that there should exist at least two A-type genes and one B-type gene in some rats. The complete rat genome project could be helpful in resolving the question of the number of rat Abo genes and alleles and of the evolution of the ABO system.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Animals
Rattus norvegicus rats were obtained from Iffa Credo (France). They were from either syngeneic lines (BN, Lewis, BDIX, DA, and WKY) or outbred (Sprague Dawley and Wistar). Genomic DNA was extracted either from blood or tissue by classical methods.

PCR amplification of genomic DNA
Amplification of exon 7 of the rat Abo gene was performed by using the AB10 (ATCTGATGTGCCACAGGT) and 3'enzA (ACCATCCCGGGCCTTGCATGGA) primers.

Briefly, PCR experiments were carried out in a final volume of 50 µl. Between 150–200 ng of genomic DNA were used, with primers AB10 and 3'enzA at 0.5 µM in 1x solution Q Qiagen (Courtaboeuf, France), to which we added 25 µl Taq Master Mix Qiagen (2.5 U Taq DNA polymerase + 200 µM each of dNTP + 1x Qiagen PCR buffer). The temperature cycles were as follows: denaturation 2' at 94°C, then 35 cycles (15'' at 94°C, 30'' at 55°C, 45'' at 72°C) and elongation 7' at 72°C.

A BLAST search using the sequence of the rat A gene that we recently cloned (AF264018) revealed three rat ESTs with features of a B-like gene (GenBank accession numbers BF284956, BF544312, and BF544313). The following primers, Rat.Ex7.D CACGAGGGTCATCAGCCAC (forward) and Rat.Ex7.R GTAGCTGCTGGTCCCACATG (reverse), deduced from these sequences, were used to amplify a 425-bp fragment of genomic DNA. PCR conditions used with these primers were identical with those described for primers AB10 and 3'enzA. Amplicons were size purified by electrophoresis and eluted from agarose gel with a gel extraction kit (Qiagen). The purified amplicons were sequenced using the Dye Terminator kit of Perkin Elmer (Boston, MA) and the amplification primers.

Cloning of a rat B-like cDNA
The Rat.Ex7.D and Rat.Ex7.R primers were used to amplify a cDNA fragment from a rat testis cDNA library (Clontech, Palo Alto, CA). The complete coding sequence was obtained from the testis cDNA library by RACE-PCR with primers deduced from the sequence of this fragment and the Clontech Marathon cDNA amplification kit. Elongation in the 5' direction was performed using the inverted primer CCACTGACCCCCCAAAGAAGGCTCCCAT and the adaptor AP1 primer provided by the supplier. The second nested PCR was performed with the nested inverted primer GGCTCCCATATAGTAAAAGTCACCCTGG and the nested adaptor primer AP2 from the supplier. The PCR was run with the Advantage Polymerase (Clontech) and the manufacturer's touchdown-RACE program. Products were ligated in the pCR3.1 vector (Invitrogen, Carlsbad, CA) and sequenced. Because the longest fragment of 728 bp obtained did not contain the start codon, a second 5' RACE-PCR was performed using new inverted primers deduced from this fragment (TTCCTATTCACAGCTCCTGGGTGCCCCC and nested CCTGGGTGCCCCCATTCCTGGCTTCTGA). A 3' RACE-PCR was performed using the first primer CCAGGGTGACTTTTACTATATGGGAGCC and the AP1 primer, followed by a nested PCR with the nested primer ACTATATGGGAGCCTTCTTTGGGGGG and AP2. After ligation in the pCR3.1 vector, products were sequenced.

To prepare a truncated form of the enzyme lacking N-terminal putative cytosolic and transmembrane regions, PCR amplification with the primers AGGAAGGCCTATCCCCAGCCAAGG (forward) and GAGTGCCCCTGGCTATGGCCTGT (reverse) was performed using the testis cDNA as template. The 906-bp amplified fragment was inserted through EcoRV into the pSecTag2b vector (Invitrogen) and sequenced for verification. The resulting plasmid, named pSecTag B, will encode a fusion protein containing a secretion signal from the V-J2-C region of the mouse Ig kappa chain and the entire coding region for the putative catalytic domain of the rat B enzyme. A similar plasmid with the truncated A enzyme cDNA was prepared by inserting an EcoRI fragment of the rat A enzyme cDNA previously cloned in a pUC18 vector (Cailleau-Thomas et al., 2002Go) into the pBlueScript KS+ vector. The truncated A enzyme sequence was then subcloned into pSecTag2b through KpnI insertion. After sequencing of the insert for verification, the resulting plasmid was named pSecTag A.

Sequence analysis
Multiple alignments were performed with the Clustal W program. Approximate location of transmembrane regions were determined using the TMHMM, tmap, and TopPred2 programs. Determination of the genomic organization of the A (Abo) and B (Abo2) genes was performed by analysis of the rat genomic sequences available in the NCBI database. The programs used are all available online at www.infobiogen.fr.

Chromosome localization
The Abo2 gene was first assigned to a rat chromosome using a panel of standard rat x mouse cell hybrids that segregate rat chromosomes (Szpirer et al., 1984Go). The hybrids were typed by PCR with the following primers: 5'-AGTGTGGAAGGCTGTGGG-3' (forward) and 5'-CTAAGATCCCTCCAACCAAT-3' (reverse). Both primers hybridize to sequences located in the intron between exons 5 and 6 of the B gene (Abo2), and their sequence does not show homology with that of the A gene or Abo (see Figure 1B). For regional localization, the panel of rat x hamster radiation cell hybrids (Watanabe et al., 1999Go) was typed in the same manner. The mapping results were obtained from the rat radiation hrybrid map server at the Otsuka GEN Research Institute (http://ratmap.ims.u-tokyo.ac.jp/menu/RH.html) (Watanabe et al., 1999Go).

RT-PCR analysis
Total RNAs (1 µg) from various rat tissues listed in Table I were prepared using the SV Total RNA isolation System kit from Promega (Madison, WI) and reverse transcribed at 42°C with the M-MLV reverse transcriptase (Promega). Contaminating DNA had been removed by digestion with RNase-free DNase I (10 U/µg RNA) for 15 min at room temperature. Amplification of the cDNA corresponding to the B enzyme cDNA was performed by nested PCR. The first amplification was performed using the following primers: GTATCCTTCGGGCGTTGAACTCG (forward) and GAGTGCCCCTGGCTATGGCCTGT (reverse) with initial denaturation at 94°C 3 min, followed by 20 cycles of 94°C 30 s, 65°C 30 s, and 72°C 2 min. The second amplification was performed with the nested primers AGGAAGGCCTATCCCCAGCCAAGG (forward) and GTAGCTGCTGGTCCCACATG (reverse) together with the primers and competimers from the QuantumRNA 18S kit (Ambion, Austin, TX) to coamplify the 18S rRNA as an internal control. The following program was used: initial denaturation at 94°C 1 min, followed by 30 cycles of 94°C, 30 s; 60°C, 30 s; and 72°C, 90 s. The amplification yields two products of 786 bp for the B gene and 488 bp for the 18S rRNA.

Detection of enzyme activity
COS cells were transfected with either the pSecTag A or the pSecTag B vectors using lipofectamine (Gibco BRL). After 48 h, the supernatant was collected and used as a crude enzyme preparation. The reaction mixtures contained 50 µl COS supernatant, 30 mM MnCl2, 5 mM ATP, 10 mM NaN3, either 5 mM 2'fucosyllactose (Fuc{alpha}2Galß4Glc) or 0.56 mM Fuc{alpha}2Galß3GalNAc{alpha}-sp-biotin (Syntesome, Munich, Germany) as sugar acceptors and either 20 µM UDP-D-[14C]-N-acetylgalactosamine (55 mCi/mmol, ICN, Costa Mesa, CA) or 20 µM UDP-D-[14C]-galactose (278 mCi/mmol, NEN Chemical Center, Dreieichendain, Germany) as sugar donors in a final volume of 50 µl and incubated at 37°C for 16 h. After incubation, the reaction mixture was quenched with 750 µl distilled water and applied to an AG1-X8 column, chloride form, 100–200 mesh (Bio-Rad, Hercules, CA) when 2'fucosyllactose was the acceptor or to a Sep-Pak C18 cartridge (Waters-Millipore, Bedford, MA) when Fuc{alpha}2Galß3GalNAc{alpha}-sp-biotin was used. The radiolabeled products were then eluted with 1 ml water in the case of AG1-X8 columns or with 5 ml methanol in the case of Sep-Pak C18 cartridge and counted in 10 ml scintillation liquid (Ready Safe, Beckman, Palo Alto, CA). Background levels of radioactivity were obtained from controls without exogenous acceptor and from supernatants from mock-transfected COS cells. Values obtained for the controls were then subtracted from those obtained for the assays.

CHO cells stably transfected with the rat FTB ({alpha}1,2fucosyltransferase) cDNA were prepared as previously described (Cailleau-Thomas et al., 2002Go). These cells strongly express H antigenic determinants that can be used as acceptors for the A and B enzymes. They were transiently transfected with pCR3.1 plasmids containing the complete rat A or putative rat B cDNA using lipofectAMIN (Gibco BRL, Cergy-Pontoise, France) according to the manufacturer's instructions. Forty-eight hours after transfection, cell surface expression of A and B epitopes was assayed by flow cytometry. For this aim, cells (2 x 105 cells/well) were incubated with the anti-A mAb 3–3A at 10 µg/ml in phosphate buffered saline (PBS) containing 0.1% gelatin for 1 h at 4°C or with the anti-B mAb ED3 as a cell supernatant at a one-half dilution. The anti-A mAb 3–3A was obtained from Dr. J. Bara (Villejuif, France). It recognizes all types of A antigens (Bara et al., 1988Go) and does not show any detectable cross reactivity with B epitopes as judged from enzyme immunoassay with synthetic oligosaccharides and immunostaining of human tissues of known ABO phenotypes. The anti-B mAb ED3 is a gift from Dr. A. Martin (Rennes, France). It recognizes all types of B and shows no detectable cross-reactivity with A epitopes or with the Gal{alpha}1,3Gal epitope (Le Pendu et al., 1997Go). After washing in the same buffer, a second 45-min incubation was performed with an fluorescein isothiocyanate–labeled anti-mouse IgG (Sigma, St. Louis, MO). Following three washes, propidium iodide was added, and fluorescence analysis was performed on a FACScan (Becton-Dickinson, Franklin Lakes, NJ) using the CELLQUEST program. Dead cells, propidium iodide positive, were excluded from the analysis.

Immunohistochemical analysis
Tissues from 2–3-month-old rats were collected and paraffin embedded after fixation in ethanol for 48 h. Sections (5 µm) were prepared and washed in PBS. Endogenous peroxidase was inhibited using methanol/H2O2 0.3% for 20 min. Sections were then washed in PBS for 5 min and covered with PBS/bovine serum albumin (BSA) 1% for 20 min at room temperature in a moist chamber. After washing in PBS, sections were covered with either of the primary antibodies diluted in PBS/BSA 1% and left at 4°C overnight. The anti-A mAb 3–3A was used as an ascitic fluid diluted 1/105 and the anti-B mAb ED3 was used as a cell supernatant diluted one-half. Sections were then rinsed three times with PBS and incubated with biotinylated anti-mouse IgG (Vector Labs, Burlingame, CA) diluted at 1/100 for 60 min at room temperature. After washing in PBS, the sections were covered with peroxidase-conjugated avidin (Vector Labs) diluted at 1/1000 for 45 min and washed with PBS; reactions were revealed with 3-amino-9-ethylcarbazol. Counterstaining was performed with Mayer's hemalun.


    Acknowledgements
 
The authors are grateful to Drs. J. Bara and A. Martin for their generous gift of antibodies and to S. Minault for great animal care. They thank Pascale Van Vooren for excellent technical assistance. The work was supported by the Institut National de la Santé et de la Recherche Médicale (INSERM), the Etablissement Français du Sang Pyrénées-Méditerranée, the French Ministry of Resarch (grant E.A. 3034) and by a grant from the Association for International Cancer Research (AICR). C.S. is a research director of the National Fund for Scientific Research (FNRS, Belgium).


    Footnotes
 
1 To whom correspondence should be addressed; email: jlependu{at}nantes.inserm.fr Back


    Abbreviations
 
BSA, bovine serum albumin; CHO, Chinese hamster ovary; EST, expressed sequence tag; LTR, long terminal repeat; mAb, monoclonal antibody; PBS, phosphate buffered saline; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; RT, reverse transcription


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Astic, L., Le Pendu, J., Mollicone, R., Saucher, D., and Oriol, R. (1989) Cellular expression of H and B antigens in the rat olfactory system during development. J. Comp. Neurol., 289, 386–394.[CrossRef][Web of Science][Medline]

Bara, J., Gautier, R., Le Pendu, J., and Oriol, R. (1988) Immunochemical characterization of mucins. Polypeptide (M1) and polysaccharide (A and Leb) antigens. Biochem. J., 254, 185–193.[Web of Science][Medline]

Black, R.E., Levine, M.M., Clements, M.L., Hughes, T., and O'Donnell, S. (1987) Association between O blood group and occurence and severity of diarrhoea due Escherichia coli. Trans. R. Soc. Trop. Med. Hyg., 81, 120–123.[CrossRef][Web of Science][Medline]

Blancher, A. and Socha, W.W. (1997) ABO, Hh and Lewis blood groups in humans and nonhuman primates. In Blancher, A., Klein, J., and Socha, W.W. (Eds.), Molecular biology and evolution of blood group and MHC antigens in primates. Springer-Verlag: Berlin, pp. 30–92.

Boren, T., Falk, P., Roth, K.A., Larson, G., and Normak, S. (1993) Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science, 262, 1892–1895.[Abstract/Free Full Text]

Bouhours, D., Hansson, G.C., and Bouhours, J.F. (1995) Structure and genetic polymorphism of blood group A-active glycoshingolipids of the rat large intestine. Biochem. Biophys. Acta, 1255, 131–140.[Medline]

Bouhours, J.F., Bouhours, D., and Hansson, G.C. (1987) Developmental changes of gangliosides of the rat stomach. Appearance of a blood group B-active ganglioside. J. Biol. Chem., 262, 16370–16375.[Abstract/Free Full Text]

Breimer, M.E., Hansson, G.C., Karlsson, K.A., and Leffler, H. (1980) Human blood group A-positive and -negative strains of rats. Chemical basis as shown by fucolipids of small intestine. FEBS Lett., 114, 51–56.[CrossRef][Web of Science][Medline]

Breimer, M.E., Hansson, G.C., Karlsson, K.A., and Leffler, H. (1982) Glycosphingolipids of rat tissues. Different composition of epithelial and nonepithelial cells of small intestine. J. Biol. Chem., 257, 557–568.[Abstract/Free Full Text]

Cailleau-Thomas, A., Le Moullac-Vaidye, B., Rocher, J., Bouhours, D., Szpirer, C. and Le Pendu, J. (2002) Cloning of a rat gene encoding the histo-blood group A enzyme. Tissue expression of the gene and of the A and B antigens. Eur. J. Biochem., 269, 4040–4047.[Web of Science][Medline]

Clausen, H. and Hakomori, S.I. (1989) ABH and related histo-blood group antigens; immunochemical differences in carrier isotypes and their distribution. Vox Sang., 56, 1–20.[Web of Science][Medline]

Doxiadis, G.G.M., Otting, N., Antunes, S.G.M., de Groot, N.G., Harvey, M., Doxiadis, I.I.N., Jonker, M., and Bontrop, R.E. (1998) Characterization of the ABO blood group genes in macaques: evidence for convergent evolution. Tissue Antigens, 51, 321–326.[Web of Science][Medline]

Geisel, J., Steuer, M.K., Ko, H.L., and Beuth, J. (1995) The role of ABO blood groups in infections induced by Staphylococcus saprophyticus and Pseudomonas aeruginosa. Zentralbl. Bakteriol., 282, 427–430.[Web of Science][Medline]

Glass, R.I., Holmgren, J., Haley, C.E., Khan, M.R., Svennerholm, A.M., Stoll, B.J., Belayet Hossain, K.M., Black, R.E., Yunus, M., and Barua, D. (1985) Predisposition for cholera of individuals with O blood group. Possible evolutionary significance. Am. J. Epidemiol., 121, 791–796.[Abstract/Free Full Text]

Hansson, G.C. (1983) The structure of two blood group A-active glycosphingolipids with 12 sugars and a branched chain present in the epithelial cells of rat small intestine. J. Biol. Chem., 258, 9612–9615.[Abstract/Free Full Text]

Hansson, G.C., Bouhours, J.F., and Angström, J. (1987) Characterization of neutral blood group B-active glycosphingolipids of rat gastric mucosa. J. Biol. Chem., 262, 13135–13141.[Abstract/Free Full Text]

Heissigerova, H., Breton, C., Moravcova, J., and Imberty, A. (2003) Molecular modeling of glycosyltransferases involved in the biosynthesis of blood group A, blood group B, Forssman and iGb3 antigens and their interaction with substrates. Glycobiology, 13, 377–386.[Abstract/Free Full Text]

Iwamoto, S., Kumada, M., Kamesaki, T., Okuda, H., Kajii, E., Inagaki, T., Saikawa, D., Takeuchi, K., Ohkawara, S., Takahashi, R., and others. (2002) Rat encodes the paralogous gene equivalent of the human histo-blood group ABO gene. J. Biol. Chem., 277, 46463–46469.[Abstract/Free Full Text]

Karlsson, N.G., Herrmann, A., Karlsson, H., Johansson, M.E., Carlstedt, I., and Hansson, G.C. (1997) The glycosylation of rat intestinal Muc2 mucin varies between rat strains and the small and large intestine. A study of O-linked oligosaccharides by a mass spectrometry approach. J. Biol. Chem., 272, 27025–27034.[Abstract/Free Full Text]

Kermarrec, N., Roubinet, F., Apoil, P.A., and Blancher, A. (1999) Comparison of allele O sequences of the human and nonhuman primate ABO system. Immunogenetics, 49, 517–526.[CrossRef][Web of Science][Medline]

Kominato, Y., McNeill, P.D., Yamamoto, M., Russell, M., Hakomori, S.I., and Yamamoto, F. (1992) Animal histo-blood group ABO genes. Biochem. Biophys. Res. Commun., 189, 154–164.[CrossRef][Web of Science][Medline]

Laferte, S., Prokopishyn, N.L., Moyana, T., and Bird, R.P. (1995) Monoclonal antibody recognizing a determinant on type 2 chain blood group A and B oligosaccharides detects oncodevelopmental changes in azoxymethane-induced rat colon tumors and human colon cancer cell lines. J. Cell. Biochem., 57, 101–119.[CrossRef][Web of Science][Medline]

Le Pendu, J., Le Cabellec, M., and Bara, J. (1997) Immunohistological analysis of antibodies against ABH and other glycoconjugates in normal human pyloric and duodenal mucosae. Transfus. Clin. Biol., 1, 41–46.

Lindstedt, R., Larson, G., Falk, P., Jodal, U., Leffler, H., and Swanborg, C. (1991) The receptor repertoire defines the host range for attaching Escherichia coli strains that recognize globo-A. Infect. Immun., 59, 1086–1092.[Abstract/Free Full Text]

Marionneau, S., Cailleau-Thomas, A., Rocher, J., Le Moullac-Vaidye, B., Ruvoën-Clouet, N., Clément, M., and Le Pendu, J. (2001) ABH and Lewis histo-blood group antigens, a model for the meaning of oligosaccharide diversity in the face of a changing world. Biochimie, 83, 565–573.[Medline]

Martinko, J.L., Vincek, V., Klein, D., and Klein, J. (1993) Primate ABO glycosyltransferases: evidence for trans-species evolution. Immunogenetics, 37, 274–278.[Web of Science][Medline]

Ménoret, A., Otry, C., Labarrière, N., Breimer, M.E., Piller, F., Meflah, K., and Le Pendu, J. (1995) The expression of carbohydrate blood group antigens correlates with heat resistance. J. Cell Sci., 108, 1691–1701.[Abstract]

Miller, K.M., Kaukinen, K.H., and Schulze, A.D. (2002) Expansion and contraction of major histocompatibility complex genes: a teleostean example. Immunogenetics, 53, 941–963.[CrossRef][Web of Science][Medline]

Mollicone, R., Trojan, J., and Oriol, R. (1985) Appearance of H and B antigens in primary sensory cells of the rat olfactory apparatus and inner ear. Brain Res., 349, 275–279.[Medline]

Nei, M., Gu, X., and Sitnikova, T. (1997) Evolution by the birth-and-death process in multigene families of the vertebrate immune system. Proc. Natl Acad. Sci. USA, 94, 7799–7806.[Abstract/Free Full Text]

Olson, F.J., Johansson, M.E.V., Klinga-Levan, K., Bouhours, D., Enerbäck, L., Hansson, G.C., and Karlsson, N.G. (2002) Blood group A glycosyltransferase occuring as alleles with high sequence difference is transiently induced during a Nippostrongylus brasiliensis parasite infection. J. Biol. Chem., 277, 15044–15052.[Abstract/Free Full Text]

Olsson, M.L. and Chester, M.A. (2001) Polymorphism and recombination events at the ABO locus: a major challenge for genomic ABO blood grouping strategies. Transfus. Med., 11, 295–313.[CrossRef][Web of Science][Medline]

Oriol, R., Mollicone, R., Couillin, P., Dalix, A.M., and Candelier, J.J. (1992) Genetic regulation of the expression of ABH and Lewis antigens in tissues. APMIS, 100(Suppl 27), 28–38.

Patenaude, S.I., Seto, N.O.L., Borisova, S.N., Szpacenko, A., Marcus, S.L., Palcic, M.M., and Evans, S.V. (2002) The structural basis for specificity in human ABO(H) blood group biosynthesis. Nature Struct. Biol., 9, 685–690.[CrossRef][Web of Science][Medline]

Roubinet, F., Kermarrec, N., Despiau, S., Apoil, P.-A., Dugoujon, J.M., and Blancher, A. (2001) Molecular polymorphism of O alleles in five populations of different ehtnic origins. Immunogenetics, 53, 95–104.[CrossRef][Web of Science][Medline]

Steuer, M.K., Beuth, J., Hofstadter, F., Probster, L., Ko, H.L., Pulverer, G., and Strutz, J. (1995) Blood group phenotype determines lectin-mediated adhesion of Pseudomonas aeruginosa to human outer ear canal epithelium. Zentralbl. Bakteriol., 282, 287–295.[Web of Science][Medline]

Swerdlow, D.L., Mintz, E.D., Rodriguez, M., Tejada, E., Ocampo, C., Espejo, L., Barrett, T.J., Petzelt, J., Bean, N.H., and Seminario, L. (1994) Severe life-threatening cholera associated with blood group O in Peru: implications for the latin american epidemic. J. Infect. Dis., 170, 468–472.[Web of Science][Medline]

Szpirer, J., Levan, G., Thörn, M., and Szpirer, C. (1984) Gene mapping in the rat by mouse-rat cell hybridization: synteny of the albumin and alpha-foetoprotein genes and assignment to chromosome 14. Cytogenet. Cell Genet., 38, 142–149.[Web of Science][Medline]

Taylor, S.G., McKenzie, I.F., and Sandrin, M.S. (2003) Characterization of the rat {alpha}(1,3)galactosyltransferase: evidence for two independant genes encoding glycosyltransferases that synthesize Gal{alpha}(1,3)Gal by two separate glycosylation pahtways. Glycobiology, 13, 327–337.[Abstract/Free Full Text]

Watanabe, T.K., Bihoreau, M.T., McCarthy, L.C., Kiguwa, S.L., Hishigaki, H., Tsuji, A., Browne, J., Yamasaki, Y., Mizoguchi-Miyakita, A., Oga, K., and others. (1999) A radiation hybrid map of the rat genome containing 5,255 markers. Nature Genet., 22, 27–36.[CrossRef][Web of Science][Medline]

Watkins, W.M. (1999) A half century of blood-group antigen research. Some personal recollections. Trends Glycosci. Glycotech., 11, 391–411.

Yamamoto, F. (2000) Molecular genetics of ABO. Vox. Sang., 78, 91–103.

Yamamoto, F. and McNeill, P.D. (1996) Amino acid residue at codon 268 determines both activity and nucleotide-sugar donor substrate specificity of human histo-blood group A and B transferases. J. Biol. Chem., 271, 10515–10520.[Abstract/Free Full Text]

Yamamoto, F., McNeill, P.D., and Hakomori, S.I. (1995) Genomic organization of the human histo-blood group ABO genes. Glycobiology, 5, 51–58.[Abstract/Free Full Text]

Yamamoto, M., Lin, X.-H., Kominato, Y., Hata, Y., Noda, R., Saitou, N., and Yamamoto, F. (2001) Murine equivalent of the human histo-blood group ABO gene is a cis-AB gene that encodes a glycosyltransferase with both A and B transferase activity. J. Biol. Chem., 276, 13701–13708.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
P. Tumbale, H. Jamaluddin, N. Thiyagarajan, K R. Acharya, and K. Brew
Screening a limited structure-based library identifies UDP-GalNAc-specific mutants of {alpha}-1,3-galactosyltransferase
Glycobiology, December 1, 2008; 18(12): 1036 - 1043.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
A.-L. Turcot-Dubois, B. Le Moullac-Vaidye, S. Despiau, F. Roubinet, N. Bovin, J. Le Pendu, and A. Blancher
Long-term evolution of the CAZY glycosyltransferase 6 (ABO) gene family from fishes to mammals--a birth-and-death evolution model
Glycobiology, May 1, 2007; 17(5): 516 - 528.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/12/919    most recent
cwg087v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Turcot, A. L.
Right arrow Articles by Le Pendu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Turcot, A. L.
Right arrow Articles by Le Pendu, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?