Skip Navigation


Glycobiology Advance Access originally published online on August 7, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/11/777    most recent
cwg106v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Altman, E.
Right arrow Articles by Logan, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Altman, E.
Right arrow Articles by Logan, S. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2003, Vol. 13, No. 11 777-783
© 2003 Oxford University Press

Occurrence of a nontypable Helicobacter pylori strain lacking Lewis blood group O antigens and DD-heptoglycan: evidence for the role of the core {alpha}1,6-glucan chain in colonization

Eleonora Altman1, Natalia Smirnova, Jianjun Li, Annie Aubry and Susan M. Logan

Institute for Biological Sciences, National Research Council of Canada, Ottawa, Ontario, K1A 0R6, Canada

Received on May 13, 2003; revised on July 17, 2003; accepted on July 23, 2003


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The cell envelope of Helicobacter pylori contains a lipopolysaccharide (LPS) essential for the physical integrity and functioning of the bacterial cell membrane. The O-chain of this LPS frequently expresses type 2 Lewis x (Lex) and Lewis y (Ley) blood group antigens that mimic human gastric mucosal cell-surface glycoconjugates. This article describes the isolation and structural analysis of the LPS from a clinical isolate of H. pylori strain PJ2 that lacks Le antigens but is still capable of colonization. Subsequent composition, methylation, and CE-ESMS analyses of LPS revealed its core oligosaccharide structure to be consistent with the previously proposed structural model for H. pylori LPS. In addition, it carries an unusually long side branch {alpha}1,6-glucan and was devoid of Le O-chain polysaccharide. Its ability to colonize the mouse stomach was essentially identical to that of DD-heptoglycan- and Le antigen– producing H. pylori strains.

Key words: colonization / Helicobacter pylori / Lewis antigen / lipopolysaccharide


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The Gram-negative bacterium Helicobacter pylori is known to be associated with the development of chronic gastritis, peptic ulcer, and gastric carcinoma and is recognized as the most common bacterial pathogen, affecting more than half of the worlds population (Dunn et al., 1997Go). H. pylori produces several putative colonization factors, including urease, various adhesins, flagella, vacuolating cytotoxin (vacA), the cytotoxin-associated antigen (cagA) and lipopolysaccharide (LPS) (for review see Covacci et al., 1999Go; Moran et al., 1996Go, Monteiro, 2001Go). The LPS of most H. pylori strains contain fucosylated polylactosamine O-chains that mimic Lewis (Le) antigens present on the cell surface of human gastric cells and in adenocarcinoma tumors (Sakamoto et al., 1989Go; Sherburne and Taylor, 1996; Appelmelk et al., 1997Go). These LPS features have been reported to contribute to the virulence of H. pylori strains and the ability of H. pylori to colonize the human host and persist for decades in human stomach (Blaser, 1999Go).

It has been suggested that there is a correlation between the lack of Le antigen expression and the lack of colonization and pathology of disease (Sakamoto et al., 1989Go). Previous surveys of H. pylori isolates suggest that a strong expression of Lex and Ley antigens by cagA-positive isolates contributes to inflammatory activities and persistence (Wirth et al., 1996Go). More recently, it was shown that Le expression is not necessary for successful mouse gastric colonization or for H. pylori adherence to epithelial cells (Monteiro et al., 2001Go; Takata et al., 2002Go). We report on the isolation and structural analysis of the LPS from a clinical isolate, strain PJ2, that is devoid of both the Le antigens and the DD-heptoglycan structures but is still capable of colonization. Its ability to colonize the murine stomach was essentially identical to that of DD-heptoglycan and Le antigen–expressing H. pylori strains.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
LPS isolation, composition, and linkage analysis
Clinical isolate H. pylori strain PJ2 was grown in flasks as previously described (Logan et al., 2000Go), and LPS was isolated by hot phenol-water extraction of bacterial cells (Westphal and Jann, 1965Go). Crude aqueous-phase soluble LPS was subjected to further purification by ultracentrifugation. Composition analysis of the purified LPS as alditol acetates revealed the presence of L-fucose, D-glucose, D-galactose, N-acetyl-D-glucosamine, D-glycero-D-manno-heptose (DD-Hep), and L-glycero-D-manno-heptose (LD-Hep) in the approximate molar ratio of 0.5:4.9:0.8:1.9:1.6:1.0. Methylation analysis (Table I) carried out on intact aqueous-phase LPS indicated that it contained only negligible amounts of sugars associated with the presence of Le O-antigen, namely, terminal fucose, 3-linked galactose, and 3,4-linked N-acetylglucosamine, and no 2-linked galactose, suggesting the absence of Ley. Significant amounts of 6-linked glucose were detected together with other typical inner and outer core forming sugar residues: terminal glucose, 3-linked glucose, 2,7-linked DD-Hep, 2-linked DD-Hep, 6-linked DD-Hep, 2-linked LD-Hep, and 3-linked LD-Hep (Monteiro et al., 2000Go). No 3-linked DD-Hep or significant amount of 2-linked DD-Hep was detected, suggesting the absence of DD-heptoglycan (Monteiro et al., 2001Go). All sugars were present in pyranose form.


View this table:
[in this window]
[in a new window]
 
Table I. Methylation analysis of the delipidated LPS from H. pylori strain PJ2

 
SDS–PAGE analysis of PJ2 LPS
Purified aqueous-phase LPS was analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). Silver staining revealed that it lacked the typical high-molecular-weight ladder pattern. Consistent with these findings, immunoblotting with anti-Lex and anti-Ley monoclonal antibodies confirmed that PJ2 LPS was devoid of Lex and Ley antigens (Figure 1). An enzyme-linked immunosorbent assay performed on the whole cells confirmed that it also lacked Lea and Leb antigens (data not shown).



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 1. Silver-stained SDS–PAGE (12% acrylamide) and immunoblot of purified aqueous LPS from H. pylori. (A) Lane 1, H. pylori 26695 LPS; lane 2, H. pylori PJ2 LPS. (B) Corresponding immunoblot using anti Lex monoclonal antibody at 1:100 dilution. (C) Corresponding immunoblot using anti Ley monoclonal antibody at 1:500 dilution.

 
Fast-atom bombardment mass spectrometry (FAB-MS)
To confirm sequence information of the LPS outer extremities, permethylated LPS from strain PJ2 was subjected to FAB-MS analysis in the positive mode. The analysis indicated the presence of the primary glycosyl oxonium ion at m/z 682 [Fuc, GlcNAc, Hep]+, consistent with the moiety containing GlcNAc and Fuc residues of the O-chain and a single heptose residue from the core. Presence of the primary ion at m/z 668 and its corresponding secondary ion at m/z 228 pointed to the presence of the type 1 linear B blood group [Gal(1-3)Gal(1-3)GlcNAc] antigen, a blood group antigen found in the LPS of 26695 LPS (Monteiro et al., 2000Go). No fragments characteristic of Lex (m/z 638, m/z 432) and Ley (m/z 812, m/z 606) epitopes or DD-Hep oligomers (m/z 263, m/z 231 [Hep]+; m/z 511, m/z 479 [Hep-Hep]+) were detected, confirming the absence of an O-chain and DD-heptoglycan.

Nuclear magnetic resonance (NMR) analysis
LPS was delipidated with 0.1 M sodium acetate buffer (pH 4.5) and subjected to gel filtration chromatography on a Bio-Gel P-2 column, affording a single fraction eluting in the void volume of the column. The 1H-NMR spectrum of the delipidated aqueous-phase LPS showed a predominant proton resonance at {delta} 4.99 ppm belonging to H-1 of {alpha}1,6-linked glucan. Based on the integration of proton resonances, the average length of {alpha}1,6-linked glucan corresponded to approximately eight glucose residues (Figure 2). As seen in other H. pylori LPS structures (Monteiro et al., 2000Go), anomeric resonances characteristic of {alpha}-DD- and {alpha}-LD-Hep were observed in the {delta} 5.1–5.45 ppm region together with anomeric resonances at {delta} 4.6 ppm and {delta} 4.5 ppm corresponding to ß-GlcNAc and ß-Gal respectively, a signal at {delta} 2.05 ppm corresponding to the CH3 of N-acetyl group of ß-GlcNAc and a signal at {delta} 1.18 ppm corresponding to the methyl group of {alpha}-Fuc.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. 400 MHz 1H-NMR spectrum of the delipidated aqueous-phase LPS from H. pylori strain PJ2 recorded at 25°C in D2O. Chemical shifts were measured relative to the methyl group of external acetone standard at {delta} 2.225 ppm with HOD signal at {delta} 4.787 ppm.

 
Capillary electrophoresis-electrospray mass spectrometry (CZE-ES-MS)
The analysis of glucose-containing glycoforms was performed on delipidated LPS by CZE-ES-MS in the positive mode. The mixture of glycoforms was analyzed by capillary electrophoresis-mass spectrometry (Figure 3a) which revealed the presence of the series of triply and doubly charged ions consistent with the consecutive addition of Hex residues, the longest glucan chain corresponding to approximately 11 residues (Figure 3a) and the most abundant glycoforms contained between six and eight glucose units. Tandem MS (MS/MS) of the doubly charged ion at m/z 1389 afforded three major singly charged fragment ions at m/z 1263, m/z 1448, and m/z 1516. Further structural evidence was obtained in a separate MS/MS experiment in which a singly charged fragment at m/z 1516 was selected as a precursor. Its fragmentation pattern was consistent with the core fragment Hex6Hep(Fuc,HexNAc), and the fragmentation pattern of the diagnostic ion at m/z 1263 was consistent with the previously observed backbone core oligosaccharide fragment Hex2Hep3(PE)KDO (Figure 3b). A similar fragmentation pattern was observed for other doubly charged ions when they were subjected to MS/MS experiments (Table II). The presence of the singly charged ion at m/z 1448, corresponding to the core fragment Hex2HexNAcHep3(PE)KDO, suggested that some of the GlcNAc in the side chain could be directly linked to DD-Hep in the core oligosaccharide backbone (Figure 3c), a pattern consistent with the presence of 3-linked GlcNAc and terminal DD-Hep in the methylation analysis (Table I). Based on the combined chemical and spectrometric evidence the structure of the major glycoform produced by H. pylori strain PJ2 is illustrated in Figure 4.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. CE-MS analysis of LPS from strain PJ2. (a) Extracted mass spectrum (m/z 800–2000) obtained using Q-Star at 5.082 to 5.725 min (11 scans); (b) product ion spectrum of ions at m/z 1389 obtained using API3000; (c) the second-generation product ion of fragment ion at m/z 1448 promoted by increasing the orifice voltage of API3000 to 180 v.

 

View this table:
[in this window]
[in a new window]
 
Table II. Positive-ion CE-ESMS data and proposed composition of the major glycoforms in the delipidated LPS from H. pylori strain PJ2

 


View larger version (8K):
[in this window]
[in a new window]
 
Fig. 4. Predominant structure of H. pylori LPS from strain PJ2.

 
Polymerase chain reaction (PCR) analysis of cagA and vacA genes in PJ2
The H. pylori–specific CagA primers DZ3 (5' AGTAA GGAGAAACAATGA3'), R009 (5' AATAAGCCTTAGAGTCTTTTTGGAAATCC 3') (Xiang et al., 1995Go), D008 (5'ATAATGCTAAATTAGACAACTTGAGCGA3'), and R008 (5' TTAGAATAATCAACAAACATCACGCCAT 3') (Covacci and Rappuoli, 1996Go) and vacA primers 1F 5'ATGGAAATACAACAAACACA3' and 1R 5' CTC CAGAACCCACACGATT 3' (Cover et al., 1994Go) were used to determine if cagA and vacA genes were present in strain PJ2. For vacA the expected 600-bp internal PCR fragment was obtained, indicating the presence of the vacA gene in the chromosome of this strain. In amplification of genomic PJ2 DNA with either of the cagA-specific primer sets, no product of the predicted size was evident, indicating the absence of the cagA gene in this strain or significant sequence divergence. PCR amplification using chromosomal DNA from 26695 and SS1 as template using the same primers produced products of the expected size when examined by agarose gel electrophoresis.

Mouse colonization experiments
The ability of this nontypable H. pylori strain PJ2, which expresses only an {alpha}1,6-glucan chain linked to the conserved core structure, to colonize the murine stomach was investigated. Colonization levels of this isolate were compared with the colonization levels achieved for the SS1 strain expressing Le O antigen and PJ1 strain expressing DD-heptoglycan (Table III). Although the Le antigen–expressing strain SS1 was shown to be a good colonizer, there was a 10-fold difference in numbers of SS1 and PJ2 bacteria recovered at 4 weeks postchallenge. However, the colonization levels of H. pylori strain PJ2 were still significant (4.667 ± 0.186 log10 cfu of bacteria recovered) and were practically identical to the ones achieved using a second nontypable clinical isolate H. pylori strain PJ1 with extended DD-heptoglycan structure (4.799 ± 0.572 log10 cfu of bacteria recovered).


View this table:
[in this window]
[in a new window]
 
Table III. Gastric colonization of CD1 mice with wild-type H. pylori strains SS1, PJ1, and PJ2

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
In this study we determined the chemical structure of the LPS produced by a nontypable strain of H. pylori and have shown its ability to successfully colonize murine stomach despite its Le-negative status. Most of the reported H. pylori LPS structures share the common characteristic of expressing Le blood group antigens (Monteiro et al., 2000Go). Recently, H. pylori strains from asymptomatic hosts were shown to express extended DD-heptoglycan chains and lack the O-chain polysaccharide with histo-blood group structures (Monteiro et al., 2001Go). In contrast, the LPS structure from H. pylori strain PJ2 is clearly unique. To our knowledge, this is the first reported case of the LPS from a nontypable strain of H. pylori devoid of O-chain and DD-heptoglycan yet still able to express an {alpha}1,6-glucan chain. In comparison to other H. pylori strains examined, the length of this polymer in PJ2 is considerably extended reaching up to 11 monosaccharide units. This may reflect the inability of this strain to synthesise either a DD-heptoglycan and/or Le antigen. The presence of this longer {alpha}1,6-glucan may indeed substitute for the lack of the other extending structures and facilitate colonization by this strain.

Previous studies have demonstrated that H. pylori strains with mutations in both 1,3-fucosyltransferase genes were able to colonize mouse stomach, suggesting that Lex and Ley antigen expression was not required for gastric colonization (Takata et al., 2002Go). Suresh and colleagues (2000)Go have also noted colonization of Balb/c and C57 mice by Le antigen–negative H. pylori strains. However, in these cases, the LPS structure presented on the cell surface remained uncharacterized. We now extend this work to show that the presence of neither O-chain polylactosamine backbone nor an extended DD-heptoglycan is a prerequisite for colonization in a murine model. This study indicates that the presence of a long glycan alone could be sufficient for successful gastric colonization and that nontypable strains of H. pylori expressing extended {alpha}1,6-glucans can colonize the murine stomach at a comparable level to Le antigen–producing strains. Whether these studies point to features of the H. pylori cell critical for colonization of human gastric epithelium remains to be established.

However, recent studies have addressed the role of H. pylori LPS, and in particular Le antigen expression, in adherence and internalization using in vitro and in vivo human tissue models (AGS cells, human xenografts in nude mice, and binding to human gastric sections) (Edwards et al., 2000Go; Lozniewski et al., 2003Go; Mahdavi et al., 2003Go). Studies on bacterial internalization in AGS cells by Lozniewski et al. (2003)Go provide evidence for a role of Le antigens in the internalization process for strains 26695, UA948, and UA1111. In contrast, a second study examining the role of Le antigens in bacterial adherence using human gastric epithelial cells indicated that they played only a minor role in adhesion and that adherence in this system was more likely related to the presence of the babA adhesin (Mahdavi et al., 2003Go). The ability to examine a natural H. pylori isolate devoid of fucosylated or nonfucosylated polylactosamine chains in the two aforementioned systems will be invaluable in determining the role of Le antigens in both adhesion and internalization processes in human gastric epithelial cells.

It has been shown that 80% of cagA+ H. pylori strains express Lex or Ley and that half of them express both (Wirth et al., 1996Go). Heneghan et al. (2000)Go reported that in patients with H. pylori–related chronic gastritis, a significant relationship was found between the amount of bacterial Lex and Ley expression and the neutrophil and lymphocyte infiltration. Other studies have shown that neutrophils are a potential target recognized by anti-Lex antibodies (Appelmelk et al., 1996Go). It was shown in this analysis that PJ2 LPS was unable to express Lex and Ley epitopes; correspondingly, PCR analysis confirmed that the strain also appears to lack the cagA gene or that its sequence was significantly divergent. Because cagA+ isolates induce more inflammation than do cagA- isolates (Peek et al., 1996Go), it is plausible that the presence of Le antigens could be important for long-term colonization and pathology and that nontypable H. pylori strains expressing only an {alpha}1,6-glucan may indeed be unable to induce significant pathology yet are still capable of colonization. We are currently investigating if this is indeed the case for the PJ2 strain characterized in this study by utilizing the SCID mouse model of disease (Eaton et al., 1999Go).

Previous structural studies have shown that {alpha}1,6-glucan is produced by a majority of H. pylori strains expressing type 2 Lex and Ley antigens with an average reported glucan chain corresponding to three to four glucoses (Monteiro, 2001Go). Some strains are also capable of producing a longer {alpha}1,6-glucan chain (Altman, unpublished data). This study indicates that the ability to synthesize {alpha}1,6-glucan by H. pylori strains could be an important structural feature contributing to the successful colonization of the gastric mucosa by all H. pylori isolates, and the presence of other additional LPS structures contributes to the ensuing pathology of disease.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Bacterial strains and culture conditions
H. pylori strain PJ2 was a fresh clinical isolate. Helicobacter cells were grown at 37°C on antibiotic supplemented (Lee et al., 1997Go) trypticase soy agar plates containing 7% horse blood (Glaxo selective supplement agar; GSS agar) in a microaerophilic environment for 48 h. For growth in liquid culture, antibiotic supplemented Brucella broth containing 10% fetal bovine serum was inoculated with H. pylori cells harvested from 48 h trypticase soy agar/horse blood plates and incubated for 36 h in a Trigas incubator (Nuaire, Plymouth, MN) (85% N2, 10% CO2, 5% O2) on a shaking platform.

Electrophoresis and western blotting
SDS–PAGE was performed with a mini-slab gel apparatus (Bio-Rad, Hercules, CA) by the method of Laemmli (1970)Go. LPS samples were loaded in each lane and stained according to Tsai and Frasch (1982)Go or transferred to nitrocellulose for immunological detection with anti-Le monoclonal antibodies (Signet Laboratories, Dedham, MA) as previously described (Logan et al., 2000Go).

LPS isolation and delipidation
LPS was isolated by the hot phenol-water extraction procedure (Westphal et al., 1965Go) and, following the removal of insoluble material by low-speed centrifugation, purified by ultracentrifugation (105,000 x g, 4°C, 12 h).

Purified LPS (20 mg) was hydrolyzed in 0.1 M sodium acetate buffer, pH 4.2, for 2 h at 100°C; the solution was cooled; and the precipitated lipid A was removed by low-speed centrifugation. The supernatant solution was lyophilized, and water-soluble components were fractionated by gel filtration on a Bio-Gel P-2 column (1.6 cm x 95 cm) equilibrated with pyridinium acetate (0.02 M, pH 5.4). Elution was performed with pyridinium acetate (0.02 M, pH 5.4). The fractions (1 ml) were monitored for neutral glycoses (Dubois et al., 1956Go) and those giving positive reaction were combined and lyophilized.

Sugar composition and methylation analyses
Sugar composition analysis was performed by the alditol acetate method (Sawardeker et al., 1967Go). The hydrolysis was done in 4 M trifluoroacetic acid at 100°C for 4 h or 2 M trifluoroacetic acid at 100°C for 16 h followed by reduction in H2O with NaBH4 and subsequent acetylation with acetic anhydride/pyridine. Alditol acetate derivatives were analyzed by gas-liquid chromatography (GLC) MS using a Hewlett-Packard chromatograph equipped with a 30 m DB-17 capillary column [210°C (30 min) to 240°C at 2°C/min] and MS spectra in the electron impact mode were recorded using a Varian Saturn II mass spectrometer. Methylation linkage analysis was carried out by the NaOH/dimethyl sulfoxide/CH3I procedure (Ciucanu and Kerek, 1984Go) and with characterization of permethylated alditol acetate derivatives by GLC-MS in the electron impact mode (DB-17 column, isothermally at 190°C for 60 min).

FAB-MS
A fraction of the methylated sample was used for positive ion FAB-MS performed on a JEOL JMS-AX505H mass spectrometer with glycerol-thioglycerol (1:3) as the matrix. A 6 kV xenon beam was used to produce pseudo-molecular ions that were then accelerated to 3 kV and their mass analyzed. Product ion scan (B/E) and precursor ion scan (B2/E) were performed on metastable ions created in the first free field with a source pressure of 5 x 10-5 torr.

ES-MS
Samples were analyzed on a crystal Model 310 CE instrument (ATI Unicam, Boston, MA) coupled to an API 3000 mass spectrometer (Applied Biosystems/Sciex, Concord, ON) via a micro-ionspray interface. A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1 µl/min to a low dead volume tee (250 µm ID, Chromatographic Specialties, Brockville, Canada). All aqueous solutions were filtered through a 0.45-µm filter (Millipore, Bedford, MA) before use. An electrospray stainless steel needle (27-gauge) was butted against the low dead volume tee and enabled the delivery of the sheath solution to the end of the capillary column. The separations were obtained on about 90 cm length bare fused-silica capillary using 10 mM ammonium acetate/ammonium hydroxide in deionized water, pH 9.0, containing 5% methanol. A voltage of 25 kV was typically applied at the injection. The outlet of the capillary was tapered to ~15 µm ID using a laser puller (Sutter Instruments, Novato, CA). Mass spectra were acquired with dwell times of 3.0 ms per step of 1 m/z unit in full-mass scan mode. Accurate masses were determined using internal standartization on a Q-Star quadropole/time-of-flight instrument (Applied Biosystems/Sciex). The mass spectra resolution (half-height definition) was 7,000.

PCR analysis of cagA and vacA
Amplifications were performed on a 9600 Thermocycler (Perkin Elmer, Canada) using Pwo polymerase (Roche) with the following cycling profiles: for cagA DZ3 and R009, 94°C for 3 min, 94°C for 30 s, 50°C for 30 s, 72°C for 60 s, for 30 cycles, followed by an extension at 72°C for 10 min 30 s; for cagA D008 and R008: 94°C for 3 min, 94°C for 30 s, 60°C for 30 s, 72°C for 60 s for 30 cycles, followed by an extension at 72°C for 10 min; for vacA 1-F and 1-R: 94°C for 3 min, 94°C for 30 s, 53°C for 30 s, 72°C for 60 s for 30 cycles, followed by an extension at 72°C for 10 min.

Mouse colonization
Specific pathogen-free female CD1 mice were purchased from Charles Rivers Laboratories (Montreal, Quebec) when they were 6–8 weeks old. Mice were maintained and used in accordance with the recommendations of the Canadian Council on Animal Care Guide to the Care and Use of Experimental Animals (1993). Mice were inoculated with bacteria harvested from 36 h broth culture. Aliquots of 0.2 ml, containing approximately 108 bacteria resuspended in phosphate buffered saline (PBS) were given by gavage directly into the gastric lumen using a 20 g gavage needle. Three inocula were given over a period of 6 days. No attempt was made to neutralize gastric acidity prior to inoculation. To recover viable bacteria from the stomach, mice were killed by CO2 asphyxiation, and their stomachs were removed whole. Stomachs were cut open along the greater curvature, and the exposed lumenal surface was gently irrigated with 10 ml sterile PBS, delivered via a syringe fitted with a 20 g gavage needle, to dislodge the loosely adherent stomach contents. This step effectively diminished the small numbers of ubiquitous contaminating bacteria that otherwise overgrow on GSS agar to thereby mask the presence of the slower-growing H. pylori organisms. The washed stomach tissue was then homogenized, and serial dilutions plated on GSS agar. H. pylori colonies were counted following 3–6 days incubation.


    Acknowledgements
 
We thank Suzon Larocque for recording NMR spectra, Ken H. Chan for FAB-MS, and Blair Harrison for enzyme-linked immunosorbent assay. This research was funded in part by GlycoDesign, Inc. This article was presented in part at the 7th Annual Conference of the Society for Glycobiology, Boston, MA.


    Footnotes
 
1 To whom correspondence should be addressed; e-mail: eleonora.altman{at}nrc.ca Back


    Abbreviations
 
cagA, the cytotoxin-associated antigen; CZE-ES-MS, capillary zone electrophoresis electrospray mass spectrometry; FAB-MS, fast atom bombardment mass spectrometry; GLC, gas liquid chromatography; GSS agar, Glaxo selective supplement agar; Le, Lewis; LPS, lipopolysaccharide; MS, mass spectrometry; MS/MS, tandem mass spectrometry; NMR, nuclear magnetic resonance; PBS, phosphate buffered saline; PCR, polymerase chain reaction; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; vacA, vacuolating cytotoxin


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Appelmelk, B.J., Simoons-Smit, I., Negrini, R., Moran, A.P., Aspinall, G.O., Forte, J.G., de Vries, T., Quan, H., Verboom, T., Maaskant, J.G., and others. (1996) Potential role of molecular mimicry between Helicobacter pylori lipopolysaccharide and host Lewis blood group antigens in autoimmunity. Infect. Immun., 64, 2031–2040.[Abstract/Free Full Text]

Appelmelk, B.J., Negrini, R., Moran, A.P., and Kuipers, E.J. (1997) Molecular mimicry between Helicobacter pylori and the host. Trends Microbiol., 5, 70–73.[CrossRef][Web of Science][Medline]

Blaser, M.J. (1999) Hypothesis: the changing relationships of Helicobacter pylori and humans: implications for health and disease. J. Infect. Dis., 179, 1523–1530.[CrossRef][Web of Science][Medline]

Ciucanu, I. and Kerek, F. (1984) A simple and rapid method for the permethylation of carbohydrates. Carbohydr. Res., 131, 209–217.[CrossRef]

Covacci, A. and Rappuoli, R. (1996) PCR amplification of gene sequences from Helicobacter strains. In Lee, A. and Megraud, F. (Eds.), Helicobacter pylori: techniques for clinical diagnosis and basic research. Saunders, London, pp. 96–102.

Covacci, A., Telford, J.L., Del Guidice, G., Parsonnet, J., and Rappuoli, R. (1999) Helicobacter pylori virulence and genetic geography. Science, 284, 1328–1333.[Abstract/Free Full Text]

Cover, T.L., Tummuru, M.K., Cao, P., Thompson, S.A., and Blaser, M.J. (1994) Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains. J. Biol. Chem., 269, 10566–10573.[Abstract/Free Full Text]

Dubois, M., Gilles, K.A., Hamilton, J.K., Revers, P.A., and Smith, F. (1956) Colorimetric method for the determination of sugars and related substances. Anal. Chem., 28, 350–356.[CrossRef]

Dunn, B.E., Cohen, H., and Blaser, M.J. (1997) Helicobacter pylori. Clin. Microbiol. Rev., 10, 720–741.[Abstract/Free Full Text]

Eaton, K.A., Ringler, S.R., and Danon, S.J. (1999) Murine splenocytes induce severe gastritis and delayed-type hypersensitivity and suppress bacterial colonization in Helicobacter pylori–infected SCID mice. Infect. Immun., 67, 4594–4602.[Abstract/Free Full Text]

Edwards, N.J., Monteiro, M.A., Faller, G., Walsh, E.J., Moran, A.P., Roberts, I.S., and High, N.J. (2000) Lewis x structures in the O-chain side-chain promote adhesion of Helicobacter pylori to the gastric epithelium. Mol. Microbiol., 35, 1530–1539.[CrossRef][Web of Science][Medline]

Heneghan, M.A., McCarthy, C.F., and Moran, A.P. (2000) Relationship of blood group determinants on Helicobacter pylori lipopolysaccharide with host Lewis phenotype and inflammatory response. Infect. Immun., 68, 937–941.[Abstract/Free Full Text]

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227, 680–685.[CrossRef][Medline]

Lee, A., O'Rourke, J., Corazon De Ungria, M., Robertson, B., Daskaolopoulos, G., and Dixon, M.F. (1997) A standardized mouse model of Helicobacter pylori infection: introducing the Sydney srain. Gastroenterology, 112, 1386–1397.[CrossRef][Web of Science][Medline]

Logan, S.M., Conlan, J.W., Montero, M.A., Wakarchuk, W.W., and Altman, E. (2000) Functional genomics of Helicobacter pylori: identification of a ß-1,4 galactosyltransferase and generation of mutants with altered lipopolysaccharide. Mol. Microbiol., 35, 1156–1167.[CrossRef][Web of Science][Medline]

Lozniewski, A., Haristoy, X., Rasko, D.A., Hatier, R., Plénat, F., Taylor, D.E., and Angiori-Duprez, K. (2003) Influence of Lewis antigen expression by Helicobacter pylori on bacterial internalization by gastric epithelial cells. Infect. Immun., 71, 2902–2906.[Abstract/Free Full Text]

Mahdavi, J., Borén,T., Vandenbroucke-Grauls, C., and Appelmelk, B.J. (2003) Limited role of lipopolysaccharide Lewis antigens in adherence of Helicobacter pylori to the human gastric epithelium. Infect. Immun., 71, 2876–2880.[Abstract/Free Full Text]

Monteiro, M.A. (2001) Helicobacter pylori: a wolf in sheep's clothing: the glycotype families of Helicobacter pylori lipopolysaccharides expressing histo-blood groups: structure, biosynthesis, and role in pathogenesis. Adv. Carbohydr. Chem. Biochem., 57, 99–158.[Web of Science][Medline]

Monteiro, M.A., Appelmelk, B.J., Rasko, D. A., Moran, A.P., Hynes, S.O., MacLean, L.L., Chan, K.H., St Michael, F., Logan, S.M., O'Rourke, J., and others. (2000) Lipopolysaccharide structures of Helicobacter pylori genomic strains 26695 and J99, mouse model H. pylori Sydney strain, H. pylori P466 carrying sialyl Lewis X, and H. pylori UA915 expressing Lewis B: classification of H. pylori. Eur. J. Biochem., 267, 305–320.[Web of Science][Medline]

Monteiro, M.A., St Michael, F., Rasko, D.A., Taylor, D.E., Conlan, J.W., Chan, K.H., Logan, S.M., Appelmelk, B.J., and Perry, M.B. (2001) Helicobacter pylori from asymptomatic hosts expressing heptoglycan but lacking Lewis O-chains: Lewis blood-group O-chains may play a role in Helicobacter pylori induced pathology. Biochem. Cell Biol., 79, 449–459.[CrossRef][Web of Science][Medline]

Moran, A.P., Prendergast, M.M., and Appelmelk, B.J. (1996) Molecular mimicry of host structures by bacterial lipopolysaccharides and contribution to disease. FEMS Immunol. Med. Microbiol., 16, 105–115.[CrossRef][Web of Science][Medline]

Peek, R.M. Jr., Miller, G.G., Tham, K.T., Perez-Perez, G.I., Zhao, X., Atherton, J.C., and Blaser, M.J. (1996) Heightened inflammatory response and cytokine expression in vivo to cagA+ Helicobacter pylori strains. Lab. Invest., 71, 760–770.

Sakamoto, J., Watanabe, T., Tokumaru, H., Takagi, H., Nakazato, H., and Lloyd, K.O. (1989) Expression of Lewisa, Lewisb, Lewisx, sialyl-Lewisa, sialyl-Lewisx blood group antigens in human gastric carcinoma and in normal gastric tissue. Cancer Res., 49, 745–752.[Abstract/Free Full Text]

Sawardeker, J.H., Sloneker, J.H., and Jeannes, A. (1967) Quantitative determination of monosaccharides as their alditol acetates by gas liquid chromatography. Anal. Chem., 39, 1602–1604.[Medline]

Sherburne, R. and Taylor, D.E. (1995) Helicobacter pylori expresses a complex surface carbohydrate, Lewis X. Infect. Immun., 63, 4564–4568.[Abstract/Free Full Text]

Suresh, M.R., Fanta, M.B., Kriangkum, J., Jiang, Q., and Taylor, D.E. (2000) Colonization and immune responses in mice to Helicobacter pylori expressing different Lewis antigens. J. Pharm. Pharmaceut. Sci., 3, 259–266.[Medline]

Takata, T., El-Omar, E., Camorlinga, M., Thompson, S.A., Minohara, Y., Ernst, P.B., and Blaser, M. (2002) Helicobacter pylori does not require Lewis X or Lewis Y expression to colonize C3H/HeJ mice. Infect. Immun., 70, 3073–3079.[Abstract/Free Full Text]

Tsai, C.M. and Frasch, C.E. (1982) A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem., 119, 115–119.[CrossRef][Web of Science][Medline]

Westphal, O. and Jann, K. (1965) Bacterial lipopolysaccharides. Extraction with phenol-water and further applications of the procedure. Meth. Carbohydr. Chem., 5, 83–91.

Wirth, H.-P., Yang, M., Karita, M., and Blaser, M.J. (1996) Expression of the human cell surface conjugates Lewis X and Lewis Y by Helicobacter pylori isolates is related to CagA status. Infect. Immun., 64, 4598–4605.[Abstract/Free Full Text]

Xiang, Z., Censini, S., Bayeli, P.F., Telford, J.L., Figura, N., Rappuoli, R., and Covacci, A. (1995) Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin. Infect. Immun., 63, 94–98.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
B. Ma, J. L. Simala-Grant, and D. E. Taylor
Fucosylation in prokaryotes and eukaryotes
Glycobiology, December 1, 2006; 16(12): 158R - 184R.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Ma, G. F. Audette, S. Lin, M. M. Palcic, B. Hazes, and D. E. Taylor
Purification, Kinetic Characterization, and Mapping of the Minimal Catalytic Domain and the Key Polar Groups of Helicobacter pylori {alpha}-(1,3/1,4)-Fucosyltransferases
J. Biol. Chem., March 10, 2006; 281(10): 6385 - 6394.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. Hiratsuka, S. M. Logan, J. W. Conlan, V. Chandan, A. Aubry, N. Smirnova, H. Ulrichsen, K. H. N. Chan, D. W. Griffith, B. A. Harrison, et al.
Identification of a D-glycero-D-manno-Heptosyltransferase Gene from Helicobacter pylori
J. Bacteriol., August 1, 2005; 187(15): 5156 - 5165.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
R. Langdon, J. E Craig, M. Goldrick, R. Houldsworth, and N. J High
Analysis of the role of HP0208, a phase-variable open reading frame, and its homologues HP1416 and HP0159 in the biosynthesis of Helicobacter pylori lipopolysaccharide
J. Med. Microbiol., August 1, 2005; 54(8): 697 - 706.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
S. M. Logan, E. Altman, O. Mykytczuk, J.-R. Brisson, V. Chandan, F. St. Michael, A. Masson, S. Leclerc, K. Hiratsuka, N. Smirnova, et al.
Novel biosynthetic functions of lipopolysaccharide rfaJ homologs from Helicobacter pylori
Glycobiology, July 1, 2005; 15(7): 721 - 733.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. A. Eaton, S. M. Logan, P. E. Baker, R. A. Peterson, M. A. Monteiro, and E. Altman
Helicobacter pylori with a Truncated Lipopolysaccharide O Chain Fails To Induce Gastritis in SCID Mice Injected with Splenocytes from Wild-Type C57BL/6J Mice
Infect. Immun., July 1, 2004; 72(7): 3925 - 3931.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/11/777    most recent
cwg106v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Altman, E.
Right arrow Articles by Logan, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Altman, E.
Right arrow Articles by Logan, S. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?