Glycobiology Advance Access originally published online on November 1, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Glycobiology, 2003, Vol. 13, No. 1 23-34
© 2003 Oxford University Press
Complex-type biantennary N-glycans of recombinant human transferrin from Trichoplusia ni insect cells expressing mammalian ß-1,4-galactosyltransferase and ß-1,2-N-acetylglucosaminyltransferase II
2 Department of Biology, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218, USA
3 Department of Molecular Biology, University of Wyoming, P.o. Box 3944, Laramie, WY 82071-3944, USA
4 Department of Chemical Engineering, Johns Hopkins University,3400 North Charles Street, Baltimore, MD 21218, USA
5 Department of Biology, Temple University, 1900 North 12th Street, Philadelphia, PA 19122, USA
Received on July 21, 2002; revised on August 29, 2002; accepted on September 5, 2002
| Abstract |
|---|
|
|
|---|
A novel recombinant baculovirus expression vector was used to produce His-tagged human transferrin in a transformed insect cell line (Tn5ß4GalT) that constitutively expresses a mammalian ß-1,4-galactosyltransferase. This virus encoded the His-tagged human transferrin protein in conventional fashion under the control of the very late polyhedrin promoter. In addition, to enhance the synthesis of galactosylated biantennary N-glycans, this virus encoded human ß-1,2- N-acetylglucosaminyltransferase II under the control of an immediate-early (ie1) promoter. Detailed analyses by MALDI-TOF MS, exoglycosidase digestion, and two-dimensional HPLC revealed that the N-glycans on the purified recombinant human transferrin produced by this virushost system included four different fully galactosylated, biantennary, complex-type glycans. Thus, this study describes a novel baculovirushost system, which can be used to produce a recombinant glycoprotein with fully galactosylated, biantennary N-glycans.
Key words: HPLC / insect / N-glycan / MALDI-TOF MS
| Introduction |
|---|
|
|
|---|
The baculovirus expression vector (BEV) system is widely used for the production of recombinant glycoproteins. Unlike mammalian cells, however, established insect cell lines are generally incapable of synthesizing terminally sialylated, complex-type N-glycans. The N-glycans of glycoproteins produced by insect cells consist principally of high mannose and paucimannosidic structures (Altmann et al., 1999
Recently, four transgenic insect cell lines derived from established Spodoptera frugiperda (Sf9; Vaughn et al., 1977
) or Trichoplusia ni (Tn-5B1-4, also known as High Five; Wickham et al., 1992
) cell lines were described: Sfß4GalT cells (Hollister et al., 1998
) and Tn5ß4GalT cells (Breitbach and Jarvis, 2001
) stably expressing mammalian ß4GalT; Sfß4GalT/ST6 cells (Hollister and Jarvis, 2001
) and Tn5ß4GalT/ST6 cells (Breitbach and Jarvis, 2001
) stably expressing ß4GalT and
-2,6-sialyltransferase. Previous studies using lectin blotting and high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) analyses demonstrated that stable expression of ß4GalT and
-2,6-sialyltransferase in Sfß4GalT/ST6 cells led to terminal galactosylation and sialylation of the N-glycans on baculoviral and heterologous glycoproteins (Hollister and Jarvis, 2001
). It was also demonstrated that transient coexpression of a mammalian ß4GalT by infection of Tn-5B1-4 cells with an immediate-early BEV (Jarvis and Finn, 1996
) led to higher terminal galactosylation and lower amounts of paucimannosidic N-glycans on human transferrin (Ailor et al., 2000
).
Interestingly, the terminal galactose was always found on the GlcNAcß(1,2)Man
(1,3)Manß branch of the elongated N-glycans produced by these virushost systems. The inability of these systems to galactosylate the Man
(1,6) branch appeared to be related to the general absence of terminal GlcNAc on this same branch. In fact, Ailor and colleagues (2000)
found that less than 1% of all the N-glycans from recombinant human serum transferrin (hTf) had a terminal GlcNAc residue on the Man
(1,6) branch. Therefore, we created a novel baculovirushost system designed to provide the glycosyltransferase activities needed to elongate the Man
(1,6) branch of N-glycans by the addition of both N-acetylglucosamine and galactose. This system consists of Tn5ß4GalT cells, which constitutively express a stably integrated bovine ß4GalT cDNA (Breitbach and Jarvis, 2001
), and Ac10KIEGnTII-hTfHIS, a novel BEV that encodes human GlcNAcT-II under the control of the ie1 promoter and a His-tagged form of hTf under the control of the polyhedrin promoter. Using this system, both transferase genes were expressed during the early stages of infection, and the hTf gene was expressed during the very late stage of infection. The recombinant glycoprotein produced by this system was purified, and its major N-glycans were isolated and analyzed using a two-dimensional high-performance liquid chromatography (HPLC) mapping technique (Tomiya et al., 1988
) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). The results demonstrated that the novel virushost system described in this study could elongate the Man
(1,6) branch and produce biantennary N-glycans terminating with galactose on both branches.
| Results |
|---|
|
|
|---|
Construction and characterization of Ac10KIEGnTII-hTfHIS
The novel BEV used in this study was designed to express recombinant human GlcNAcT-II during the early phase and His-tagged transferrin during the very late phase of infection, so that the former enzyme activity would be available to modify the N-glycans of the latter. This virus was created in a series of steps, the first of which involved placing the human GlcNAcT-II (Tan et al., 1995
|
The resulting transfer plasmid was used to introduce the ie1-GlcNAcT-II gene into the p10 region of Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) and produce an intermediate virus called Ac10KIEGnTII. The genetic structure of this virus was confirmed by Southern blotting and polymerase chain reaction (PCR) analyses, as described in Materials and methods. In addition, one-step growth curve experiments were performed to determine if deletion of the p26 and p10 genes from Ac10KIEGnTII adversely influenced its in vitro replication. The results showed that the in vitro growth curves of Ac10KIEGnTII and wild-type AcMNPV were virtually identical (data not shown ). Finally, the ability of Ac10KIEGnTII to express the GlcNAcT-II gene and induce this activity in cultured insect cells was examined, as described in Materials and methods.
Ac10KIEGlcNAcTII clearly expressed the gene and induced GlcNAcT-II activity, with a plateau at about 24 h, which was maintained until at least 72 h postinfection (Figure 2). There was no detectable GlcNAcT-II activity in AcMNPV-infected insect cells, as the apparent activity observed in these cells was not significantly higher than the background of the assay, which was established using boiled cell lysates (data not shown). Subsequently, a polyhedrin-driven Escherichia coli LacZ gene and two additional Bsu36I sites were introduced into the polyhedrin region of Ac10KIEGnTII. Then the polyhedrin-driven His-tagged human transferrin gene was introduced into the polyhedrin region of the resulting virus to produce Ac10KIEGnTII-hTfHIS, which was the final BEV used for this study.
|
The results of our analyses of Ac10KIEGnTII, together with the results of Southern blotting, PCR, and biochemical analyses of Ac10KIEGlcNAcTII-hTfHIS, demonstrate that the new BEV used in this study encodes GlcNAcT-II activity, which is expressed before and during the very late phase of infection (about 2472 h postinfection), and the His-tagged hTf protein, which is expressed only during the very late phase of infection (Figure 2 and data not shown).
Expression of recombinant hTf in transgenic insect cells
A previously described transgenic insect cell line, Tn5ß4GalT (Breitbach and Jarvis, 2001
), was used as the host for the production of recombinant hTf by TnAc10KIEGnTII-hTfHIS. This cell line is a stably transformed derivative of Tn-5B1-4 (Wickham et al., 1992
) and contains genomic copies of a bovine ß4GalT gene, which is constitutively expressed under ie1 control. Thus, the novel aspect of this study was the development and use of a new BEVhost system designed to provide elevated levels of two glycosyltransferase activities necessary for the production of biantennary N-glycans. The hTf protein encoded by Ac10KIEGnTII-hTfHIS was engineered with a carboxy-terminal tag consisting of the V5 epitope and six histidine residues to facilitate its purification. At 60 h postinfection, the growth medium of the Ac10KIEGnTII-hTfHIS-infected Tn5ß4GalT cells contained approximately 7 mg/L recombinant hTf. This product was isolated by multiple chromatography steps to apparent homogeneity.
Monosaccharide composition of recombinant hTf expressed in Tn5ß4GalT cells infected with Ac10KIEGnTII-hTfHIS
The monosaccharide composition of the purified recombinant hTf revealed that the glycans isolated from the hTf produced by Tn5ß4GalT cells infected with Ac10KIEGlcNAcTII-hTfHIS contained significantly higher amounts of GlcN (7.7 versus 3.2 mol/mol) and Gal (3.4 versus 0.7 mol/mol), as compared to the hTf produced by untransformed Tn-5B1-4 cells infected with a conventional BEV, which included no mammalian glycosyltransferase genes (Table I). These large increases in Gal and GlcN content were not observed with His-tagged hTf from Tn-5B1-4 cells (data not shown), indicating that the addition of the hexa-histidine tag was not responsible for the differences in monosaccharide compositions. The data also indicate that both of the two potential N-glycosylation sites in hTf (Asn413 and Asn611) were efficiently glycosylated.
|
Detailed structural analysis of the N-glycans from recombinant hTf produced by Ac10KGnTII-hTfHIS-infected Tn5ß4GalT cells
Recombinant hTf was isolated from the growth medium of Ac10KIEGnTII-hTfHIS-infected Tn5ß4GalT cells, and N-glycans were released with glycoamidase A (from sweet almond). The released N-glycans were reductively aminated with 2-aminopyridine and the pyridilamino (PA)-glycans were analyzed first by reversed-phase HPLC (Figure 3). Each of the separated fractions from the reversed-phase column (A through Q) was then resolved by normal-phase HPLC using an amide-silica column. The results from the two columns generated a 2D map of the PA-glycans from recombinant hTf (Figure 4). Five major peaks designated E', F', J', L', and Q' were observed using fractions E, F, J, L, and Q from the first column (Figure 4). The sum of E', F', J', L', and Q' accounted for about 70% of the total PA-glycans.
|
|
|
MALDI-TOF MS analysis of major PA-glycans
MALDI-TOF MS was used to confirm the monosaccharide compositions of the five major glycan species observed by 2D HPLC analysis (Figure 4). The MALDI-TOF MS results obtained with each species are shown in Table II, together with their deduced monosaccharide compositions. The molecular mass of PA-glycan E' ([M+Na]+ = 1333.9) confirmed that it is a high-mannose glycan with five Man residues. The molecular mass of PA-glycan J' ([M+Na]+ = 1741.3) suggested that it is a biantennary, digalactosylated glycan. The molecular mass of PA-glycans F' and Q' was identical ([M+Na]+ = 1888.0) and consistent with the presence of one Fuc residue on PA-glycan J'. The molecular mass of PA-glycan L' ([M+Na]+ = 2034.9) suggested that it had the same structure as PA-glycan J' plus two Fuc residues.
|
Structural characterization of PA-glycans using a 2D mapping technique
A 2D mapping technique (Tomiya et al., 1988
-L-fucosidase, and the products of each digestion were analyzed by HPLC on ODS and Amide-80 columns. The elution positions (expressed as glucose units, GU) of the intact and enzyme-treated PA-glycans were then plotted on a 2D map (Figure 5) and compared with those of authentic reference PA-glycans.
|
The coordinates of intact PA-glycan E' coincided with reference PA-glycan IX (Table III). The elution position of this glycan did not change by sequential exoglycosidase digestion with ß-galactosidase, ß-N-acetylhexosaminidase, and
-L-fucosidase. These results support the results from MALDI-TOF MS (Table II) and the proposed structure for PA-glycan E' shown in Table III. The coordinates of intact PA-glycan J' were coincidental with those of reference PA-glycan VII (Table III). The ß-galactosidase digestion product of PA-glycan J' coincided with reference PA-glycan V, and the ß-N-acetylhexosaminidase digestion product was indistinguishable from reference PA-glycan III. Therefore, PA-glycan J' is the digalactosylated, biantennary N-glycan shown in Table III.
The coordinates of intact PA-glycan Q' coincided with those of reference PA-glycan VIII. ß-galactosidase digestion altered the coordinates to match those of reference PA-glycan VI, and subsequent digestion with ß-N-acetylhexosaminidase generated a product PA-glycan indistinguishable from reference PA-glycan IV. Subsequent digestion with
-L-fucosidase yielded a product that coincided with the reference trimannosyl core PA-glycan III. These results indicate that PA-glycan Q' is a digalactosylated, biantennary N-glycan containing
1-6-linked Fuc, as shown in Table III.
The coordinates of PA-glycan F' (8.2 GU on ODS and 7.8 GU on amide-silica) did not correspond to any reference PA-glycan (Tomiya and Takahashi, 1998
). After sequential digestion with ß-galactosidase and ß-N-acetylhexosaminidase, the product coordinates coincided with those of reference PA-glycan II (Table III). This result indicates that PA-glycan F' has the core structure II in Table III. Fuc
(1-3)GlcNAcß-Asn is known to be more difficult to cleave with
-L-fucosidase than Fuc
-(1-6)GlcNAcßAsn- (Takahashi et al., 1999
). However, digestion of PA-glycan F' with a large amount of
-L-fucosidase (100 mU, 20 h at 37°C) yielded a product with the same coordinates as PA-glycan J' and reference PA-glycan VII. These results indicate that PA-glycan F' has the structure shown in Table III.
Like PA-glycan F', PA-glycan L' also had unique coordinates on the 2D map, with no corresponding reference PA-glycan. After sequential digestion with ß-galactosidase and ß-N-acetylhexosaminidase, the product coordinates coincided with those of reference PA-glycan I. This indicates that PA-glycan L' has the core structure I shown in Table III. Subsequent digestion with
-L-fucosidase (20 mU, 20 h at 37°C) generated a secondary product that coincided with reference PA-glycan II. In addition, digestion of PA-glycan L' with a large amount of
-L-fucosidase (100 mU, 20 h at 37°C) generated a new product identical to reference PA-glycan VII. These results indicate that PA-glycan L' is identical to PA-glycan J', but also has both
1-3Fuc and
1-6Fuc.
Each of the structural assignments for PA-glycans E', F', J', L', and Q' presented were completely consistent with the results of the MALDI-TOF MS analyses. Table III summarizes the structures of the five major N-glycans isolated from the recombinant hTf expressed by Ac10KIEGntII-hTfHIS-infected Tn5ß4GalT cells and shows the relative abundance of each species as molar percentages of the total N-glycans.
| Discussion |
|---|
|
|
|---|
Previously we have reported that the recombinant hTf produced by Tn-5B1-4 cells coinfected with AcNPV-hTf, which encodes hTf under polyhedrin control, and AcP(+)IE1GalT, which encodes bovine mammalian ß4GalT under ie1 control, contained 62% high-mannose glycans (Man59GlcNAc2), 18% paucimannosidic glycans, and 16% incomplete complex-type glycans (Ailor et al., 2000
(1,3) branch and 80% of the GlcNAc residues on this branch were galactosylated. In contrast, only 0.7% of the N-glycans had GlcNAcß(1,2) on the Man
(1,6) branch, despite the availability of a substantial amount of acceptor substrate for GlcNAcT-II. Because Tn-5B1-4 cells have a high level of UDP-GlcNAc (Tomiya et al., 2001
(1,6) branch appeared to be due to a limitation in GlcNAcT-II activity in T. ni insect cells.
In the present study, Tn5ß4GalT cells were used as the host for the production of His-tagged hTf under the control of the polyhedrin promoter following infection with a novel BEV called Ac10KIEGnTII-hTfHIS. Tn5ß4GalT cells constitutively express a stably integrated mammalian ß4GalT gene (Hollister and Jarvis, 2001
). Ac10KIEGnTII-hTfHIS was engineered to express a mammalian GlcNAcT-II gene during the immediate early phase of infection to promote the addition of GlcNAc to the Man
(1,6) arm of N-glycans on the recombinant His-tagged hTf produced during the very late phase of infection. Because it is known that Tn-5B1-4 cells are known to add fucose through both
-1,3 and
-1,6 linkages (Ailor et al., 2000
; Hsu et al., 1997
), and that glycoamidase A, but not PNGase F, is able to remove glycans containing fucose with the
-1,3 linkage (Altmann et al., 1995a; Fan and Lee, 1997
), structural analyses were performed on the N-glycan mixture released with glycoamidase A. The 2D mapping and MALDI-TOF MS data revealed the presence of a single high-mannose N-glycan species (17%), as well as four complex-type N-glycans (52%; Table III). The characteristics of N-glycan processing in Ac10KIEGnTII-hTfHIS-infected Tn5ß4GalT cells are summarized later and illustrated in Figure 6.
|
Processing of high-mannose N-glycans
Aside from Man5GlcNAc2, the main high-mannose type glycan, only small amounts (each less than 2%) of Man69 GlcNAc2 structures were detected by 2D HPLC (data not shown). Because paucimannosidic and complex N-glycans are generated from Man5GlcNAc2, the total amount of these glycans plus Man5GlcNAc2 (more than 70%) represents the total flux into pathway P2 in Figure 6. These results demonstrate that Tn5ß4GalT cells can efficiently process high-mannose N-glycans (pathway 1) to generate the acceptor substrate (Man5GlcNAc2) for endogenous ß-1,2-N-acetylglucosaminyltransferase I (GlcNAcT-I).
Addition of GlcNAc to the Man
(1,3) branch by GlcNAcT-I and processing by
-mannosidase II
The four major complex-type N-glycans detected in this study, which accounted for 52% of the total N-glycans, all had GlcNAc on the Man
(1,3) arm. This result indicates that Tn5ß4GalT cells have significant levels of endogenous GlcNAcT-I activity. Even so, 17% of the total N-glycans were unprocessed Man5GlcNAc2. Thus, although the endogenous GlcNAcT-I activity may indeed be substantial, this processing step may ultimately represent a bottleneck in Tn5ß4GalT cells.
N-acetylglucosaminylation of Man
(1,6) arm by GlcNAcT-II
The product N-glycan in the P3 processing step (Scheme 1), could serve as substrate for several enzymes (GlcNAcT-II, ß4GalT, core
-1,3-fucosyltransferase [Fuc-T C3], core
-1,6-fucosyltransferase [Fuc-T C6], and ß-N-acetylglucosaminidase). In the present study, we found that 52% of the total hTf N-glycans had GlcNAcß(1,2) on the Man
(1,6) branch, which was more than 70-fold (52% versus 0.7%) higher than that observed on hTf in the previous study (Ailor et al., 2000
). Thus, the ability of the novel BEV described in this study to express GlcNAcT-II clearly allowed utilization of endogenous UDP-GlcNAc and the production of biantennary, complex N-glycans. This result indicates that both GlcNAcT-II and UDP-GlcNAc are localized in sufficient quantities in the correct subcellular compartment (i.e., trans-Golgi).
|
Galactosylation of terminal GlcNAc
The major biantennary N-glycans were digalactosylated (Table III), and only small amounts of partially or nongalactosylated N-glycans were observed by 2D HPLC analyses (data not shown). This suggests that Tn5ß4GalT cells have high levels of both ß4GalT activity and UDP-Gal in the proper subcellular compartment (i.e., trans-Golgi) to enable complete galactosylation of newly synthesized glycoproteins. Indeed, we have observed that Tn-5B1-4 cells have significant levels of UDP-Gal (Tomiya et al., 2001
Fucosylation
It is known that many insect cells contain both core Fuc-T C3 and core Fuc-T C6 activities, although expression levels vary in different cell lines (Altmann et al., 2001
; Staudacher and Marz, 1998
). Both core Fuc-T's require an acceptor substrate with GlcNAcß(1,2) on the Man
(1,3) arm (Staudacher and Marz, 1998
). These enzymes can modify N-glycans to generate three types of fucosylated N-glycans, all of which were found in the present study (Table III). This indicates that Tn5ß4GalT cells have both Fuc-T C3 and Fuc-T C6 activities.
Generation of paucimannosidic structures
Some insect cells have a ß-N-acetylglucosaminidase specific for the terminal GlcNAc on the Man
(1,3) branch, which is thought to be responsible for production of the paucimannosidic N-glycans often found on insect cell expressed glycoproteins (Altmann et al., 1995b; Licari et al., 1993
). Previous studies demonstrated that galactosylation of the GlcNAcß(1,2)Man
(1,3) arm protects the terminal GlcNAc from the action of this enzyme and suppresses the production of paucimannosidic glycans. (Ailor et al., 2000
). However, as much as 18% of the N-glycans isolated from hTf produced by AcP(+)IEGalT-infected Tn-5B1-4 cells were still paucimannosidic structures, and those N-glycans represented about 50% of the total of both incomplete complex-type and paucimannosidic N-glycans. In contrast, the relative amounts of paucimannosidic glycans observed in this study, such as structures I, II, III, and IV in Table III, were much less than the amounts of complex-type N-glycans. This observed decrease in paucimannosidic structures and concomitant increase of the galactosylated, biantennary complex-type N-glycans probably reflected more efficient galactosylation and protection from the ß-N-acetylglucosaminidase. This is because the virushost system used in this study involved infection of transgenic cells, in which the ß4GalT gene was integrated into the chromosome with a single virus.
Sialylation
No significant levels of sialylated species were observed in this study when the released glycans were analyzed by HPAEC-PAD (data not shown). Like other insect cell lines, the sialylation potential of Tn5ß4GalT cells is clearly far below that required to efficiently synthesize terminally sialylated, complex N-glycans. This could be due to limitations in the endogenous levels of sialyltransferase activity (Hooker and James, 1998
; Lopez et al., 1999
) and/or CMP-sialic acids (Hooker et al., 1999
; Lawrence et al., 2001
; Tomiya et al., 2001
) in Tn5ß4GalT cells.
Conclusion
This study describes a novel baculovirushost cell system and shows that the use of this system resulted in the production of a recombinant human glycoprotein with significant levels of digalactosylated, biantennary, complex N-glycans. The efficient production of digalactosylated, biantennary N-glycans in this system was achieved by (1) efficient processing of high-mannose N-glycans to produce the acceptor substrate for GlcNAcT-I; (2) protection of GlcNAcß(1,2) on the Man
(1,3) branch by galactosylation, which suppressed the production of paucimannosidic structures; (3) increased production of GlcNAcT-II activity by the expression of a mammalian GlcNAcT-II gene during the immediate-early phase of infection; and (4) increased production of ß4GalT activity by expression of the integrated mammalian transgene in the Tn5ß4GalT cells.
| Materials and methods |
|---|
|
|
|---|
Materials
The following materials were obtained from the sources indicated: glycoamidase A (glycopeptidase A, EC 3.5.1.52) from sweet almond (Seikagaku America, Falmouth, MA); ß-galactosidase (jack bean), ß-N-acetylhexosaminidase (jack bean),
-L-fucosidase (bovine kidney), 2-aminopyridine, sodium cyanoborohydride, and apo-human transferrin (Sigma-Aldrich, St. Louis, MO); anti-human transferrin antibody (Dako, Carpinteria, CA); Sephadex G-15 (medium), N-hydroxysuccinimide-activated Sepharose 4 Fast Flow, DEAE-Sepharose 4 Fast Flow (Amersham Biosciences, Piscataway, NJ); Sep-Pak C18 cartridges (Millipore, Bedford, MA); HyQ SFX-Insect serum-free media was kindly provided by Hyclone (Logan, UT); Shim-pack CLC-ODS column (
6x150 mm; Shimadzu, Columbia, MD); Amide-80 column (
4.6x250 mm; Tosoh Biosep, Montgomeryville, PA); and enzyme-linked immunosorbent assay (ELISA) kit for human transferrin (Bethyl Labs, Montgomery, TX).
Reference PA-glycans
The PA-derivatives of isomalto-oligosaccharides (420 glucose residues) were prepared from an acid hydrolysate of dextran. PA-derivatized reference glycan I was prepared from hTf expressed by Tn-5B1-4 cells (Ailor et al., 2000
). PA-derivatized reference glycan II was prepared from reference PA-glycan I by partial digestion with
-L-fucosidase. Other PA-derivatized reference glycans IIIXIII were prepared as described previously (Tomiya et al., 1988
). The structures of the reference PA-glycans used in this study are shown in Table III.
Plasmid constructions
pAc10KIEGnTII
Bsu-repaired is a baculovirus transfer plasmid in which a human GlcNAcT-II cDNA (Tan et al., 1995
) is positioned under the transcriptional control of the AcMNPV ie1 promoter (Guarino and Summers, 1987
) and hr5 enhancer (Guarino et al., 1986
) and the chimeric ie1-hr5-GlcNAcT-II gene is embedded within sequences derived from the p10 region of the AcMNPV genome (Ayres et al., 1994
). This plasmid was constructed through a series of steps (Figure 1) that began with replacement of the EcoRV-BamHI fragment of pAcAS2 (Vlak et al., 1990
) with an EcoRV-BamHI fragment from pIE1HR3 (Jarvis et al., 1996
) to produce pAc10KIETV. In parallel, site-directed mutagenesis (Transformer kit; Clonetech Laboratories, Palo Alto, CA; Deng and Nickoloff, 1992
) was used to introduce a silent mutation into pHG30 (Tan et al., 1995
) to eliminate a Bsu36I site in the human GlcNAcT-II sequence. The mutated sequence was then PCR-amplified from the resulting plasmid, pHGNTII
Bsu, using sense (5'-TTACTAGTGGAGACCATGAGGTTCCGCATC-3') and antisense (5'-CCACTAGTGAAACCAGTTCCTAAACTC-3') primers that added SpeI sites to its 5' and 3' ends. The 1.44 kb amplification product was gel-purified and cloned into pCR 2.1 TOPO (Invitrogen, Carlsbad, CA), then excised with SpeI, gel-purified, and subcloned into the unique SpeI site downstream of the ie1 promoter in pAc10KIETV, producing pAc10KIE-GnTII
Bsu. Sequencing revealed that the GlcNAcTII
Bsu fragment in this plasmid contained one PCR error. Therefore, an internal KpnI-AvrII fragment containing this mutation was excised and replaced with the corresponding fragment from pHGNTII
Bsu, which contained no mutations, to produce the final baculovirus transfer plasmid, pAc10KIE- GnTII
Bsu-repaired.
Another baculovirus transfer plasmid constructed for this study, pAcP(-)TCBlue, has a polyhedrin-driven gene encoding a fusion protein composed of an N-terminal fragment of polyhedrin and an enzymatically active C-terminal fragment of E. coli ß-galactosidase. This construct was designed to introduce the polyhedrin-ßgal fusion gene and three Bsu36I sites, including one in the essential p74 gene, into the polyhedrin region of the AcMNPV genome. Briefly, this plasmid was constructed by using site-directed mutagenesis to introduce the Bsu36I sites near the polyhedrin ATG (new sequence is 5'-ATGCCTgAggAT-3', with mutations in lowercase) and the C-terminal end of the p74 open reading frame (new sequence is 5'-TTTATAATCcTTAGGGT-3', with mutation in lowercase) to produce an intermediate plasmid called pAcPoly-ATG/BBR5S. A BamHI fragment encoding a large C-terminal fragment of E. coli ß-galactosidase was then subcloned from pMC1871 (Shapira et al., 1983
) into the unique BamHI site of pAcPoly-ATG/BBR5S to create pAcP(-)TCBlue. This last manipulation introduced the C-terminal ß-galactosidase coding sequence downstream and in-frame with the sequence encoding the first 57 amino acids of polyhedrin, as well as the third Bsu36I site, which is located within the Lac Z gene.
The last baculovirus transfer plasmid constructed for this study was pBlueBac-hTfr-V5His, which encodes a His-tagged human transferrin cDNA under the transcriptional control of the AcMNPV polyhedrin promoter, embedded within sequences derived from the polyhedrin region of the viral genome. The human transferrin 2.1-kb coding region was amplified by PCR using pTfR27A (from American Type Culture Collection, a gift of J. Slavicek) as the template with the following primers: a forward primer (MB1), 5'-CACTACTAGTCACCCGGAAGATG-AGGCTCG, which included a SpeI site (italics) upstream of the initiator ATG (underscored), and a reverse primer (MB2), 5'-AGTG CTCGAGAGGTCTACGGAAACTGCAGG, which included an XhoI site (italics). PCR was performed in a 100-µl reaction using the following cycle settings: 94°C for1 min; 25 cycles at 94°C for 1 min, 55°C for 1.5 min, and 72°C for 2 min; a final extension at 72°C for 10 min; and hold at 4°C. PCR reagents were purchased from Applied Biosystems (Foster City, CA), and PCR was performed using an Applied Biosystems GeneAmp 2400 thermal cycler.
After digestion with the appropriate enzyme, the PCR product was ligated into the Drosophila expression system vector pMT/V5-His A (Invitrogen) to introduce an in-frame V5 epitope and 6x His tag, then the ligated construct was introduced into E. coli DH5-
cells. The human transferrinV5-His coding region was shuttled from pMT/V5-His A-hTfrV5His into the baculovirus expression plasmid pBlueBac4.5 (Invitrogen) by PCR amplification using the following primers: a forward primer (MB10), 5'-CACTGCTAGCCACCCGGAAGMATGAGGCTCG, which included a NheI restriction site (italics) upstream of the initiator ATG (underscored), and a reverse primer (MB11), AGTGAGATCTGCTGATCAGCGGGTTTA-AC, which included a BglII restriction site (italics) and terminated 23 bp past the terminal His codon. PCR amplification was performed as before except that only 12 cycles were used. The final construct, pBlueBac-hTfr-V5His, was sequenced to verify that no base changes had been introduced during PCR.
Cells and viruses
Sf9 (Vaughn et al., 1977
) and Tn5ß4GalT (Breitbach and Jarvis, 2001
) cells were routinely maintained as spinner cultures in TNM-FH medium (Summers and Smith, 1987
) containing 10% (v/v) fetal bovine serum (Hyclone) or in SFX-Insect serum-free medium (Hyclone). AcMNPV strain E2 (Summers and Smith, 1978
) was used as the wild-type baculovirus. Ac10KIEGnTII, Ac10KIEGnTII-TCBlue, and Ac10KIEGnTII-hTfHIS are new recombinant baculoviruses that were produced for this study. Ac10KIEGnTII was isolated by crossing genomic DNA from the recombinant baculovirus AcMNPV-MO21 (Martens et al., 1995
) with pAc10KIE-GnTII
Bsu-repaired. Prior to the cross, the AcMNPV-MO21 viral DNA was linearized with Bsu36I to facilitate recombination within the p10 region, as described previously (Martens et al., 1995
). Recombinant viruses were tentatively identified by dot-blot hybridization and confirmed by Southern blotting, as described previously (O'Reilly et al., 1992
; Summers and Smith, 1987
). Subsequently, genomic DNA was isolated from Ac10KIEGnTII and crossed with pAcP(-) TCBlue to produce Ac10KIEGnTII-TCBlue. This virus was tentatively identified by its occlusion-negative blue plaque phenotype in the presence of x-gal and its genetic structure was confirmed by Southern blotting.
Finally, genomic DNA from Ac10KIEGnTII-TCBlue was crossed with pAc-hTfHIS to produce Ac10KIEGnTII-hTfHIS. The viral DNA used for this cross was linearized with Bsu36I to facilitate recombination within the polyhedrin region. The resulting recombinant virus was tentatively identified by its occlusion-negative white plaque phenotype and its genetic structure confirmed by dot-blotting, Southern blotting, and PCR analyses. In addition, the ability of this virus to induce GlcNAcT-II activity and His-tagged hTf during infection was confirmed by enzyme assays, as described later, and immunoblotting, as described previously (Jarvis and Summers, 1989
). Each recombinant baculovirus used in this study was plaque purified three times, amplified at low multiplicity of infection, and titered by plaque assay in Sf9 cells, as described previously (Summers and Smith, 1987
).
GlcNAcT-II assay
Sf9 cells were infected with AcMNPV or Ac10KIEGnTII at a multiplicity of about 10 PFU/cell and allowed to adsorb for 1 h at 28°C. Then the inocula were removed, and the cells were fed with complete TNM-FH and returned to the incubator. Samples were harvested at various times after infection, and the cells were washed with GlcNAcT-II buffer (0.1 M MES, pH 6.1; 0.1 M NaCl) and counted with a hemocytometer. Subsequently, the cells were pelleted and resuspended at a density of 50,000 cells/µl in GlcNAcT-II lysis buffer (0.2M MES, pH 6.1; 0.4 M GlcNAc; 20 mM AMP; 1% [v/v] Triton X-100, 0.2 M NaCl) supplemented with a protease inhibitor cocktail (Complete; Roche Molecular Biochemicals, Indianapolis, IN). The cells were freeze-thawed in this buffer to enhance lysis; then the extracts were clarified at top speed in a microcentrifuge for 15 min at 4°C, and the supernatants were harvested. The GlcNAcT-II assays were performed in a final volume of 30 µl containing 5 µl of cell lysate (equivalent to 2.5x105 cells) and final concentrations of 0.2 M MES (pH 6.1), 0.2 M GlcNAc, 10 mM AMP, 0.1 M NaCl, 80 µM GnM3-octyl (Man
1-6[GlcNAcß1-2Man
1-3]Manß-[CH2]7CH3; generously donated by Dr. Harry Schachter), 0.03 mCi/ml UDP-[3H]GlcNAc (New England Nuclear, Boston, MA; 41.6 Ci/mmol), 15 mM MnCl2, and the protease inhibitor cocktail. The reaction mixtures were incubated for 60 min at 37°C, then applied to methanol-activated and water-washed Sep-Pak C18 cartridges. The cartridges were washed extensively with water, then bound radioactivity was eluted with methanol into ScintiSafe Plus 50% scintillation cocktail (Fisher Scientific, Pittsburgh, PA) and quantified in a Beckman (Palo Alto, CA) Model LS 1801 liquid scintillation spectrometer.
One-step baculovirus growth curves
Sf9 cells were pelleted by low-speed centrifugation, gently resuspended in complete TNM-FH, and infected with AcMNPV or Ac10KIEGnTII at a multiplicity of about 10 PFU/cell. The virus was allowed to absorb for 1 h at 28°C; then the inocula were removed and the cells were gently washed three times with complete TNM-FH. The cells were resuspended in complete TNM-FH, and equal aliquots were dispensed into culture flasks. After various incubation times at 28°C, the media from cells infected with each virus were harvested from triplicate flasks and pooled, and the amounts of infectious budded virus progeny in each pool were measured by plaque assays on Sf9 cells, as described previously (Summers and Smith, 1987
).
Preparation of anti-hTf-IgG-(Sepharose 4 Fast Flow)
Specific antibody to hTf was isolated from an IgG fraction prepared from anti-hTf rabbit serum by using an immobilized apo-hTf column. The apo-hTf-(Sepharose 4 fast Flow) was prepared by reacting apo-hTf with N-hydroxysuccinimide-activated Sepharose 4 Fast Flow according to the manufacturer's protocols. Anti-hTf-IgG-(Sepharose 4 Fast Flow) was prepared by immobilizing the specific anti-hTf antibody using N-hydroxysuccinimide-activated Sepharose 4 Fast Flow.
Expression and purification of human transferrin
Tn5ß4GalT cells were grown to a density of 1x106 cells/ml in 250 ml of SFX-Insect serum-free medium in 500-ml shake-flasks cultured at 28°C and 125 rpm. The cells were then pelleted and infected at a multiplicity of about 25 PFU per cell. After a 1-h absorption period, the cells were repelleted, washed twice, resuspended in fresh SFX-Insect medium, and returned to the shake-flasks. The appearance of hTf in the extracellular medium was monitored by immunoblotting and the results showed that maximal amounts of hTf, with minimal degradation, were observed at 60 h postinfection. Thus, cultures were harvested at this time point by low-speed centrifugation to obtain the cell-free supernatant. The medium (1 L) was concentrated by ultrafiltration with an Amicon stirred-cell concentrator (
= 76 mm) using a YM-30 membrane (Millipore, Bedford, MA). Then proteins were precipitated by adding 62 g ammonium sulfate to the 200 ml concentrate in the cold (50% final saturation). After removing the precipitate by centrifugation at 8000 rpm for 15 min at 4°C in Sorvall SS-34 Rotor (Kendro, Newtown, CT), the recombinant hTf was precipitated by adding 48 g ammonium sulfate to 224 ml of the supernatant (80% final saturation) in the cold and collected by centrifugation using the same conditions already described. The precipitate was dissolved in buffer A (10 mM sodium phosphate, pH 7.5) and dialyzed against the same buffer at 4°C. The sample was then applied to a DEAE-(Sepharose 4 Fast Flow) column (
2.6x20 cm) equilibrated with buffer A.
After washing the column with 3 column volumes of buffer A, bound proteins were eluted with a linear gradient of sodium chloride (00.5 M) in buffer A. Transferrin- containing fractions were identified by ELISA, pooled, the NaCl concentration was adjusted to 0.5 M, and the sample was applied to a Ni2+-loaded iminodiacetic acidSepharose 6B column (
1.5x6 cm) equilibrated with buffer B (50 mM sodium phosphate, pH 7.0, containing 0.5 M NaCl). The column was washed with three column volumes of buffer B, and the bound proteins were successively eluted with 5 column volumes each of buffer B containing 50 mM imidazole and buffer B containing 1 M imidazole. The recombinant hTf was recovered in both the 50 mM and the 1 M imidazole eluates in a 3:2 ratio, as determined by ELISA assay. Sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE) analyses showed that the 1 M imidazole eluate contained hTf with high purity, whereas the 50 mM imidazole fraction contained hTf and many other proteins. The 1 M imidazole eluate was dialyzed against distilled water and lyophilized. To obtain a total hTf preparation, recombinant hTf in the 50 mM imidazole eluate was further purified by immunoaffinity chromatography. The 50 mM imidazole eluate was dialyzed against 50 mM sodium phosphate, pH 7.0, to remove imidazole, and solid NaCl was added to a final concentration of 0.5 M. The sample was loaded onto an anti-hTf-IgG column (
1.6x6 cm) equilibrated with 10 mM TrisHCl, pH 7.0, containing 0.5 M NaCl. After unbound proteins were washed off with the same buffer, recombinant hTf was eluted with 0.1 M glycineHCl, pH 2.7, containing 0.5 M NaCl. The eluate was immediately neutralized with 0.5 M TrisHCl, pH 8.3, dialyzed against water, and lyophilized. Finally, the purified hTf preparations from the 1 M imidazole eluate on the immobilized metal affinity chromatography and immunoaffinity chromatography were combined and used for carbohydrate analyses.
The purity of the hTf preparation was analyzed by SDSPAGE (10% acrylamide gels) under reducing condition, and protein was visualized by Coomassie brilliant blue R-250 staining.
ELISA assay of recombinant hTf
The concentration of recombinant hTf in all purification steps was determined with an ELISA kit for human transferrin using apo-hTf as a standard.
Monosaccharide analysis
Neutral and amino sugar content in the purified protein was determined by the methods of Fan et al. (1994)
.
Preparation and derivatization of N-glycans from recombinant hTf
N-glycans were prepared from the purified recombinant hTf as described previously (Ailor et al., 2000
). Briefly, a trypsin-chymotrypsin digest of htf (5 mg) was treated with glycoamidase A (0.4 mU), and the released glycans were passing the sample through a Dowex 50x2 (H+) column (1 ml). The purified N-glycans were reductively aminated with 2-aminopyridine as previously described (Nakagawa et al., 1995
; Yamamoto et al., 1989
), and the resulting PA-glycans were purified by gel filtration on a Sephadex G-15 column (1.0x40 cm) using 10 mM NH4HCO3 as the eluant.
Isolation and characterization of PA-glycans by 2D HPLC
All HPLC separations were performed on an LC-10Ai HPLC system (Shimadzu USA). PA-glycans were monitored by fluorescence using
ex = 300 nm and
em = 360 nm. The PA-glycan mixtures were separated and characterized by 2D HPLC mapping as described previously (Nakagawa et al., 1995
; Tomiya et al., 1988
). The PA-glycans were successively separated on a reversed-phase column (Shim-pack CLC-ODS) and then a normal-phase column (Amide-80). An ammonium formate buffer (10 mM, pH 4.3) was used for preparative scale chromatography on the ODS column. To normalize the elution positions of PA-glycans, both HPLC columns were calibrated with PA-isomalto-oligosaccharides (420). A GU value for each peak was obtained by comparing the elution time of sample PA-glycan and PA-iso-maltooligosaccharides, according to standard procedures (Tomiya et al., 1988
). The elution position of each PA-glycan was mapped by plotting the elution positions (expressed in GU) on the reversed-phase and the normal-phase columns on the X- and Y-axes, respectively. The coordinates for sample PA-glycans on the 2D map were compared with those of authentic reference PA-glycans by cochromatography.
Exoglycosidase digestion
Sample and reference PA-glycans were subjected to sequential exoglycosidase digestion, and the elution positions of the digests were compared with the reference compounds on the 2D map. Each PA-glycan (100 pmol) isolated from the 2D HPLC was digested with exoglycosidases (ß-galactosidase, ß-N-acetylhexosaminidase, and
-L-fucosidase) under previously described conditions (Takahashi and Tomiya, 1992
). The elution coordinates of each exoglycosidase-trimmed glycan were examined on the 2D map to verify its structural identity.
MALDI-TOF MS analysis
The molecular masses of PA-glycans were determined by MALDI-TOF MS using a Voyager Elite time-of-flight mass spectrometer equipped with a delayed-extraction system (PerSeptive Biosystems, Framingham, MA). The matrix solution was prepared by dissolving 2,5-dihydroxybenzoic acid in 50% aqueous acetonitrile solution at a concentration of 10 mg/ml. The samples (approximately 300 pmol) were dissolved in the matrix solution (10 µl), and 1 µl was placed on a sample plate and vacuum-dried. The samples were ionized with a nitrogen laser at 337 nm. The data were analyzed using GRAMS/386 software. A mixture of PA-isomalto-oligosaccharides (DP = 420) was used for calibration.
| Acknowledgements |
|---|
Support for this research was provided by grants from the National Science Foundation Grant BES9814100 from the Metabolic Engineering Program (to M.J.B., Y.C.L., and D.J.) and from the Howard Hughes Medical Institute through the Undergraduate Biological Science Education Program (to J.P.). Production of hTf was performed in a core lab supported by an NIH Research Infrastructural Grant (RR15640-01) to the University of Wyoming. We thank Dr. Harry Schachter of the University of Toronto, Dr. Joel Shaper of Johns Hopkins University, and Dr. Just Vlak of Landbouwuniversiteit Wageningen, Netherlands, for the GlcNAcT-II cDNA and GlcNAcT-II acceptor substrate, the ß4GalT cDNA, and the AcMNVP-MO21 virus, respectively. We thank Cody Jones for technical assistance in producing the recombinant hTf used in this study.
| Footnotes |
|---|
1 To whom correspondence should be addressed;e-mail: ntomiya1{at}jhu.edu ![]()
| Abbreviations |
|---|
AcMNPV or AcNPV, Autographa californica multicapsid nucleopolyhedrovirus; ß4GalT, ß-1,4-galactosyltransferase; BEV, baculovirus expression vector; Fuc-T C3, core
-1,3-fucosyltransferase; Fuc-T C6, core
-1,6-fucosyltransferase; GlcNAcT-I, ß-1,2-N-acetylglucosaminyltransferase I; GlcNAcT-II, ß-1,2-N-acetylglucosaminyltransferase II; GU, glucose unit; HPAEC-PAD, high-performance anion-exchange chromatography with pulsed amperometric detection; HPLC, high-performance liquid chromatography; hTf, human serum transferrin; MALDI-TOF MS, matrix-assisted laser desorption ionization time-of-flight mass spectrometry; PA, pyridylamino; PCR, polymerase chain reaction; SDSPAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis.| References |
|---|
|
|
|---|
Ailor, E., Takahashi, N., Tsukamoto, Y., Masuda, K., Rahman, B.A., Jarvis, D.L., Lee, Y.C., and Betenbaugh, M.J. (2000) N-glycan patterns of human transferrin produced in Trichoplusia ni insect cells: effects of mammalian galactosyltransferase. Glycobiology, 10, 837847.
Altmann, F., Fabini, G., Ahorn, H., and Wilson, I.B. (2001) Genetic model organisms in the study of N-glycans. Biochimie, 83, 703712.[Medline]
Altmann, F., Kornfeld, G., Dalik, T., Staudacher, E., and Glossl, J. (1993) Processing of asparagine-linked oligosaccharides in insect cells. N-acetylglucosaminyltransferase I and II activities in cultured lepidopteran cells. Glycobiology, 3, 619625.
Altmann, F., Schweiszer, S., and Weber, C. (1995a) Kinetic comparison of peptide: N-glycosidases F and A reveals several differences in substrate specificity. Glycoconj. J., 12, 8493.[CrossRef][Web of Science][Medline]
Altmann, F., Schwihla, H., Staudacher, E., Glossl, J., and Marz, L. (1995b) Insect cells contain an unusual, membrane-bound beta-N-acetylglucosaminidase probably involved in the processing of protein N-glycans. J. Biol. Chem., 270, 1734417349.
Altmann, F., Staudacher, E., Wilson, I.B., and Marz, L. (1999) Insect cells as hosts for the expression of recombinant glycoproteins. Glycoconj. J., 16, 109123.[CrossRef][Web of Science][Medline]
Ayres, M.D., Howard, S.C., Kuzio, J., Lopez-Ferber, M., and Possee, R.D. (1994) The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology, 202, 586605.[CrossRef][Web of Science][Medline]
Breitbach, K. and Jarvis, D.L. (2001) Improved glycosylation of a foreign protein by Tn-5B1-4 cells engineered to express mammalian glycosyltransferases. Biotechnol. Bioeng., 74, 230239.[CrossRef][Web of Science][Medline]
Butters, T.D. and Hughes, R.C. (1981) Isolation and characterization of mosquito cell membrane glycoproteins. Biochim. Biophys. Acta, 640, 655671.[Medline]
Deng, W.P. and Nickoloff, J.A. (1992) Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal. Biochem., 200, 8188.[CrossRef][Web of Science][Medline]
Fan, J.-Q. and Lee, Y.C. (1997) Detailed studies on substrate structure requirements of glycoamidases A and F. J. Biol. Chem., 272, 2705827064.
Fan, J.Q., Namiki, Y., Matsuoka, K., and Lee, Y.C. (1994) Comparison of acid hydrolytic conditions for Asn-linked oligosaccharides. Anal. Biochem., 219, 375378.[CrossRef][Web of Science][Medline]
Guarino, L.A. and Summers, M.D. (1987) Nucleotide sequence and temporal expression of a baculovirus regulatory gene. J. Virol., 61, 20912099.
Guarino, L.A., Gonzalez, M.A., and Summers, M.D. (1986) Complete sequence and enhancer function of the homologous DNA regions of Autographa californica nuclear polyhedrosis virus. J. Virol., 60, 224229.
Hollister, J.R. and Jarvis, D.L. (2001) Engineering lepidopteran insect cells for sialoglycoprotein production by genetic transformation with mammalian beta 1,4-galactosyltransferase and alpha 2,6-sialyltransferase genes. Glycobiology, 11, 19.
Hollister, J.R., Shaper, J.H., and Jarvis, D.L. (1998) Stable expression of mammalian beta 1,4-galactosyltransferase extends the N-glycosylation pathway in insect cells. Glycobiology, 8, 473480.
Hooker, A. and James, D. (1998) The glycosylation heterogeneity of recombinant human IFN-gamma. J. Interferon Cytok. Res., 18, 287295.
Hooker, A.D., Green, N.H., Baines, A.J., Bull, A.T., Jenkins, N., Strange, P.G., and James, D.C. (1999) Constraints on the transport and glycosylation of recombinant IFN-gamma in Chinese hamster ovary and insect cells. Biotechnol. Bioeng., 63, 559572.[CrossRef][Web of Science][Medline]
Hsu, T.A., Takahashi, N., Tsukamoto, Y., Kato, K., Shimada, I., Masuda, K., Whiteley, E.M., Fan, J.Q., Lee, Y.C., and Betenbaugh, M.J. (1997) Differential N-glycan patterns of secreted and intracellular IgG produced in Trichoplusia ni cells. J. Biol. Chem., 272, 90629070.
Jarvis, D.L. and Finn, E.E. (1996) Modifying the insect cell N-glycosylation pathway with immediate early baculovirus expression vectors. Nat. Biotechnol., 14, 12881292.[CrossRef][Web of Science][Medline]
Jarvis, D.L. and Summers, M.D. (1989) Glycosylation and secretion of human tissue plasminogen activator in recombinant baculovirus-infected insect cells. Mol. Cell Biol., 9, 214223.
Jarvis, D.L., Weinkauf, C., and Guarino, L.A. (1996) Immediate early baculovirus vectors for foreign gene expression in transformed or infected insect cells. Prot. Exp. Purif., 8, 191203.[CrossRef][Web of Science][Medline]
Kawar, Z. and Jarvis, D.L. (2001) Biosynthesis and subcellular localization of a lepidopteran insect alpha 1,2-mannosidase. Insect Biochem. Mol. Biol., 31, 289297.[CrossRef][Web of Science][Medline]
Lawrence, S.M., Huddleston, K.A., Pitts, L.R., Nguyen, N., Lee, Y.C., Vann, W.F., Coleman, T.A., and Betenbaugh, M.J. (2000) Cloning and expression of the human N-acetylneuraminic acid phosphate synthase gene with 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid biosynthetic ability. J. Biol. Chem., 275, 1786917877.
Lawrence, S.M., Huddleston, K.A., Tomiya, N., Nguyen, N., Lee, Y.C., Vann, W.F., Coleman, T.A., and Betenbaugh, M.J. (2001) Cloning and expression of human sialic acid pathway genes to generate CMP-sialic acids in insect cells. Glycoconj. J., 18, 205213.[CrossRef][Web of Science][Medline]
Licari, P.J., Jarvis, D.L., and Bailey, J.E. (1993) Insect cell hosts for baculovirus expression vectors contain endogenous exoglycosidase activity. Biotechnol. Prog., 9, 146152.[CrossRef][Medline]
Lopez, M., Tetaert, D., Juliant, S., Gazon, M., Cerutti, M., Verbert, A., and Delannoy, P. (1999) O-glycosylation potential of lepidopteran insect cell lines. Biochim. Biophys. Acta, 1427, 4961.[Medline]
Marchal, I., Jarvis, D.L., Cacan, R., and Verbert, A. (2001) Glycoproteins from insect cells: sialylated or not? Biol. Chem., 382, 151159.[CrossRef][Web of Science][Medline]
Martens, J.W., van Oers, M.M., van de Bilt, B.D., Oudshoorn, P., and Vlak, J.M. (1995) Development of a baculovirus vector that facilitates the generation of p10-based recombinants. J. Virol. Methods, 52, 1519.[CrossRef][Web of Science][Medline]
Marz, L., Altmann, F., Staudacher, E., and Kubelka, V. (1995) Protein glycosylation in insects. In Montreuil, J., Vliegenthart, J.F.G., and others (eds), Glycoproteins. Elsevier, Amsterdam, pp. 543563.
Nakagawa, H., Kawamura, Y., Kato, K., Shimada, I., Arata, Y., and Takahashi, N. (1995) Identification of neutral and sialyl N-linked oligosaccharide structures from human serum glycoproteins using three kinds of high-performance liquid chromatography. Anal. Biochem., 226, 130138.[CrossRef][Web of Science][Medline]
O'Reilly, D.R., Miller, L.K., and Luckow, V.A. (1992) Baculovirus expression vectors. Freeman, New York.
Shapira, S.K., Chou, J., Richaud, F.V., and Casadaban, M.J. (1983) New versatile plasmid vectors for expression of hybrid proteins coded by a cloned gene fused to lacZ gene sequences encoding an enzymatically active carboxy-terminal portion of beta-galactosidase. Gene, 25, 7182.[CrossRef][Web of Science][Medline]
Staudacher, E. and Marz, L. (1998) Strict order of (Fuc to Asn-linked GlcNAc) fucosyltransferases forming core-difucosylated structures. Glycoconj. J., 15, 355360.[CrossRef][Web of Science][Medline]
Summers, M.D. and Smith, G.E. (1978) Baculovirus structural polypeptides. Virology, 84, 390402.[CrossRef][Web of Science][Medline]
Summers, M.D. and Smith, G.E. (1987) A manual of methods for baculovirus vectors and insect cell culture procedures. Tx. Ag. Expt. Stn. Bull., 1555.
Takahashi, N. and Tomiya, N. (1992) Analysis of N-linked oligosaccharides: application of glycoamidase A. In: Takahashi, N. and Muramatsu, T. (eds), Handbook of Endoglycosidases and Glycoamidases. CRC Press, Boca Raton, FL, pp. 199332.
Takahashi, N., Tsukamoto, Y., Shiosaka, S., Kishi, T., Hakoshima, T., Arata, Y., Yamaguchi, Y., Kato, K., and Shimada, I. (1999) N-glycan structures of murine hippocampus serine protease, neuropsin, produced in Trichoplusia ni cells. Glycoconj. J., 16, 405414.[CrossRef][Web of Science][Medline]
Tan, J., D'Agostaro, A.F., Bendiak, B., Reck, F., Sarkar, M., Squire, J.A., Leong, P., and Schachter, H. (1995) The human UDP-N-acetylglucosamine: alpha-6-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase II gene (MGAT2). Cloning of genomic DNA, localization to chromosome 14q21, expression in insect cells and purification of the recombinant protein. Eur. J. Biochem., 231, 317328.[Web of Science][Medline]
Tomiya, N., Ailor, E., Lawrence, S.M., Betenbaugh, M.J., and Lee, Y.C. (2001) Determination of nucleotides and sugar nucleotides involved in protein glycosylation by high-performance anion-exchange chromatography: sugar nucleotide contents in cultured insect cells and mammalian cells. Anal. Biochem., 293, 129137.[CrossRef][Web of Science][Medline]
Tomiya, N., Awaya, J., Kurono, M., Endo, S., Arata, Y., and Takahashi, N. (1988) Analyses of N-linked oligosaccharides using a two-dimensional mapping technique. Anal. Biochem., 171, 7390.[CrossRef][Web of Science][Medline]
Tomiya, N. and Takahashi, N. (1998) Contribution of component monosaccharides to the coordinates of neutral and sialyl pyridylaminated N-glycans on a two-dimensional sugar map. Anal. Biochem., 264, 204210.[CrossRef][Web of Science][Medline]
van Die, I., van Tetering, A., Bakker, H., van den Eijnden, D.H., and Joziasse, D.H. (1996) Glycosylation in lepidopteran insect cells: identification of a beta 1
4-N-acetylgalactosaminyltransferase involved in the synthesis of complex-type oligosaccharide chains. Glycobiology, 6, 157164.
Vaughn, J.L., Goodwin, R.H., Thompkins, G.J., and McCawley, P. (1977) The establishment of two insect cell lines from the insect Spodoptera frugiperda (Lepidoptera:Noctuidae). In Vitro, 13, 213217.[Web of Science][Medline]
Vlak, J.M., Schouten, A., Usmany, M., Belsham, G.J., Klinge-Roode, E.C., Maule, A.J., Van Lent, J.W., and Zuidema, D. (1990) Expression of cauliflower mosaic virus gene I using a baculovirus vector based upon the p10 gene and a novel selection method. Virology, 179, 312320.[CrossRef][Web of Science][Medline]
Wickham, T.J., Davis, T., Granados, R.R., Shuler, M.L., and Wood, H.A. (1992) Screening of insect cell lines for the production of recombinant proteins and infectious virus in the baculovirus expression system. Biotechnol. Prog., 8, 391396.[CrossRef][Medline]
Yamamoto, S., Hase, S., Fukuda, S., Sano, O., and Ikenaka, T. (1989) Structures of the sugar chains of interferon-gamma produced by human myelomonocyte cell line HBL-38. J. Biochem. (Tokyo), 105, 547555.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
O. Choi, N. Tomiya, J. H. Kim, J. M. Slavicek, M. J. Betenbaugh, and Y. C. Lee N-glycan structures of human transferrin produced by Lymantria dispar (gypsy moth) cells using the LdMNPV expression system Glycobiology, July 1, 2003; 13(7): 539 - 548. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


) or Ac10KIEGnTII-(
) infected insect cells. Samples were taken from insect cell cultures infected with each virus at various times postinfection, extracted, and used for GlcNAcT-II activity assays, as described in Materials and methods.


), ß-N-acetylhexosaminidase (-
, GlcNAc;
, fucose;
, glucose; 
