Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Alverez, K.
Right arrow Articles by Fregien, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alverez, K.
Right arrow Articles by Fregien, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2002, Vol. 12, No. 7 389-394
© 2002 Oxford University Press

Sequences of the mouse N-acetylglucosaminyltransferase V (Mgat5) mRNA and an mRNA expressed by an Mgat5-deficient cell line

Karen Alverez2, Chevon Haswell2, Marc St. Clair2, Guang-Shing Perng2, Mohammed Shorebah3, Michael Pierce3 and Nevis Fregien1,2

2 Department of Cell Biology and Anatomy, Unviversity of Miami School of Medicine, Miami, FL 33101, USA, and 3 Department of Biochemistry, University of Georgia, Athens, GA, USA

Received on November 29, 2001; revised on February 4, 2002; accepted on February 5, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
N-acetylglucosaminyltransferase V, encoded by the Mgat5 gene, plays an important regulatory role in the synthesis of complex N-glycans, including the Lewis antigens. The elevated expression of this enzyme is regulated during development and is highly associated with cellular transformation and malignancy. In addition, mammary tumors produced in Mgat5 gene knockout mice show markedly reduced metastases, indicating that it plays an important role in this process. The expression of this transferase is important for normal T cell proliferation and function. The amino acid and mRNA sequences for this protein are very highly conserved among the reported species. We report here the sequence of the mouse Mgat5 mRNA. This sequence is very similar to the other mammalian sequences with 95%, 91%, and 87.8% overall sequence identity to rat, hamster, and human mRNAs, respectively. In addition, we have identified a 63-bp insertion mutation, introducing a premature stop codon in the coding region of the Mgat5 mRNA expressed in a N-acetylglucosaminyltransferase V–deficient cell line, PhaR2.1.

Key words: glycosylation/glycosyltransferase/mRNA/mutant


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
Cell surface N-linked oligosaccharides are synthesized into a large number of different configurations ranging from simple high mannose structures to more complex, highly branched and terminally decorated structures. The expression of these structures is regulated both temporally and spatially during development and in certain disease situations (Dennis et al., 1999Go). Extensive studies, many using glycosylation mutant cell lines, have shown that these oligosaccharides are constructed progressively by the orchestrated activity of many different glycosidases and glycosyltransferases that remove or add specific sugar residues in specific chemical linkages (Stanley and Ioffe, 1995Go). Glycosylation mutant cells that lack a specific enzyme activity in the synthetic pathway accumulate N-linked oligosaccharide products that are earlier in the pathway because they require the missing enzymatic activity to proceed. These observations indicate that the genetic regulation of the expression of specific N-linked oligosaccharide structures occurs at the level of regulating the genes encoding the individual glycosyltransferases and glycosidases required for the synthesis of each oligosaccharide.

UDP-N-acetylglucosamine:{alpha}-D-mannoside ß-1,6-N-acetylglucosaminyltransferase V or GlcNAc-TV (EC.4.1.155) plays a pivotal role in the synthesis of complex N-linked glycans. This enzyme catalyzes the addition of an N-acetylglucosamine to the {alpha}1,6 mannosyl core in a ß1,6 linkage and forms the ß1,6 branch on tri- and tetraantennary N-linked oligosaccharide structures. This branch provides the preferred substrate for the enzymatic subsequent synthesis of polylactosamine chains (van den Eijnden et al., 1988Go) and their terminal modifications including the Lewis antigens. GlcNAc-TV is expressed in a variety of tissues at considerably different levels (Dennis and Laferte, 1989Go) as well as during embryogenesis (Granovsky et al., 1995Go). In some cases (i.e., brain), the level of the mRNA does not appear to correlate with the level of enzyme activity, indicating that regulation of GlcNAc-TV expression is complex with both transcriptional and translational controls.

Elevated GlcNAc-TV expression has been correlated with a number of different tumors including breast and colon (Fernandes et al., 1991Go) and virally transformed cells (Pierce et al., 1997Go). Several studies have shown that the GlcNAc-TV gene transcription can be induced by the oncogenes, including ras (Yamashita et al., 1984Go) src (Buckhaults et al., 1997Go), and neu (Chen et al., 1998Go). GlcNAc-TV activity is also highly associated with metastatic potential. This has recently been demonstrated by the observation that Mgat5 knockout mice lacking the GlcNAc-TV activity show reduced tumor growth and have a 20-fold decrease in metastasis to the lungs (Granovsky et al., 2000Go). In addition to showing reduced metastasis, these Mgat5 mice showed increased susceptibility to autoimmune disease, due to altered T cell receptor aggregation and signaling (Demetriou et al., 2001Go). The activity of this GlcNAc-TV and the presence of its ß1,6 branch product are associated with a number of cellular properties that might promote cancer progression. Correlations of GlcNAc-TV expression have also been reported for cellular adhesiveness, migration, proliferation, and apoptosis (Demetriou et al., 1995Go). Thus, proper regulation of this gene appears to be significant for proper cellular behavior.

The oligosaccharide product of GlcNAc-TV forms the binding site for the lectin L-Pha. The toxicity of this lectin after binding to GlcNAc-TV-expressing cells has been used as a selective scheme to isolate several cell lines with mutations in the GlcNAc-TV gene. Two lines, Lec4 and Lec4a, were derived from Chinese hamster ovary (CHO) cells with the Lec4 having no detectable GlcNAc-TV activity and the Lec4a having enzymatic activity that is improperly localized outside the Golgi. The mRNAs for these mutants have been sequenced and show that the Lec4 mRNA has two insertions, resulting in a frame shift and premature termination. The Lec4a mRNA has a single point mutation that changes amino acid 188 from a leucine to an arginine. This amino acid change is presumably responsible for the mislocalization of the protein (Weinstein et al., 1996Go) and altered glycosylation. A third cell line, PhaR2.1, is a set of mouse lymphoma cells derived from mutagenized BW5147 cells (Cummings et al., 1982Go). This line has no detectable GlcNAc-TV enzyme activity but does transcribe a GlcNAc-TV mRNA that is slightly larger than the 7.5-kb mRNA observed in the parental BW5147 cells. In this report, we have determined the coding and 3' untranslated sequences of the mouse GlcNAc-TV mRNA and the genetic lesion in the sequence of the mutant PhaR2.1 GlcNAc-TV mRNA.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
Determination of the mouse sequence
The sequence of the mouse GlcNAc-TV mRNA has been determined by combining sequence data obtained from three cDNA clones. Two of the clones were obtained by constructing and screening cDNA libraries from two mouse cell lines, BW5147 and NIH3T3. These clones contained 2377 bases of the 3' end of the mRNA, including the 3' UTR and 1357 bases of the coding region, but lacked the 5' most 865 bases of the coding region. The remaining 5' coding sequences were obtained by reverse-transcription polymerase chain reaction (RT-PCR) of BW5147 mRNA. The 3' primer (CAAAGGAGTCTAGCACCC) was selected from within the sequenced portion of the mouse mRNA, just downstream of a ClaI restriction endonuclease site that could be used to construct a full-length coding sequence by combine this amplimer with the other cDNAs. The 5' primer (CCCGTCGACGAGAGCCAAGGGAATGGT) was selected from the 5' UTR of the rat mRNA sequence (positions –33 to –15 relative to the ATG translation initiation site). This primer included a nine-base 5' extension containing a Sal I restriction endonuclease site (underlined) to assist subsequent clonings. The combined sequence of the mouse cDNA is shown in Figure 1, with the corresponding translation of the open reading frame.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 1. Sequences of the Mgat5 cDNAs obtained from normal and mutant mouse cell lines. The nucleotide sequence of the mouse Mgat5 mRNA is shown with its translation in the 3-letter amino acid abbreviations shown. The numbers at the left indicate the nucleotide number beginning with the ATG translation initiation codon as 1. The boxed region contains the sequence of the insertion found in the PhaR2.1 mRNA and its inferred amino acid sequence, leading to premature termination after a total of 149 amino acids. The site of the insertion is between bases 406 and 407 and is indicated in the normal sequence by the slash marks.

 
Determination of the GlcNAc TV mRNA sequence in PhaR2.1 cells
Previous studies have shown that mouse lymphoma cell line, PhaR2.1 that was derived from the BW5147 cell line by mutagenesis and selection for resistance to the lectin L-Pha is deficient in GlcNAc-TV activity. Surprisingly, this cell line was found to express a GlcNAc-TV mRNA that was slightly larger than the GlcNAc-TV mRNA observed in the parental, BW5147 cells. This suggested the possibility of an insertion into the coding region of the GlcNAc-TV gene in the PhaR2.1 cells. To determine whether this was true, primers were designed to be used for RT-PCR across the entire coding region of the GlcNAc-TV mRNAs from both PhaR2.1 and BW5147 cells in two separate amplification reactions. The N-terminal part of the coding region was amplified using primers beginning at position –34 of the mouse sequence (5'-AGAGCCAAGGGAATGGTAC-3') and ending at base 1629 (5' CATCGCGAATGGATGTGC-3') and C-terminal part of was amplified using primers beginning a positions 1421 (5'-TCGATATTGTGGGACTTG-3') to position 2587(5'- GAGTCTCCGGACTTTTAT-3') about 330 bp beyond the translation termination codon. These primer pairs were predicted to produce amplification products of 1663 bp and 1166 bp, respectively.

In an effort to ensure the homogeneity of the PhaR2.1 cells prior to RNA isolation, they were tested for their L-Pha-binding ability. This was done using two methods. For the first method, 10-ml cultures of BW5147 and PhaR2.1 cells were grown and used to prepare crude membrane fractions. The proteins in these crude membrane preparations were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and blotted to nylon membranes. The samples were probed for the presence of ß1,6 branched oligosaccharides with horseradish peroxidase–conjugated L-Pha. The results of this lectin blot are shown in Figure 2. These data show that there is little (if any) specific L-Pha binding to membrane proteins from PhaR2.1 cells, and the membrane proteins from the parental BW5147 cells demonstrate very strong binding. To further confirm the absence of L-Pha binding to the PhaR2.1 cells, the cells were treated with fluorescein isothiocyanate (FITC)-labeled-L-Pha and analyzed on a fluorescence-assisted cell sorting (FACS) scan. This data also in Figure 2 shows again that the PhaR2.1 cells do not express ß1.6-branched oligosaccharides, L-Pha binding sites, therefore, these cells could be used for mRNA isolation without fear of contamination with BW5147 cells.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of L-Pha binding to BW5147 and PhaR2.1 cells. BW5147 and PhaR2.1 cells were tested for the presence of ß1-6 branched N-acetylglucosamine containing N-linked oligosaccharides using L-Pha binding in two ways. (A) Partially purified membranes from the two cell lines were prepared and separated by SDS–PAGE and blotted to nylon membranes. The membranes were then probed with horseradish peroxidase–conjucated L-Pha, and binding was detected by chemiluminescence and X-ray film. (B) Cells were washed and bound with FITC-labeled L-Pha followed by analysis using a FACS scan. The BW5147 cell binding is indicated by the solid line and the PhaR2.1 binding is indicated by the dashed line. Both of these show that there is very little (if any) binding of L-Pha to the PhaR2.1 cells.

 
The mRNA was reverse transcribed, and 5' and 3' portions were amplified in separate PCR reactions. The amplimers were cloned into pGEM-Teasy and then sequenced. The sequence of the 3' portion matched the sequence obtained from the previously determined mouse sequence exactly, however the sequence of the 5' portion of the mRNA revealed a 62-base insertion 406 bases into the coding sequence. This insertion causes a change in the coding sequence that continues for 14 amino acids before reaching a stop codon. Therefore, the GlcNAc-T V mRNA expressed in PhaR2.1 cells would encode a protein of 157 amino acids in length.

Test for complementation by the PhaR2.1 amplimers
To test for mutation events in each of the individual 5' and 3' amplification products of the PhaR2.1 GlcNAc-TV mRNA, they were substituted for their normal counterparts in an expression plasmid that contained a functional, full-length, wild-type mouse coding sequence driven by the mouse mammary tumor virus promoter. The replacements were made using a Cla I restriction endonuclease site that is 1147 bases (about 47%) into the reading frame and was present in the overlap between the 3' and 5' amplification products. Specifically, the 5' PhaR2.1 amplification product was excised from the pGEM-Teasy vector by digesting with EcoRI (site in the vector) and ClaI and substituted for the wild-type sequence cut with the same enzymes. This plasmid is referred to as pPhaR5'. Similarly the 3' PhaR2.1 amplimer was isolated from the pGEM-Teasy vector by digestion with Cla I and Not I (site in the vector) to created a plasmid with 5' end of the PhaR2.1 message sequence and the 3' end of the normal mouse sequence, and one plasmid with the 5' end of the normal sequence and the 3' end of the PhaR2.1 sequence (pPhaR3'). These plasmids were used to transfect the GlcNAc-T V deficient cell line CHOP4 (Heffernan and Dennis, 1991Go) and assayed for the presence of ß1,6 branched N-linked oligosaccharides by FITC-conjugated L-Pha binding and FACS scan analysis. The results of these transfections and scans are shown in Figure 3. These experiments show that the 3' portion of the PhaR2.1 GlcNAc-TV mRNA encodes the proper amino acid sequence to produce a functional GlcNAc-TV enzyme and confirm that the 5' portion of the PhaR2.1 GlcNAc-T V mRNA contains the mutation(s) responsible for the lack of GlcNAc-T V activity in the mutant cells. This is most likely to be due to the inserted sequence we have detected.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. FACS analysis of transfected CHOP4 cells. CHOP4 cells were transfected with the expression vector containing either: (A) no insert; (B) normal mouse Mgat5 cDNA; (C) PhaR 5'/BW5147 3' hybrid cDNA; or (D) BW51475'/ PhaR3 hybrid cDNA. After 48 h, the cells were collected, bound with FITC-labeled L-Pha, and analyzed by FACS.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
The sequence of the mouse GlcNAc-TV cDNA and its translated coding region are very similar to the other mammalian mRNAs previously sequenced. The mouse mRNA has overall nucleotide sequence identities of 95%, 91%, and 87.8% with the rat, hamster, and human sequences, respectively. Within the coding region the sequence identity is slightly increased to 95.3%, 93.5%, and 88%. Comparison of the 3' UTR sequences is difficult because there are only short available human and rat 3' UTR sequences. The mouse and rat 3' UTR sequences maintain high sequence similarity with 92% sequence identity, but the human 3' UTR diverges somewhat and shows only 52% identity. The 3' untranslated region of the mouse mRNA GlcNAc-TV mRNA is 977 bases long, with an AAATAAA polyadenylation signal 40 bases before the poly A sequence at the 3' end of the cDNA clone. This gives a total sequenced length of 3201 bases sequenced out of the approximately 7.5-kb mRNA previously reported (Perng et al., 1994Go). The remaining ~4 kb of sequence must be in either the 5' UTR or 3' UTR or both. Several different 5' UTR sequences have been reported for the GlcNAc-TV mRNA, the longest being a 2700-base 5' UTR for a human mRNA (Buckhaults et al., 1997Go), which still does not account for the missing sequence. It is also possible that 3' UTR is longer and the poly A sequence at the end of the cDNA clone is not the actual 3' end of the mRNA but is a stretch of As within the 3' UTR that hybridized with the oligo dT and primed cDNA synthesis.

As would be expected from high sequence identity of the mRNAs, the amino acid sequences are also remarkably similar. The mouse and rat sequences have only two differences out of the entire 740-amino-acid length. The hamster sequence has 8 amino acid differences with the mouse protein, and the human protein has the greatest difference with 20 amino acid substitutions. The human protein also has one additional difference to the rodent proteins, because it has an additional alanine residue at position 108, giving it 741 amino acids to the 740 amino acids in the rodent proteins. Most of the amino acid differences are conserved as shown in Table I.


View this table:
[in this window]
[in a new window]
 
Table I. Amino acid substitutions in mammalian GlcNAc-TV sequences
 
The mutation detected in the PhaR2.1 GlcNAc-TV mRNA is an insertion of a 63-base sequence within the codon for amino acid 143 that inserts 13 missense codons followed by an in frame, termination codon resulting in a truncated polypeptide without a catalytic domain (Korczak et al., 2000Go). The origin of this insertion and its cause are unknown. This sequence was used to search the GenBank nucleotide database, and no matching sequences were found. RNA gel blot data suggested a larger, ~500-bp insertion in the PhaR2.1 mRNA, therefore, it is possible that there are additional, yet undefined insertions in either the 5' or 3' UTRs.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
Cells
Dr. R. Cummings generously provided BW5147 and PhaR2.1 cells, and Dr. James Dennis kindly provided the CHOP4 cells. The cells were grown in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum, penicillin, and streptomycin.

RNA isolation, library construction, and cloning
RNAs were isolated from cultured cells using RNAzol (Tel Test) according to manufacturers recommendations. Poly A containing RNA was purified from total RNA by binding to and eluting from oligo(dT)-cellulose. The BW5147 cDNA Library was constructed in pcDNA1 using the Librarian II system (Invitrogen) and oligo(dT)-primed cDNA. The NIH 3T3 cell cDNA library was constructed using random hexanucleotide primed cDNA, EcoRI linker addition, and ligation into the 8Gem vector. The libraries were screened using 32P-labeled fragments of the rat cDNA using the random prime labeling method (Roche Diagnostics).

The remaining 5' portion of the mouse mRNA sequence was obtained by RT-PCR using AMV reverse transcriptase and Tfl DNA polymerase (Promega). The 5' most portion of the BW5147 cell mRNA was amplified using a 5' primer with a sequence found in the 5' untranslated region of the rat mRNA (5'-CCCGTCGACGAGAGCCAAGGGAATGGTA-3') and a 3' primer complimentary to a sequence near 5' end of the longest cDNA clone (5'-CAAAGGAGTCTAGCACCC-3'). This amplification product was cloned into the pGEM-Teasy vector (Promega). A complete cDNA clone was constructed by sequentially adding the fragments into the pcDNA1/BW5147 cDNA clone.

The full-length PhaR2.1 GlcNAc T-V cDNA was constructed using two RT/PCR steps, one for the 5' half of the mRNA and the second for the 3' half. The primers for the 5' portion were the same as described for the cloning of the BW5147 5' portion. The 3' coding portion was amplified using the primers 5'-GAGTCTCCGGACTTTTAT-3' and 5' ATCTACCTGGATATCATTC. These amplification products were cloned into the pGEM-Teasy system (Promega) and sequenced either at the University of Miami DNA Sequencing Facility or the University of Georgia, Athens, DNA sequencing facility.

Crude membrane preparations and western blotting
Cells were collected scraping and washed in cold HBS (20 mM HEPES, pH 7.4, 8 g/L NaCl, 0.4 g/L KCl , 0.35 g/L NaHCO3, 1 g/L D-glucose, 100 µM ethylenediamine tetra-acetic acid [EDTA]) then incubated in HBS on ice for 10 min. About 107 cells were centrifuged and resuspended in 1 ml harvest buffer (20 mM sodium borate, pH 8, 200 µM EDTA) and kept on ice for 10 min. The cell suspension was then homogenized with 30 strokes in a dounce homogenizer. Unlysed cells and large particles were removed by centrifugation at 5000 x g for 5 min. The cell membranes were then pelleted by centrifugation of the clarified supernatant by centrifugation in a Beckman Table Top Ultracentrifuge at 100,000 x g for 30 min. Pellets were resuspended phosphate buffered saline (PBS) containing 0.1% SDS.

Protein concentrations were determined using the BCA Protein Assay Reagent (Pierce). Equivalent amounts of the protein samples were separated by SDS–PAGE using 8% acrylamide gels and transferred to nylon membranes (Immobilon, Millipore). ß1,6 Branched N-linked oligosaccharides were detected using peroxidase-labeled L-Pha (E-M Laboratories) and chemiluminescence (Renaissance, NEN Life Science).

Transfection and FACS analysis
Cells were transfected using ExGen 500 (MBI Fermentas) gene delivery reagent according to the manufacturer’s recommendations. Briefly, CHOP4 cells were plated at 150,000 cells per 35-mm dish 1 day before transfection. Plasmid DNAs used for transfection were prepared using the endotoxin-free protocol (Qiagen). Eight micrograms of plasmid DNA were mixed with 26.4 µl (six equivalents) of ExGen and used to transfect 35-mm dish of CHOP4 cells for 5–6 h, at which time the cells were fed fresh medium and allowed to grow for about 60 h. The cells were washed two times with PBS (Ca2+ Mg2+ free) and removed from the dish using enzyme-free cell dissociation buffer (Gibco/BRL). The cells were washed twice in PBS (Ca2+ Mg2+ free) + 1% bovine serum albumin (BSA). FITC-labeled L-Pha (Vector Labs) was added to a final concentration of 2.5 µg/ml in PBS-BSA, and the cells were incubated in this mixture for 30 min at 4°C. The cells were centrifuged and resuspended in 1 ml PBS-BSA and analyzed using a Bectin-Dickenson FACS scan at the Sylvester Cancer Center FACS Facility.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
BSA, bovine serum albumin; CHO, Chinese hamster ovary; EDTA, ethylenediamine tetra-acetic acid; FACS, fluorescence-assisted cell sorting; FITC, fluorescein isothiocyanate; GlcNAc-TV, UDP-N-acetylglucosamine:{alpha}-D-mannoside ß-1,6-N-acetylglucosaminyltransferase V; HBS, 20 mM HEPES, pH 7.4, 8 g/L NaCl, 0.4 g/L KCl , 0.35 g/L NaHCO3, 1 g/L D-glucose, 100 µm EDTA; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate buffered saline; RT-PCR, reverse-transcription polymerase chain reaction; SDS, sodium dodecyl sulfate


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
This work was supported NIH grant NCI49926 to N.F. and the Sylvester Comprehensive Cancer Center, Miami, FL. The cDNA sequences have been submitted to GenBank with the following accession numbers: mouse N-acetylglucosaminyltransferase V, AF474154; PhaR2.1 cDNA, AF474155.


    Footnotes
 
1 To whom correspondence should be addressed; E-mail: nevis{at}miami.edu Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Abbreviations
 Acknowledgments
 References
 
Buckhaults, P., Chen, L., Fregien, N., and Pierce, M. (1997) Transcriptional regulation of N-acetylglucosaminyltransferase V by the src oncogene. J. Biol. Chem., 272, 19575–19581.[Abstract/Free Full Text]

Chen, L., Zhang, W., Fregien, N., and Pierce, M. (1998) The her-2/neu oncogene stimulates the transcription of N-acetylglucosaminyltransferase V and expression of its cell surface oligosaccharided products. Oncogene, 17, 2087–2093.[CrossRef][ISI][Medline]

Cummings, R.D., Trowbridge, I.S., and Kornfeld, S. (1982) A mouse lymphoma cell line resistant to the leukoagglutinating lectin from Phaseolus vulgaris is deficient in UDP-GlcNAc: alpha- D-mannoside beta 1, 6 N-acetylglucosaminyltransferase. J. Biol. Chem., 257, 13421–13427.[Free Full Text]

Demetriou, M., Granovsky, M., Quaggin, S., and Dennis, J.W. (2001) Negative regulation of T-cell activation and autoimmunity by Mgat5 N-glycosylation. Nature, 409, 733–739.[CrossRef][Medline]

Demetriou, M., Nabi, I.R., Coppolino, M., Dedhar, S., and Dennis, J.W. (1995) Reduced contact-inhibition and substratum adhesion in epithelial cells expression GlcNAc-transferase V. J. Cell Biol., 123, 383–392.

Dennis, J.W. and Laferte, S. (1989) Oncodevelopmental expression of Glc-NAc beta 1-6Man alpha 1-6Man beta 1-branched asparagine-linked oligosaccharides in murine tissues and human breast carcinomas. Cancer Res., 49, 945–950.[Abstract/Free Full Text]

Dennis, J.W., Granovsky, M., and Warren, C.E. (1999) Protein glycosylation in development and disease [review]. Bioessays, 21, 412–421.[CrossRef][ISI][Medline]

Fernandes, B., Sagman, U., Auger, M., Demetriou, M., and Dennis, J.W. (1991) Beta 1-6 branched oligosaccharides as a marker of tumor progression in human breast and colon neoplasia [see comments]. Cancer Res., 51, 718–723.[Abstract/Free Full Text]

Granovsky, M., Fata, J., Pawling, J., Muller, W.J., Khokha, R., and Dennis, J.W. (2000) Suppression of tumor growth and metastasis in Mgat5-deficient mice. Nat. Med., 6, 306–312.[CrossRef][ISI][Medline]

Granovsky, M., Fode, C., Warren, C.E., Campbell, R.M., Marth, J.D., Pierce, M., Fregien, N., and Dennis, J.W. (1995) GlcNAc-transferase V and core 2 GlcNAc-transferase expression in the developing mouse embryo. Glycobiology, 5, 797–806.[Abstract/Free Full Text]

Heffernan, M. and Dennis, J.W. (1991) Polyoma and hamster papovavirus large T antigen-mediated replication of expression shuttle vectors in Chinese hamster ovary cells. Nucleic Acids Res., 19, 85–92.[Abstract/Free Full Text]

Korczak, B., Le, T., Elowe, S., Datti, A., and Dennis, J.W. (2000) Minimal catalytic domain of N-acetylglucosaminyltransferase V. Glycobiology, 10, 595–599.[Abstract/Free Full Text]

Perng, G.S., Shoreibah, M., Margitich, I., Pierce, M., and Fregien, N. (1994) Expression of N-acetylglucosaminyltransferase V mRNA in mammalian tissues and cell lines. Glycobiology, 4, 867–871.[Abstract/Free Full Text]

Pierce, M., Buckhaults, P., Chen, L., and Fregien, N. (1997) Regulation of N-acetylglucosaminyltransferase V and Asn-linked oligosaccharide beta(1, 6) branching by a growth factor signaling pathway and effects on cell adhesion and metastatic potential [review]. Glycoconj. J., 14, 623–630.[CrossRef][ISI][Medline]

Stanley, P. and Ioffe, E. (1995) Glycosyltransferase mutants: key to new insights in glycobiology [review]. FASEB J., 9, 1436–1444.[Abstract]

van den Eijnden, D.H., Koenderman, A.H., and Schiphors, W.E.C.M. (1988) Biosynthesis of blood group i-active polylactosaminoglycans. J. Biol. Chem., 263, 12461–12471.[Abstract/Free Full Text]

Weinstein, J., Sundaram, S., Wang, X., Delgado, D., Basu, R., and Stanley, P. (1996) A point mutation causes mistargeting of Golgi GlcNAc-TV in the Lec4A Chinese hamster ovary glycosylation mutant. J. Biol. Chem., 271, 27462–27469.[Abstract/Free Full Text]

Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S., and Kobata, A. (1984) Comparative study of the oligosaccharides released from baby hamster kidney cells and their polyoma transformants by hydrazinolysis. J. Biol. Chem., 259, 10834–10840.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
D. Li, Y. Li, X. Wu, Q. Li, J. Yu, J. Gen, and X.-L. Zhang
Knockdown of Mgat5 Inhibits Breast Cancer Cell Growth with Activation of CD4+ T Cells and Macrophages
J. Immunol., March 1, 2008; 180(5): 3158 - 3165.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Alverez, K.
Right arrow Articles by Fregien, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alverez, K.
Right arrow Articles by Fregien, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?