Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Deng, W.
Right arrow Articles by Ladisch, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, W.
Right arrow Articles by Ladisch, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2002, Vol. 12, No. 3 145-152
© 2002 Oxford University Press

Transfection of glucosylceramide synthase antisense inhibits mouse melanoma formation

Wen Deng, Ruixiang Li, Michael Guerrera, Yihui Liu and Stephan Ladisch1

Glycobiology Program, Center for Cancer and Transplantation Biology, Children’s Research Institute and Department of Pediatrics and Biochemistry/Molecular Biology, George Washington University School of Medicine, Washington, DC 20010, USA

Received on April 13, 2001; revised on November 26, 2001; accepted on November 27, 2001.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
MEB4 murine melanoma cells synthesize GM3 as the major ganglioside. Inhibition of GM3 synthesis by a specific glucosylceramide synthase inhibitor resulted in reduced tumorigenicity and metastatic potential of these cells. We used a molecular approach—antisense transfection targeting the glucosylceramide synthase gene—to regulate glycosphingolipid synthesis by MEB4 cells and examine the influence on tumor formation. Antisense transfection inhibited the synthesis of the direct product of glucosylceramide synthase, glucosylceramide, and consequently GM3 ganglioside, by MEB4 cells, reducing the concentration of GM3 in the transfectants by up to 58%. Although neither morphology nor proliferation kinetics of the cultured cells was affected, the inhibition of glycosphingolipid synthesis and reduction of total ganglioside content caused a striking reduction in melanoma formation in mice. Only 1/60 (2%) of mice injected ID with 104 antisense-transfected MA173 cells formed a tumor, compared to 31/60 (52%) of mice receiving MEB4 cells and 7/15 (47%) of mice receiving the MS2 sense-transfected cells (p < 0.001 and p = 0.005, respectively). These findings demonstrate that stable transfection of glucosylceramide synthase antisense reduces cellular glycosphingolipid levels and reduces tumorigenicity, providing further experimental support for an enhancing role of gangliosides in tumor formation.

Key words: antisense transfection/glucosylceramide synthase/glycosphingolipids/mouse melanoma/tumorigenesis


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The role of tumor-derived molecules in enhancing tumor formation is increasingly recognized. Acting either on the tumor cell itself or on the host, these molecules may favorably alter the tumor cell microenvironment to enhance tumor implantation and progression. Well-known tumor-derived molecules with such activities include cytokines and chemokines. Another class of molecules that may alter the tumor host microenvironment are tumor-derived gangliosides. These sialic acid–containing glycosphingolipids are components of the outer leaflet of plasma membranes, with their hydrophobic ceramide portion anchored in the membrane and the hydrophilic oligosaccharide chain facing the extracellular environment. They are frequently present in high concentrations in the membranes of tumor cells and are actively shed into their microenvironment (Ladisch et al., 1983Go, 1987; Young et al., 1986Go; Portoukalian et al., 1993Go; Chang et al., 1997Go), in the form of micelles, monomers, and membrane vesicles (Kong et al., 1998Go; Dolo et al., 2000Go).

Gangliosides have a range of biological properties. They enhance the growth factor–mediated proliferation of fibroblasts (Li et al., 2000Go) and the proliferation and migration of human vascular endothelial cells (Lang et al., 2001Go), and they exert potent immunosuppressive activity (Ladisch et al., 1983Go; Floutsis et al., 1989Go; Li et al., 1996Go; Lu and Sharom, 1996Go). By multiple mechanisms, gangliosides inhibit normal human lymphoproliferative responses to mitogens and antigens (Gonwa et al., 1984Go), interleukin 2–dependent cell proliferation (Robb, 1986Go), antigen presenting cell function (Ladisch et al., 1984Go; Heitger and Ladisch, 1996Go), helper T cell proliferation (Chu and Sharom, 1995Go), and NK cell activity (Bergelson et al., 1989Go), and they enhance apoptosis of thymocytes (Zhou et al., 1998Go). Because of their cell surface location, gangliosides are likely to be involved in various membrane-triggered cellular functions, including signal transduction, regulation of cell proliferation and differentiation, and cell death (De Maria et al., 1997Go; Iwabuchi et al., 1998Go; Kopitz et al., 1998Go). Evidence implicating tumor gangliosides in modulating tumor formation in vivo includes (1) a correlation between tumor cell ganglioside content and tumor forming ability and (2) direct experiments showing that addition of tumor gangliosides to the tumor cell inoculum enhances tumor formation in vivo (Ladisch et al., 1987Go).

MEB4 mouse melanoma is characterized by high expression of NeuNAc2-3Galß1-4Glcß1-1Cer (GM3) ganglioside; this high expression is associated with enhanced tumor formation in mice (Ichikawa et al., 1994Go). Recently, we found that the pharmacologic inhibitor of glucosylceramide synthase, 1-phenyl-2-hexadecanoylamino-3-pyrrolidino-1-propanol (PPPP) (Lee et al., 1999Go), was effective in reducing ganglioside content and in inhibiting tumor formation and metastasis by MEB4 cells (Deng et al., 2000Go). However, because the inhibition of ganglioside synthesis by PPPP can only be achieved with the constant presence of this inhibitor in the cell culture, and because cellular recovery from inhibition is relatively rapid (48–72 h after the removal of the inhibitor), we sought to develop a more permanent approach to the alteration of ganglioside metabolism in tumor cells.

Here we transfected MEB4 melanoma cells with an antisense sequence to the gene encoding glucosylceramide synthase. The highly specific inhibition of glucosylceramide synthase, a key enzyme in the pathway of ganglioside synthesis, resulted in substantially reduced ganglioside content and markedly reduced tumorigenicity of these murine melanoma cells.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Antisense vector construction and expression
A 1075 bp cDNA fragment of the gene encoding glucosylceramide synthase (Figure 1A) was obtained by reverse transcription polymerase chain reaction (RT-PCR) with a pair of specific primers. The forward primer, specific to nucleotides 82–102 of the cDNA, had the sequence AGTCCTGACGCGTCATGGCTATCATCTACACCCGA. The reverse primer, to nucleotides 1108–1128, had the sequence AGTCCTGACGCGTCTCTCCAGCTTATAGTTGGGTC. The resulting cDNA fragment was subcloned into the pCI-neo mammalian expression vector under the control of a CMV promoter. The orientation of the fragment in the vector was identified by restriction mapping with Hind III. The vector with the antisense-oriented insert yielded bands of 1176 bp, 1530 bp, and 3815 bp (Figure 1B), and the vector with the sense-oriented insert produced bands of 563 bp, 2143 bp, and 3815 bp (Figure 1B). By sequencing (DNA Sequencing Facility, University of Chicago Cancer Research Center) both the antisense and sense vectors were confirmed to contain the correct cDNA insert with the correct orientation.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Generation and vector integration of a glucosylceramide synthase cDNA fragment. (A) A 1047-bp glucosylceramide synthase cDNA fragment was obtained by RT-PCR from total human medulloblastoma DAOY cell RNA. The forward primer was AGTCCTGACGCGTCATGGCTATCATCTACACCCGA to nucleotides 82–102, and AGTCCTGACGCGTCTCTCCAGCTTATAGTTGGGTC was the reverse primer, to nucleotides 1108–1128. (B) The glucosylceramide cDNA fragment was then subcloned in a pCI-neo mammalian expression vector under the control of a CMV promoter. The orientation of the fragment in the vector was identified by restriction digestion with Hind III. Lanes 1, 8, 11: vector without insert. Lanes 2, 3, 5, 7, and 9: vector with sense-oriented insert. Lanes 4, 6, 10, and 12: vector with antisense-oriented insert.

 
We then generated a number of cell clones by transfection of MEB4 cells with either the antisense vector or the sense vector and selection with G418. The expression of antisense mRNA in antisense-transfected clones was confirmed by RT-PCR using a pair of specific primers. They were TACGACTCACTATAGGCTAGC (nucleotides 1070–1090 of the sense sequence on the vector) and ATCAGGTGGACCAAACTACGA (nucleotides 1110–1130 of the sense sequence on the cDNA), which were designed to amplify only the antisense transcript expressed from the antisense vector. As shown in Figure 2, a 349-bp band was amplified in an antisense vector transfected cell clone, designated MA173, indicating that the antisense vector successfully expressed itself. This antisense-transfected clone was then subjected to the further studies.



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 2. Expression of antisense RNA in antisense-transfected cells. MEB4 cells were transfected with antisense vector and selected with G418. Expression of antisense RNA was evaluated by RT-PCR using the following primers to generate a 349-bp product: TACGACTCACTATAGGCTAGC corresponding to nucleotides 1070–1090 of the sense sequence on the vector and ATCAGGTGGACCAAACTACGA corresponding to nucleotides 1110–1130 of the sense sequence on the cDNA. The antisense vector-transfected clone MA173, shown in the figure, expressed antisense RNA, whereas the control MEB4 cells did not.

 
Ceramide, glucosylceramide, and ganglioside concentrations in antisense-transfected cells
We used several approaches to assess the glycosphingolipids of the antisense-transfected MA173 cells. First, we measured the rate of conversion of UDP-glucose to glucosylceramide and other glycosphingolipids in these cells and control MEB4 cells. The cells were radiolabeled with 14C-UDP-glucose for 18 h, harvested, total lipids extracted, and the neutral glycosphingolipids (NGSLs) separated by partition using di-isopropyl ether/1-butanol/0.1% aqueous NaCl. After recovery from the upper organic phase, the NGSLs were further analyzed by ß-scintillation counting and high-performance thin-layer chromatography (HPTLC). The radioactivity of total NGSLs in MA173 cells was 53% of that of the control MEB4 cells (9.1 versus 17.1 x 103 dpm/106 cells/h) and, as detected by HPTLC autoradiography, included a marked specific reduction (90%) of incorporation of UDP-glucose into glucosylceramide, the direct product of glucosylceramide synthase.

In a second approach we used 3H-serine to metabolically radiolabel cellular ceramide and glucosylceramide. Here we observed a 60% reduction in glucosylceramide content by HPTLC autoradiography (Figure 3B). Following autoradiography, the HPTLC bands were visualized with iodine vapor, scraped off the plate, and quantified by scintillation counting. In MA173 cells the radiolabeled glucosylceramide concentration was decreased by 65%, to 4.2 x 103 dpm or 0.96 nmol/107 cells from 12.2 x 103 dpm or 1.8 nmol/107 MEB4 cells. The level of ceramide was somewhat increased, to 1863 dpm or 2.15 nmol/107 cells from 860 dpm or 0.98 nmol/107 MEB4 cells (Figure 3B). These combined findings clearly demonstrate that antisense transfection was highly efficient in inhibiting glucosylceramide synthase activity.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. Effect of antisense transfection on cellular ceramide and glucosylceramide concentrations. Control MEB4 and antisense-transfected MA173 cells were radiolabeled with 3H-serine for 18 h. Total lipids were extracted and ceramide and glucosylceramide were quantified. (A) HPTLC autoradiography. (B) Ceramide and glucosylceramide were recovered from the plates and quantified by scintillation counting.

 
The major ganglioside of MEB4 cells was previously determined to be GM3 (Deng et al., 2000Go). Using the resorcinol assay and HPTLC densitometry, we quantified the ganglioside content of the sense- and antisense-expressing clones. The parent MEB4 cell line contained 44.2 nmol gangliosides/108 cells, and the ganglioside content of the antisense expressing clone, MA173, was reduced by 56% to 20.4 nmol/108 cells (Figure 4, Table I). In contrast, the ganglioside content of the sense-transfected clone, MS2, was not reduced (Figure 4, Table I). GM3 ganglioside content was further analyzed by fluorescence-activated cell sorting (FACS) analysis using the murine anti-GM3 antibody DH2 and phycoerythrin-conjugated goat-anti-mouse antibody. Control MEB4 and antisense-transfected MA173 cells (2 x 105) were treated with a mild detergent, saplin, to create a temporarily permeable plasma membrane for antibody staining. FACS analysis confirmed a 58% reduction in the density of GM3 ganglioside in MA173 cells in comparison to the control MEB4 cells.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 4. Ganglioside content of antisense and sense-transfected cells. Total cellular gangliosides were purified from glucosylceramide synthase antisense (MA173)- and sense (MS2)-transfected clones, and from the parent MEB4 cell lines, and analyzed by HPTLC. Gangliosides were stained with resorcinol-HCl. HBG: standard human brain gangliosides.

 

View this table:
[in this window]
[in a new window]
 
Table I. Ganglioside content of glucosylceramide synthase antisense/sense transfectants
 
Effects of antisense transfection on morphology, cell growth, and apoptosis
Once this stable antisense transfectant containing reduced ganglioside content and the corresponding sense transfectant were identified, we evaluated the effect of this reduction on cell morphology and proliferation. The reduction of ganglioside content had no impact on cell morphology, demonstrated by the identical morphology of MEB4 and MA173 cells shown in Figure 5A and 5B. To assess proliferation, the cells were cultured for 1–4 days, pulsed with [3H]thymidine for 4 h, and harvested, then cellular [3H]thymidine uptake was quantified. MA173 and MEB4 cells had similar proliferation kinetics (Figure 5C). Furthermore, from daily cell counts performed in parallel with the measurement of thymidine incorporation, the doubling times of MEB4 and MA173 cells were determined to be 23.1 and 23.7 h, respectively. Finally, using flow cytometry to assess for apoptotic cells, we found that the degree of apoptosis in cultures of MA173 and MEB4 cells was nearly equal: 3.3% and 2.7%, respectively.



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 5. Morphology and proliferation kinetics of glucosylceramide synthase antisense-transfected cells. Cells were cultured in Delbecco’s modified Eagle medium with 10% fetal bovine serum. Morphology of MEB4 cells (A) and MA173 antisense transfected cells (B) was assessed by microscopy at 400x magnification. To assess DNA synthesis (C), cells were cultured for 4 days and [3H] thymidine was uptake quantified daily. Bars indicate standard deviation of triplicate cultures at each time point.

 
Effect of antisense transfection on MEB4 cell tumorigenicity
The stably antisense-transfected cell line MA173 and sense-transfected cell line MS2 provided us with ideal tools for investigating the role of gangliosides in tumor formation, because ganglioside content is constantly reduced in MA173 cells without the use of an exogenous pharmacologic agent. We tested tumorigenicity by intradermal (ID) injection of control MEB4 cells, MS2 sense-transfected cells, and MA173 antisense-transfected cells in syngeneic C57B1/6 mice. The cells were cultured until subconfluent, harvested, and resuspended in 0.9% NaCl. Cells (1 x 104 or 1 x 105) cells were injected. As shown in Figure 6A, when 105 cells were injected, all of 15 mice receiving sense-transfected MS2 cells and 51/60 (85%) of the mice receiving control MEB4 cells developed tumors after 2 weeks (p = 0.235), whereas only 30/60 (50%) of the mice receiving MA173 cells formed tumors (p = 0.0003 and p = 0.0001, respectively). When the injected cell number was decreased to 104 cells/mouse (Figure 6B), an even more striking difference was observed. Whereas MS2 sense-transfected cells formed tumors in 7/15 (47%) of mice and MEB4 cells in 31/60 (52%, p = 0.729), MA173 cells only formed a tumor in 1 of 60 mice (p = 0.005 and p < 0.001, respectively).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6. Influence of glucosylceramide synthase sense and antisense transfection on melanoma formation in mice. Female C57BL/6 mice, 6–8 weeks old, were injected ID with 105 (A) or 104 (B) cells. Key: MEB4 cells (squares), a sense transfectant, MS2 (open circles), an antisense transfectant, MA173 (closed circles). Mice were monitored for tumor formation twice weekly. MA173 cells had a significantly lower tumor incidence than did MEB4 (p = 0.0001) or MS2 (p = 0.0003) cells, when 105 cells were injected or when 104 MA173 cells were injected, compared with MEB4 cells (p = 0.005) or MS2 cells (p < 0.001).

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
This study demonstrates the effectiveness of antisense transfection in stably reducing the total cellular ganglioside content of MEB4 cells through inhibition of glycosphingolipid synthesis. The inhibition of glucosylceramide synthesis resulted in a significant reduction in tumorigenicity of MEB4 cells. In contrast, proliferation kinetics, cell morphology, and rate of apoptosis all were unaffected. Thus the alteration in glycosphingolipids in itself did not appear to have significant impact on intrinsic cell behavior in vitro, whereas it has a significant impact on tumor formation in vivo, underlining the potential importance of these molecules in modifying tumor cell–host interactions.

In earlier studies, pharmacologic inhibition of ganglioside synthesis were used to block endogenous cellular ganglioside production. The first such molecule was D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol, an inhibitor of glucosylceramide synthase (Inokuchi et al., 1990Go; Radin, 1994Go; Li and Ladisch, 1996Go). Recently we used the improved, more potent inhibitor PPPP (Lee et al., 1999Go) to inhibit ganglioside synthesis of MEB4 cells. Treatment of MEB4 cells with 0.5 µM PPPP for 4 days resulted in a significant reduction of ganglioside content of MEB4 cells (Deng et al., 2000Go). However, a rapid reversal of the inhibition of ganglioside synthesis was seen when PPPP was removed from the culture medium, and ganglioside content recovered to the original level within 3 days. The requirement of continuing presence of an exogenous inhibitor for efficient inhibition is a disadvantage of this approach.

Two alternative approaches to modify ganglioside synthesis that have been explored by others are antisense oligodeoxynucleotide administration and antisense transfection. Treatment of the human promyelocytic leukemia cell line HL-60 with an antisense oligodeoxynucleotide to II3NeuNAcGgOse3Cer (GM2) synthase down-regulated the synthesis of GM2 and the more complex ganglioside II3NeuNAcGgOse4Cer (GM1) by ~50%. Specificity of the effect was suggested by a concomitant increase in GM3 content without a change in total cellular ganglioside content. Antisense oligodeoxynucleotides to NeuNAc2-8NeuNAc2-3Galß1-4Glcß1-1Cer (GD3) synthase were also used to interfere with ganglioside synthesis (Zeng et al., 1995Go) and to study the function of GD3 in cell apoptosis (De Maria et al., 1997Go). The drawback of antisense oligodeoxynucleotide administration is that oligodeoxynucleotides must be constantly present in the cell culture to achieve sustained inhibition of ganglioside synthesis. This is the same disadvantage as that of standard pharmacological inhibition. Antisense transfection, on the other hand, could provide a way to alter permanently the kinetics of glycosphingolipid synthesis. In the only published study of alteration of ganglioside metabolism using this technique, the GD3 level in rat F11 hybrid neuroblastoma cells was reduced by stable transfection of an antisense vector to GD3 synthase (Zeng et al., 1999Go). This was associated with reduced cell migration in vitro and reduced metastatic potential in a nude mouse model (Zeng et al., 2000Go). Though both of these antisense studies targeted the synthesis of a specific ganglioside (GM2 or GD3), the reduction of total cellular gangliosides by antisense transfection has not been reported.

Here we provide a first demonstration that the ganglioside level of cells can be permanently reduced by transfection of cells with an antisense vector targeting glucosylceramide synthase. The resulting cell line, MA173, expressed the antisense RNA and showed reduction in half of both glucosylceramide and GM3 ganglioside content. Also, synthesis of metabolically radiolabeled glucosylceramide (Ichikawa et al., 1994Go) in MA173 cells was greatly reduced, suggesting that glucosylceramide synthase activity was efficiently inhibited.

The reduction of tumor formation associated with the inhibition of glucosylceramide synthesis by antisense transfection was striking and shows that reduction of tumor cell glycosphingolipids is associated with significantly reduced tumor incidence. These results are consistent with our previous findings using the pharmacologic inhibitor PPPP (Deng et al., 2000Go), in which reduction of tumor cell glycosphingolipids was also associated with significant reduction in tumor incidence. In the present study, the constitutive inhibition of ganglioside synthesis circumvented possible complications that could result from the recovery of ganglioside synthesis after the removal of an inhibitor.

The mechanism(s) underlying significant inhibition of tumor formation after inhibition of glucosylceramide synthesis remain to be elucidated. Several possible mechanisms must be considered. First, because inhibition of glucosylceramide synthase may cause accumulation of ceramide (the substrate for this enzyme), and because elevated ceramide levels have been associated with increased apoptosis, the possibility that increased apoptotic cell death could be the cause of decreased tumorigenicity was investigated. In the MA173 cell line, in which ceramide was somewhat elevated, there was neither a reduction in cell viability nor an increase in apoptosis compared with the control MEB4 cells. These findings exclude decreased intrinsic cell survival as a cause for decreased tumor formation. Second is a possible effect of decreased concentrations of the neutral glycosphingolipid products of glucosylceramide synthase, glucosylceramide, and lactosylceramide. However, to the extent studied, NGSLs (lacking sialic acid) have not been found to affect host cell responses that may influence tumor formation (such as the cellular immune response), which are affected by their sialic acid–containing products, gangliosides (Lengle and Krishnaraj, 1979Go; Ladisch et al., 1992Go).

Existing knowledge of these biological properties of gangliosides may give some clues to the mechanism of decreased tumor formation. One is that the inhibition of shedding caused by blockade of synthesis stops the release of immunosuppressive gangliosides (Li and Ladisch, 1996Go), which act to inhibit host immune responses to tumors through suppression of immune cell function at the tumor site (Ladisch et al., 1987Go; Li et al., 1995Go; McKallip et al., 1999Go). Most recently we have obtained direct evidence that GM1b ganglioside shed by a murine lymphoma inhibits the specific immune response against this syngeneic tumor in vivo, including the primary anti-tumor immune response, the secondary response, and the generation of tumor-specific cytotoxic lymphocytes (McKallip et al., 1999Go). Another property that may be operative is ganglioside enhancement of growth factor–mediated proliferation of normal fibroblasts (Li et al., 2000Go) and of human vascular endothelial cells (Lang et al., 2001Go), important in tumor-associated angiogenesis.

Although the cellular mechanisms remain to be fully elucidated, the significant reduction of tumor formation by antisense transfection of glucosylceramide synthase suggests that highly specific pharmacologic interference with glycosphingolipid metabolism warrants further study as a potential experimental therapeutic approach to cancer.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Cell lines and culture conditions
MEB4 cells (Ichikawa et al., 1994Go), a subline of B16 murine melanoma cells, were obtained from the RIKEN Cell Bank (Saitama, Japan). The cells were maintained in Dulbecco’s modified Eagle’s medium enriched in glucose, glutamine, and sodium pyruvate (Gibco), and supplemented with 10% heat-inactivated fetal bovine serum. Cultures were maintained under 5% CO2 in a humidified incubator at 37°C.

Vector construction and transfection
A glucosylceramide synthase cDNA fragment corresponding to the nucleotides 82–1128 of the published sequence of human glucosylceramide synthase (Ichikawa et al., 1996Go) was obtained by RT-PCR from total human RNA (human medulloblastoma DAOY cells) with two primers: AGTCCTGACGCGTCATGGCTATCATCTACACCCGA (forward primer specific to nucleotides 82–102) and AGTCCTGACGCGTCTCTCCAGCTTATAGTTGGGTC (reverse primer specific to nucleotide of 1108–1128). Both primers contain an extra 14-nucleotide segment, which has a restriction site for Mlu-1 endonuclease. The restriction site permits the cloning of the 1075-bp-long cDNA fragment into the polylinker region of the pCI-neo mammalian expression vector at the Mlu-1 site. The orientation of inserts was identified by restriction mapping with Hind III enzyme, for which there is one restriction site on the inserts and two sites on the vector. Antisense and sense vectors were identified by different digestion patterns, with three distinguishable bands.

MEB4 cells were transfected by electroporation using the gene pulser II (Bio-Rad) at 375 µF and 500 V. Stable transfectants were selected by incubating the cells in 1 mg/ml of the antibiotic G-418 for 10–14 days beginning 2 days after the electroporation. Individual surviving and proliferating colonies were then collected and cultured in fresh medium containing 500 µg/ml G418. The transfection efficiency was about 0.05%, which is the range of anticipated efficiency by electroporation (Potter, 1996Go).

Antisense expression by RT-PCR
Expression of the antisense was studied by RT-PCR with a pair of primers: TACGACTCACTATAGGCTAGC (the same sequence as a part of the polylinker region of the vector between the transcription starting point and the insert) and ATCAGGTGGACCAAACTACGA (the same sequence as the nucleotides from 819 to 839). Successful use of this pair of primers to amplify the cDNA fragment, which is 349 bp in length, showed that the cDNA fragment was inserted into the vector in antisense orientation.

Flow cytometry
To determine cellular GM3 expression, 2 x 105 MEB4 cells or the transfectants were detached using trypsin, which was neutralized by adding 10-fold serum-containing medium. The cells were incubated for 1 h at 37°C to repair any membrane damage due to the trypsinization, resuspended in cold Hank’s buffered saline solution (HBSS)/0.5% bovine serum albumin (BSA)/0.1% NaN3, sequentially incubated with DH2, a murine anti-GM3 antibody (Dohi et al., 1988Go) and phycoerythrin-conjugated goat monoclonal anti-mouse antibody on ice for 30 min, and washed three times with HBSS/0.5% BSA/0.1% NaN3. To quantify apoptosis, cells were assessed (Schutte et al., 1995Go; Vermes et al., 1995Go) for expression of annexin V and uptake of 7-aminoactinomycin D. Apoptotic cells were identified as annexin V–positive, 7-aminoactinomycin D–negative. Flow cytometry was performed using a FACStar Plus flow cytometer (Becton Dickinson). Fluorescence was measured as molecules of equivalent soluble fluorochrome.

Lipid analyses of antisense-transfected cells
To assess the effect of the antisense transfection on incorporation of UDP-glucose into glucosylceramide, cells were cultured to subconfluence and then labeled with 5 µCi/ml 14C-UDP-glucose for 18 h, harvested, and lyophilized. Ten nmol unlabeled GM3 ganglioside was added to the cells as a cold carrier before extraction twice with 5 ml chloroform:methanol (1:1). The combined extracts were dried down under N2, lyophilized, and partitioned twice with 2 ml di-isopropyl ether/1-butanol (60:40, by vol) and 1 ml 0.1% aqueous NaCl (Ladisch and Gillard, 1985Go). The upper organic phases, which contain most of the NGSLs, were combined and dried down under N2, lyophilized, and redissolved in chloroform:methanol (1:1) for aliquoting for ß-scintillation counting and HPTLC analysis.

Cell lipids were also analyzed by metabolic radiolabeling of the cells with 1.0 µCi/ml [3H] serine (21.7 Ci/mmol, NEN). After a 24-h incubation, the cells were washed three times with phosphate buffered saline (PBS) and the cell pellet processed for sphingolipid analysis. For ceramide determination (Rani et al., 1995Go), the pellet was extracted twice with 4 ml chloroform:methanol (1:1), centrifuged at 1000 x g for 10 min, and the supernatants pooled. Chloroform (5 ml) and 0.9% NaCl (4 ml) were added to the supernatants, which were then vortexed and centrifuged at 1000 x g. The lower phase was retained, dried under a nitrogen stream, and resuspended in chloroform:methanol (1:1), and the radioactivity determined by scintillation counting. For glucosylceramide determination (Lavie et al., 1997Go), the pellets were resuspended in 2 ml methanol with 2% acetic acid. Unlabeled glucosylceramide (5 µg) was added as a carrier to aid in recovery. The lipids were extracted with 2 ml chloroform and 2 ml water, by vortexing, sonication, and centrifugation at 1000 x g for 10 min. The lower organic phase was retained, dried under a nitrogen stream, and radioactivity quantified.

Equivalent amounts of radiolabeled lipid extracts and unlabeled ceramide or glucosylceramide standards were analyzed by HPTLC following resolution in either chloroform:acetic acid (9:1) for ceramide or chloroform:methanol:ammonium hydroxide (65:25:5) for glucosylceramide. The HPTLC plate was split to separate the unlabeled standards, which were visualized by charring (Fewster et al., 1969Go). The portion of the plate containing the radioactive lipids was sprayed with En3hanceTM (NEN) and analyzed by HPTLC autoradiography by exposure of the plate to XRP X-ray film (Eastman Kodak, Rochester, NY). Densitometric scanning analysis of the samples was performed using a Scan Maker 5 scanner (Microtek) and Scion Image Analysis (NIH Image 160) software. To test for ceramide, after development of the HPTLC lipids were visualized by iodine vapor and the ceramide area was scraped into 0.5 ml water. Counting fluid was added, and the radioactivity was quantified by scintillation counting (Liu et al., 2000Go). Total cellular protein was quantified by a modification of the Lowry method (Markwell et al., 1981Go).

Gangliosides were also isolated from the cell pellets. The gangliosides were recovered from the final lower aqueous phase of the di-isopropyl ether/1-butanol partition method as described but without the addition of cold carrier. This aqueous phase was lyophilized and redissolved in a small volume of distilled water. Salts and low-molecular-weight impurities were removed from the total ganglioside fraction by Sephadex G-50 gel filtration. Gangliosides, recovered in the void volume, were lyophilized and quantified as nanomoles of lipid-bound sialic acid by the colorimetric resorcinol assay (Ledeen and Yu, 1982Go). For HPTLC analysis, they were spotted on 10 x 20 cm precoated Silica Gel-60 HPTLC plates, which were then developed in chloroform:methanol, 0.25% CaCl2 2H2O (60:40:9, by vol). Gangliosides were visualized as purple bands with resorcinol-HCl reagent (Ledeen and Yu, 1982Go), and quantified by densitometry.

Cell proliferation assay
To assess the effect of antisense transfection on the proliferation kinetics of MEB4 cells, the cells were cultured in 96-well plates. Triplicate cultures were harvested daily for up to 4 days. Before harvesting, cells were incubated for 4 h with [3H]thymidine at 3.3 µCi/ml and then rinsed twice with ice-cold PBS. Cells were detached in 1% trypsin/ethylenediamine tetra-acetic acid. Incorporated [3H]thymidine was quantified by ß-scintillation counting.

Tumorigenicity assay
Tumor formation was detected as the development of palpable tumors following ID injection of tumor cells. Female syngeneic C57BL/6 mice, 6–8 weeks old, were used. MEB4, MS2, and MA173 cells were washed in PBS and resuspended, and viability was assessed by trypan blue dye exclusion. Twenty microliters of the resuspended cells (104 or 105 cells) were injected ID on the back of each mouse. The mice were examined for tumor formation twice weekly for 10 weeks.

Statistical analysis
To test significance of differences in the absolute proportion of tumors formed in each of the three groups at the final time point, a logistic regression was performed on data for each cell number administered (104 or 105). Logistic regression allowed estimation of odds ratios (ratio of the odds of tumor production between two groups). Because 105 control MEB4 cells/mouse caused a 100% tumor incidence at 8 weeks, we used an exact logistic procedure to examine these odds ratios and test significance, using LogExact software. To examine the proportion of tumors over time a generalized estimating equation approach was used; this allows for the testing of the difference in tumor growth between the three groups over the entire study period.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
We thank Dr. Sen-Itoroh Hakomori for the DH2 antibody, Barbara Taylor and William King for the FACS analyses, Dr. Bonnie LaFleur for assistance in statistical analysis, and Guy Lotrecchiano for preparation of the manuscript. This work was supported by grant CA61010 from the National Cancer Institute.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
BSA, bovine serum albumin; FACS, florescence-activated cell sorting; GD3, NeuNAc2-8NeuNAc2-3Galß1-4Glcß1-1Cer; GM1, II3NeuNAcGgOse4Cer; GM2, II3NeuNAcGgOse3Cer; GM3, NeuNAc2-3Galß1-4Glcß1-1Cer; HBSS, Hank’s buffered saline solution; HPTLC, high-performance thin-layer chromatography; NGSL, neutral glycosphingolipid; PBS, phosphate buffered saline; PPPP, 1-phenyl-2-hexadecanoylamino-3-pyrrolidino-1-propanol; RT-PCR, reverse transcription polymerase chain reaction.


    Footnotes
 
1 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Bergelson, L.D., Dyatlovitskaya, E.V., Klyuchareva, T.E., Kryukova, E.V. Lemenovskaya, A.F., Matveeva, V.A., and Sinitsyna, E.V. (1989) The role of glycosphingolipids in natural immunity. Gangliosides modulate the cytotoxicity of natural killer cells. Eur. J. Immunol., 19, 1979–1983.[Web of Science][Medline]

Chang, F., Li, R., and Ladisch, S. (1997) Shedding of gangliosides by human medulloblastoma cells. Exp. Cell Res., 234, 341–346.[CrossRef][Web of Science][Medline]

Chu, J.W. and Sharom, F.J. (1995) Gangliosides interact with interleukin-4 and inhibit interleukin-4-stimulated helper T-cell proliferation. Immunology, 84, 396–403.[Web of Science][Medline]

De Maria, R., Lenti, L., Malisan, F., d’Agostino, F., Tomassini, B., Zeuner, A., Rippo, M.R., and Testi, R. (1997) Requirement for GD3 ganglioside in CD95- and ceramide-induced apoptosis. Science, 277(5332), 1652–1655; erratum Science (1998), 280, 363.[Abstract/Free Full Text]

Deng, W., Li, R. and Ladisch, S. (2000) Influence of cellular ganglioside depletion on tumor formation. J. Natl Cancer Inst., 92, 912–917.[Abstract/Free Full Text]

Dohi, T., Nores, G., and Hakomori, S. (1988) An IgG3 monoclonal antibody established after immunization with GM3 lactone: immunochemical specificity and inhibition of melanoma cell growth in vitro and in vivo. Cancer Res., 48, 5680–5685.[Abstract/Free Full Text]

Dolo, V., Li, R., Dillinger, M., Flati, S., Manela, J., Taylor, B.J., Pavan, A., and Ladish, S. (2000) Enrichment and localization of ganglioside G(D3) and caveolin-1 in shed tumor cell membrane vesicles. Biochim. Biophys. Acta, 1486, 265–274.[Medline]

Fewster, M., Burns, B., and Mead, J. (1969) Quantitative densitometric thin-layer chromotography of lipids using copper acetate reagent. J. Chromatogr., 43, 120–126.[CrossRef][Web of Science][Medline]

Floutsis, G., Ulsh, L., and Ladisch, S. (1989) Immunosuppressive activity of human neuroblastoma tumor gangliosides. Int. J. Cancer, 43, 6–9.[Web of Science][Medline]

Gonwa, T.A., Westrick, M.A., and Macher, B.A. (1984) Inhibition of mitogen- and antigen-induced lymphocyte activation by human leukemia cell gangliosides. Cancer Res., 44, 3467–3470.[Abstract/Free Full Text]

Heitger, A. and Ladisch, S. (1996) Gangliosides block antigen presentation by human monocytes. Biochim. Biophys. Acta, 1303, 161–168.[Medline]

Ichikawa, S., Nakajo, N., Sakiyama, H., and Hirabayashi, Y. (1994) A mouse B16 melanoma mutant deficient in glycolipids. Proc. Natl Acad. Sci. USA, 91, 2703–2707.[Abstract/Free Full Text]

Ichikawa, S., Sakiyama, H., Suzuki, G., Hidari, K.I., and Hirabayashi, Y. (1996) Expression cloning of a cDNA for human ceramide glucosyltransferase that catalyzes the first glycosylation step of glycosphingolipid synthesis. Proc. Natl Acad. Sci. USA, 93(10), 4638–4643; erratum Proc. Natl Acad. Sci. USA (1996), 93, 12654.[Abstract/Free Full Text]

Inokuchi, J., Jimbo, M., Momosaki, K., Shimeno, H., Nagamatsu, A., and Radin, N.S. (1990) Inhibition of experimental metastasis of murine Lewis lung carcinoma by an inhibitor of glucosylceramide synthase and its possible mechanism of action. Cancer Res., 50, 6731–6737.[Abstract/Free Full Text]

Iwabuchi, K., Yamamura, S., Prinetti, A., Handa, K., and Hakomori, S. (1998) GM3-enriched microdomain involved in cell adhesion and signal transduction through carbohydrate-carbohydrate interaction in mouse melanoma B16 cells. J. Biol. Chem., 273, 9130–9138.[Abstract/Free Full Text]

Kong, Y., Li, R., and Ladisch, S. (1998) Natural forms of shed tumor gangliosides. Biochim. Biophys. Acta, 1394, 43–56.[Medline]

Kopitz, J., von Reitzenstein, C., Burchert, M., Cantz, M., and Gabius, H.J. (1998) Galectin-1 is a major receptor for ganglioside GM1, a product of the growth-controlling activity of a cell surface ganglioside sialidase, on human neuroblastoma cells in culture. J. Biol. Chem., 273, 11205–11211.[Abstract/Free Full Text]

Ladisch, S. and Gillard, B. (1985) A solvent partition method for microscale ganglioside purification. Anal. Biochem., 146, 220–231.[CrossRef][Web of Science][Medline]

Ladisch, S., Gillard, B., Wong, C., and Ulsh, L. (1983) Shedding and immunoregulatory activity of YAC-1 lymphoma cell gangliosides. Cancer Res., 43, 3808–3813.[Abstract/Free Full Text]

Ladisch, S., Ulsh, L., Gillard, B., and Wong, C. (1984) Modulation of the immune response by gangliosides. Inhibition of adherent monocyte accessory function in vitro. J. Clin. Invest., 74, 2074–2081.

Ladisch, S., Kitada, S., and Hays, E.F. (1987) Gangliosides shed by tumor cells enhance tumor formation in mice. J. Clin. Invest., 79, 1879–1882.

Ladisch, S., Becker, H., and Ulsh, L. (1992) Immunosuppression by human gangliosides: I. Relationship of carbohydrate structure to the inhibition of T cell responses. Biochim. Biophys. Acta, 1125, 180–188.[Medline]

Lang, Z., Guerrera, M., Li, R., and Ladisch, S. (2001) Ganglioside GD1a enhances VEGF-induced endothelial cell proliferation and migration. BBRC.

Lavie, Y., Cao, H., Volner, A., Lucci, A., Han, T.Y., Geffen, V., Giuliano, A.E., and Cabot, M.C. (1997) Agents that reverse multidrug resistance, tamoxifen, verapamil, and cyclosporin A, block glycosphingolipid metabolism by inhibiting ceramide glycosylation in human cancer cells. J. Biol. Chem., 272, 1682–1687.[Abstract/Free Full Text]

Ledeen, R.W. and Yu, R.K. (1982) Gangliosides: structure, isolation, and analysis. Methods Enzymol., 83, 139–191.[Web of Science][Medline]

Lee, L., Abe, A., and Shayman, J.A. (1999) Improved inhibitors of glucosylceramide synthase. J. Biol. Chem., 274, 14662–14669.[Abstract/Free Full Text]

Lengle, E. and Krishnaraj, R. (1979) Inhibition of lectin-induced mitogenic response to thymocytes by glycolipids. Cancer Res., 39, 817–822.[Abstract/Free Full Text]

Li, R. and Ladisch, S. (1996) Abrogation of shedding of immunosuppressive neuroblastoma gangliosides. Cancer Res., 56, 4602–4605.[Abstract/Free Full Text]

Li, R., Villacreses, N., and Ladisch, S. (1995) Human tumor gangliosides inhibit murine immune responses in vivo. Cancer Res., 55, 211–214.[Abstract/Free Full Text]

Li, R., Gage, D., McKallip, R., and Ladisch, S. (1996) Structural characterization and in vivo immunosuppressive activity of neuroblastoma GD2. Glycoconj. J., 13, 385–389.[CrossRef][Web of Science][Medline]

Li, R., Manela, J., Kong, Y., and Ladisch, S. (2000) Cellular gangliosides promote growth factor-induced proliferation of fibroblasts. J. Biol. Chem., 275, 34213–34223.[Abstract/Free Full Text]

Liu, Y.Y., Han, T.Y., Giuliano, A.E., Hansen, N., and Cabot, M.C. (2000) Uncoupling ceramide glycosylation by transfection of glucosylceramide synthase antisense reverses adriamycin resistance. J. Biol. Chem., 275, 7138–7143.[Abstract/Free Full Text]

Lu, P. and Sharom, F.J. (1996) Immunosuppression by YAC-1 lymphoma: role of shed gangliosides. Cell Immunol., 173, 22–32.[CrossRef][Web of Science][Medline]

Markwell, M.A., Haas, S.M., Tolbert, N.E., and Bieber, L.L. (1981) Protein determination in membrane and lipoprotein samples: manual and automated procedures. Meth. Enzymol., 72, 296–303.[Medline]

McKallip, R., Li, R., and Ladisch, S. (1999) Tumor gangliosides inhibit the tumor-specific immune response. J. Immunol., 163, 3718–3726.[Abstract/Free Full Text]

Portoukalian, J., David, M.J., Gain, P., and Richard, M. (1993) Shedding of GD2 ganglioside in patients with retinoblastoma. Int. J. Cancer, 53, 948–951.[Web of Science][Medline]

Potter, H. (1996) Transfection by electroporation. In Ausubel, F.M. and others, eds. Current protocols in molecular biology. Wiley, New York, pp. 9.31–9.36.

Radin, N.S. (1994) Rationales for cancer chemotherapy with PDMP, a specific inhibitor of glucosylceramide synthase. Mol. Chem. Neuropathol., 21), 111–127.[Web of Science][Medline]

Rani, C.S., Abe, A., Chang, Y., Rosenzweig, N., Saltiel, A.R., Radin, N.S., and Shayman, J.A. (1995) Cell cycle arrest induced by an inhibitor of glucosylceramide synthase. Correlation with cyclin-dependent kinases. J. Biol. Chem., 270, 2859–2867.[Abstract/Free Full Text]

Robb, R.J. (1986) The suppressive effect of gangliosides upon IL 2-dependent proliferation as a function of inhibition of IL 2-receptor association. J. Immunol., 136, 971–976.[Abstract]

Schutte, B., Tinnemans, M.M., Pijpers, G.F., Lenders, M.H., and Ramaekers, F.C. (1995) Three parameter flow cytometric analysis for simultaneous detection of cytokeratin, proliferation associated antigens and DNA content. Cytometry, 21, 177–186.[CrossRef][Web of Science][Medline]

Vermes, I., Haanen, C., Seffens-Nakken, H., and Reutelingsperger, C. (1995) A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V. J. Immunol. Meth., 184, 39–51.[CrossRef][Web of Science][Medline]

Young, W.W. Jr., Borgman, C.A., and Wolock, D.M. (1986) Modes of shedding of glycosphingolipids from mouse lymphoma cells. J. Biol. Chem., 261, 2279–2283.[Abstract/Free Full Text]

Zeng, G., Ariga, T., Gu, X.B., and Yu, R.K. (1995) Regulation of glycolipid synthesis in HL-60 cells by antisense oligodeoxynucleotides to glycosyltransferase sequences: effect on cellular differentiation. Proc. Natl Acad. Sci. USA, 92, 8670–8764.[Abstract/Free Full Text]

Zeng, G., Li, D.D., Gao, L., Birkle, S., Bieberich, E., Tokuda, A., and Yu, R.K. (1999) Alteration of ganglioside composition by stable transfection with antisense vectors against GD3-synthase gene expression. Biochemistry, 38, 8762–8769.[CrossRef][Medline]

Zeng, G., Gao, L., and Yu, R.K. (2000) Reduced cell migration, tumor growth and experimental metastasis of rat F-11 cells whose expression of GD3-synthase is suppressed. Int. J. Cancer, 88, 53–57.[CrossRef][Web of Science][Medline]

Zhou, J., Shao, H., Cox, N.R., Baker, H.J., and Ewald, S.J. (1998) Gangliosides enhance apoptosis of thymocytes. Cell Immunol., 183, 90–98.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Lipid Res.Home page
Y.-Y. Liu, T. Y. Han, J. Y. Yu, A. Bitterman, A. Le, A. E. Giuliano, and M. C. Cabot
Oligonucleotides blocking glucosylceramide synthase expression selectively reverse drug resistance in cancer cells
J. Lipid Res., May 1, 2004; 45(5): 933 - 940.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
V. Gouaze, J. Y. Yu, R. J. Bleicher, T.-Y. Han, Y.-Y. Liu, H. Wang, M. M. Gottesman, A. Bitterman, A. E. Giuliano, and M. C. Cabot
Overexpression of glucosylceramide synthase and P-glycoprotein in cancer cells selected for resistance to natural product chemotherapy
Mol. Cancer Ther., May 1, 2004; 3(5): 633 - 640.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Weiss, S. Hettmer, P. Smith, and S. Ladisch
Inhibition of Melanoma Tumor Growth by a Novel Inhibitor of Glucosylceramide Synthase
Cancer Res., July 1, 2003; 63(13): 3654 - 3658.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Deng, W.
Right arrow Articles by Ladisch, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, W.
Right arrow Articles by Ladisch, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?