Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kim, K.
Right arrow Articles by Palter, K. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, K.
Right arrow Articles by Palter, K. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2002, Vol. 12, No. 2 73-83
© 2002 Oxford University Press

Expression of a functional Drosophila melanogaster N-acetylneuraminic acid (Neu5Ac) phosphate synthase gene: evidence for endogenous sialic acid biosynthetic ability in insects

Kildong Kim1,3, Shawn M. Lawrence1,4, Jung Park3, Lee Pitts4, Willie F. Vann5, Michael J. Betenbaugh4 and Karen B. Palter2,3

3Department of Biology, Temple University, Philadelphia, PA 19122, USA; 4Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218, USA; and 5Laboratory of Bacterial Toxins and Laboratory of Bacterial Polysaccharides, Food and Drug Administration, Bethesda, MD 20892, USA

Received on August 17, 2001; revised on September 20, 2001; accepted on September 21, 2001.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
In this study, we report the first cloning and characterization of a N-acetylneuraminic acid phosphate synthase gene from Drosophila melanogaster, an insect in the protostome lineage. The gene is ubiquitously expressed at all stages of Drosophila development and in Schneider cells. Similar to the human homologue, the gene encodes an enzyme with dual substrate specificity that can use either N-acetylmannosamine 6-phosphate or mannose 6-phosphate to generate phosphorylated forms of both the sialic acids, N-acetylneuraminic acid and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid, respectively, when expressed in either bacterial or baculoviral expression systems. The identification of a functional sialic acid synthase in Drosophila indicates that insects have the biosynthetic capability to produce sialic acids endogenously. Although sialylation is widely distributed in organisms of the deuterstome lineage, genetic evidence concerning the presence or absence of sialic acid metabolism in organisms of the protostome lineage has been lacking. Homology searches of the Drosophila genome identified putative orthologues of other genes required for sialylation of glycoconjugates.

Key words: insects/KDN/N-acetylneuraminic acid/sialic acid synthase


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
The sialic acids are a diverse family of nine carbon 2-keto-3-deoxy sugars that mainly occur as terminal components of cell surface glycoproteins and glycolipids (Schauer et al., 1995Go). The sialic acid residues of glycoconjugates vary in derivative type and glycosidic linkage and are cell type–specific and developmentally regulated. The specific sialylation pattern of glycoconjugates is due to regulated expression of specific sialyltransferases (Schauer et al., 1995Go). The presence of the negatively charged sialic acid residue on individual glycoconjugates can have profound effects on its biological properties and that of nearby cell surfaces and thereby influences a variety of complex biological processes (Varki, 1993Go). For example, the regulated presence or absence of polysialic polymers on the neural cell adhesion molecule (NCAM) is required for proper establishment of the vertebrate embryonic nervous system (Cunningham et al., 1983Go; Hoffman and Edelman, 1983Go), and diminished sialylation of neuronal gangliosides (sialoglycosphingolipids) results in loss of neurital processes and neuronal loss of function (Rosenberg, 1995Go). Additionally, sialic acid residues are ligands for endogenous lectins of the inflammatory and immune responses (Varki, 1993Go), and changes in sialylation patterns have been associated with tumorogenesis and cancer metastasis (Fukuda, 1996Go; Schauer et al., 1995Go; Takano et al., 1994Go).

Expression of sialic acids was originally believed to be restricted to the deuterostome lineage, having been observed in echinoderms, hemichordates, cephalochordates, and vertebrates (Warren, 1963Go; Corfield and Schauer, 1982Go). Certain pathogenic and commensal bacteria, viruses, and fungi have been found to contain sialic acids as well (Corfield and Schauer, 1982Go; Schauer and Kammerling, 1997Go). Whether the ability of bacteria to synthesize sialic acids is ancestral or reflects the later acquisition of this capability by horizontal transfer via phages (Roggentin et al., 1993Go) is not resolved. Recently, sialic acids have also been detected in organisms of the protostome lineage (including nematodes, arthropods, and mollusks) (Roth et al., 1992Go; D'Amico and Jacob, 1995Go; Malykh et al., 1999Go; Park et al., 1999Go).

Staining of Drosophila early embryonic stages with sialic acid–binding lectins from Limulus polyhemus (LPA) and Limas flavus (LFA) has been reported and is neuraminidase-sensitive (Roth et al., 1992Go). In later embryonic stages, LFA stains both neural and general ectodermal cells and western blot analysis with a poly {alpha} 2,8 sialic acid (PSA)–specific monoclonal antibody detects a high molecular weight band between 14 and 18 h of embyogenesis. Because this developmental period corresponds to active nervous system development, it was suggested (Roth et al., 1992Go) that PSA expression modifies axonal and cell adhesion molecule function during Drosophila development as it does during formation of the mammalian nervous system (Acheson et al., 1991Go). Sialic acid was detected in the vacuoles of the Malpighian tubules of larvae of the cicada Philaenus spumarius (Malykh et al., 1999Go) by cytochemical staining using lectins from Sambucus nigra and LFA, as well as by using a monoclonal antibody specific for PSA. The presence of sialic acid was confirmed by gas-liquid chromatography–mass spectroscopy (GLC-MS) in both of these studies (Roth et al., 1992Go; Malykh et al., 1999Go). However, the direct detection of sialic acids is not definitive proof of cellular activity due to potential contamination by pathogens, dietary sources, or serum from cell culture media (Warren, 1963Go; Corfield and Schauer, 1982Go; Park et al., 1999Go; Angata and Varki, 2000Go), reviewed in Marchal et al. (2001)Go. In fact, the vast majority of glycoproteins from insects contain truncated (paucimannosidic) or hybrid structures terminating in mannose or N-acetylglucosamine (Williams et al., 1991Go; Altmann et al., 1999Go; Marchal et al., 2001Go), and the majority of secreted and membrane-bound mammalian glycopoteins contain complex oligosaccharides terminating in sialic acid. So far, glycosphingolipids with sialic acid have not been detected in Drosophila (Seppo et al., 2000Go; Seppo and Tiemeyer, 2000Go). Furthermore, Hooker et al. (1999)Go and Tomiya et al. (2001)Go were unable to detect any CMP-Neu5Ac donor substrates nor sialyltransferase activity in a variety of insect cell lines.

Consequently there is still considerable ambiguity as to whether insects possess the intrinsic biosynthetic capacity to produce sialic acids; if they do, then what is the nature of the glycoconjugates and their biological roles? We have taken advantage of the nearly completed genome of Drosophila melanogaster (Adams et al., 2000Go) to perform homology searches for orthologues of key enzymes in the sialic acid pathway. Using the sequence information from the Escherichia coli (neuB) (Annunziato et al., 1995Go) and human (human SAS) (Lawrence et al., 2000Go) sialic acid synthase genes, we identified a homologous genomic sequence in Drosophila and subsequently cloned and characterized the corresponding cDNA encoding the first N-acetylneuraminic acid phosphate synthase gene for any protostome species. Futhermore, we show that the Drosophila enzyme (DmSAS) uses phosphorylated substrates to generate phosphorylated sialic acids as observed in human and mouse (Lawrence et al., 2000Go; Nakata et al., 2000Go), rather than the unphosphorylated substrates utilized by the E. coli enzyme (Vann et al., 1997Go). Similar to the human homologue, this enzyme exhibits multifunctional substrate activity and uses both N-acetylmannosamine-6-phosphate (ManNAc-6-P) and mannose-6-phosphate (Man-6-P) for the generation of phosphorylated forms of both N-acetylneuraminic acid (Neu5Ac) and deaminated Neu5Ac (2-keto-3-deoxy-D-glycero-D-galacto-nononic acid; KDN), sialic acids, respectively. Reverse transcriptase polymerase chain reaction (RT-PCR) analysis shows that the DmSAS mRNA is ubiquitously expressed across different stages of development. The identification of a functional sialic acid synthase gene in Drosophila offers compelling evidence that insects can utilize an endogenous biosynthetic pathway to produce sialic acids. We also discuss the identification of other putative genes encoding key enzymes in the sialic acid pathway of Drosophila. With this knowledge, it should now be possible to elucidate the biological roles of these newly identified genes using the sophisticated genetic approaches available in Drosophila.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
Identification of a D. melanogaster sialic acid phosphate synthase gene
The recent literature concerning the ability of insects to synthesize sialic acids endogenously has been contradictory owing to the very low levels of sialic acid that have been detected (Malykh et al., 1999Go; Angata and Varki, 2000Go; Seppo and Tiemeyer, 2000Go; Marchal et al., 2001Go). Given the importance of sialylation in vertebrate development, especially of the nervous system, we wondered whether sialylation might play an equally important role in D. melanogaster development. We reasoned that if Drosophila has sialic acid biosynthetic capability, we should be able to identify genes encoding key enzymes in the sialylation pathway by performing homology searches using the sequences from the bacterial and mammalian genes. The amino acid sequences of both the E. coli sialic acid synthase (Annunziato et al., 1995Go) and human sialic acid phosphate synthase (Lawrence et al., 2000Go) were used to query the Drosophila Genome database for genomic DNA encoding homologous sequences (Flybase, 1999Go; Adams et al., 2000Go). A single genomic clone coming from band 87B15 on the third chromosome had significant homology (originally listed under AC007594 and AC017132, but now AE003695). As we failed to identify a corresponding cDNA clone in the expressed sequence tag (EST) database, we cloned a cDNA using RT-PCR of total RNA from 0–16-h embryos. The abundance of this transcript is likely to be very low as RT-PCR of non-DNased RNA resulted only in amplification of contaminating genomic DNA. However, RT-PCR of DNase I–treated RNA resulted in amplification of the desired cDNA, which was distinguishable because it lacked a 106-bp intronic sequence. The cDNA sequence of the D. melanogaster sialic acid phosphate synthase (DmSAS) (Figure 1) is predicted to encode a protein of 373 amino acids, with a molecular weight of 41 kDa. Homology alignments between the Drosophila, human, and bacterial sialic acid synthase enzymes (Figure 2) show that the proteins are homologous over their entire length. The Drosophila protein shares 48.7% amino acid identity with the human protein and 35.3% identity with the bacterial protein, whereas the human and bacterial proteins share 36.1% identity (Lawrence et al., 2000Go). Since we began this work, the Berkeley Drosophila Genome Project annotators identified this gene as encoding a sialic acid synthase, however, the Gadfly Acc CG5232 predicts that the protein initiates at what we believe to be an internal methionine based on the high conservation of the upstream sequence to the human and bacterial proteins.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. DmSAS cDNA sequence. The DNA (top row) and amino acid (bottom row) sequences are shown. The arrow indicates the position of a 106-bp intron, which is absent in the cDNA but present in the genomic sequence. Accession no. AF397531 describes the cDNA sequence.

 


View larger version (107K):
[in this window]
[in a new window]
 
Fig. 2. Comparisons of the amino acid sequences of the D. melanogaster, human, and E. coli sialic acid synthase proteins. The protein sequences of each were aligned using the Pile-up program of GCG (Madison, WI), which uses progressive pairwise alignments. Gaps introduced to maximize homology are shown as dots. Identical amino acids are represented by black boxes, and similar amino acids are represented by gray boxes. The D. melanogaster SAS protein shares 48.7% identity with the human protein and 35.3% identity with the bacterial protein. Accession no. U05248 describes the bacterial sialic acid synthase and AF257466 the human sialic acid synthase.

 
Developmental expression of DmSAS
RT-PCR of total RNA from staged Drosophila or S2 cells (Figure 3A) or PCR of normalized cDNA from all Drosophila developmental stages (Figure 3B) was performed using DmSAS-specific primers. A band of the expected size of 1147 bp, characteristic of spliced RNA, is observed at all stages examined, showing that DmSAS is ubiquitously expressed throughout the fruit fly life cycle. RT-PCR performed without input RNA gave no band (Figure 3A, lane 6).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. Developmental expression of DmSAS. (A) RT-PCR of total RNA from staged Drosophila and S2 cells. M, marker; 1, 0–4-h embryos; 2, 0–16-h embryos; 3, 14–17-h embryos; 4, adult male; 5, Schneider tissue culture cells (S2); 6, no RNA control. (B) PCR of normalized cDNA from staged Drosophila using row B (100x) of a Drosophila panel with primers specific for DmSAS or using row C (10x) with primers specific for RP49. M, marker; 1, 0–4-h embryos; 2, 4–8-h embryos; 3, 8–12-h embryos; 4, 12–24-h embryos; 5, first-instar larvae; 6, second-nstar larve; 7, third-instar larvae; 8, pupae; 9, male head; 10, female head; 11, male body; and 12, female body. The upper panel shows the 1147-bp DmSAS product, and the lower panel shows the 433-bp RP49 product. RP49 is a ribosomal protein used to show normalization of cDNA. DmSAS shows comparable levels of expression at all stages of fly development as well as in S2 cells.

 
DmSAS expressed in bacterial cells generates Neu5Ac in vitro
Assays for sialic acid synthase activity were performed using partially purified DmSAS protein from isopropyl-1-thio-ß-D-galactopyranoside (IPTG)-induced E. coli using N-acetylmannosamine (ManNAc) and ManNAc-6-P as sugar substrates. Because E. coli K1 produces an extracellular polysialic acid (Vimr, 1992Go), a K-12 bacterial strain, TOP-10, which lacks the K antigen capsule genes and therefore neuB, encoding sialic acid synthase, was used to test for DmSAS activity. There is no detectable sialic acid synthase activity in TOP-10 bacteria (Vann, unpublished data). Sialic acid production from DmSAS was observed in the presence of both sugars. However, yields were much higher (7.03 nmol Neu5Ac/h/mg) in the presence of ManNAc-6-P than those obtained using ManNAc (0.45 nmol Neu5Ac/h/mg) as measured by the thiobarbituric acid (TBA) assay (Vann et al., 1997Go). This result suggests that in Drosophila, sialic acid production occurs primarily through a phosphorylated intermediate, as in mammals (Lawrence et al., 2000Go; Nakata et al., 2000Go).

To prove that the sialic acid synthase activity observed in the presence of ManAc-6-P was due to the cloned gene, DmSAS carrying a His tag was purified from TOP10:pTrcHis2DmSAS cells using Ni-NTA resin affinity chromatography. The production of TBA-reactive sialic acids using the affinity purified DmSAS was measured at various time intervals for 1 h using ManNAc-6-P as the substrate (Table I). Sialic acid production increased linearly (R2 = 0.996) throughout the 1-h analysis time with an overall specific activity of 420 nmol Neu5Ac synthesis per h per mg protein. The fact that the specific activity significantly increased after affinity purification confirmed that the observed sialic acid synthase activity was due to DmSAS.


View this table:
[in this window]
[in a new window]
 
Table I. Sialic acid synthase activity of DmSAS partially purified by immobilized metal affinity chromatography
 
DmSAS expressed from baculovirus generates Neu5Ac and KDN in insect cells
The open reading frame (ORF) of DmSAS was amplified by RT-PCR of total RNA from 0–16 h Drosophila embryos and inserted into a baculovirus transfer vector under the control of the polh promoter. Lysates from the Spodoptera frugiperda line (Sf-9) cells infected by either the baculovirus containing the Drosophila sialic acid phosphate synthase (AcDmSAS) or a negative control virus (A35) (Lawrence et al., 2000Go) were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). A band of the expected molecular weight, 41 kDa, was observed in the AcDmSAS-infected lysates but was not detected in the negative control lysates (Figure 4). N-terminal sequencing of the first six amino acids of the band confirmed the identity of the protein as DmSAS.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4. Baculovirus expression. Lysates from cells infected with AcDmSAS or A35 (control infection) as indicated were analyzed by SDS–PAGE followed by Coomassie blue staining. The arrow indicates a band of the predicted size for DmSAS of 41 kDa in cells infected with AcDmSAS.

 
AcDmSAS was used to infect Sf-9 cells that had their serum-free growth medium supplemented with several different sugars: mannose (Man), mannosamine (ManN), and ManNAc. Lysates were then analyzed for intracellular sialic acid content using 1,2-diamino-4,5-methylene dioxybenzene dihydrochloride (DMB) fluorescent labeling and reverse phase high-performance liquid chromatography (HPLC). Infection of Sf-9 cells by AcDmSAS with ManNAc supplementation resulted in the production of large quantities of Neu5Ac (Table II; Figure 5). However, infection by AcDmSAS in the absence of ManNAc supplementation resulted in the production of another sialic acid, KDN, a deaminated Neu5Ac. The identity of KDN was confirmed by the fact that it co-chromatographed with a DMB-derivatized KDN standard (Figure 5). ManNAc medium supplementation appears to lower KDN production in favor of Neu5Ac production (Table II, Figure 5). Insignificant or very low levels of either sialic acid were observed in the absence of viral infection or in the presence of infection with the negative control virus (A35). These results are similar to those obtained for the human sialic acid phosphate synthase (Lawrence et al., 2000Go). Namely, production of significant levels of Neu5Ac in Sf-9 cells requires expression of the Drosophila or human gene and supplementation with ManNAc, whereas the infected cells produce primarily KDN when either the Drosophila or human gene is expressed in the absence of ManNAc supplementation.


View this table:
[in this window]
[in a new window]
 
Table II. Sialic acid content of Sf-9 cell lines with media supplementation
 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. In vivo sialic acid content. Sialic acid content of lysed cells from uninfected Sf-9 cells or Sf-9 cells infected by A35 or AcDmSAS(SAS) as measured by DMB derivatization with reverse-phase HPLC separation. The original chromatogram values have been divided by protein concentration to normalize chromatograms. The Neu5Ac standard represents 10 pmol, and the KDN standard represents 4 pmol. (A) Sf-9 cells grown in unsupplemented medium. (B) Sf-9 cells grown in medium supplemented with 10 mM ManNAc.

 
DmSAS activity produces phosphorylated sialic acid intermediates in vitro
The mammalian pathway for Neu5Ac synthesis uses a phosphate intermediate (Jourdian et al., 1964Go; Kundig et al., 1966Go; Watson et al., 1966Go; Lawrence et al., 2000Go), whereas the E. coli pathway directly converts ManNAc and phosphoenolpyruvate (PEP) to Neu5Ac (Vann et al., 1997Go). Lysates of Sf-9 cells infected with AcDmSAS or the control A35 virus were used to perform in vitro activity assays to determine which substrates are used by the Drosophila enzyme. When ManNAc-6-phosphate (Figure 6A) and Man-6-phosphate (Figure 6B) were used as substrates, significant Neu5Ac and KDN peaks, respectively, were obtained following treatment with alkaline phosphatase. No significant production of either sialic acid was observed when either ManNAc (Figure 6A) or Man (Figure 6B) was used as substrates.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6. In vitro sugar specificity assays. Lysates of Sf-9 cells infected with the AcDmSAS baculovirus (SAS) or with a control virus (A35) were incubated with the indicated sugars and assayed for in vitro sialic acid synthetic activity as described under Materials and methods. Samples were analyzed for sialic acid content by HPLC after treatment by alkaline phosphatase and derivitization with DMB. A residual KDN peak is seen in all AcDmSAS infected lysates. (A) Lysates incubated with ManNAc or ManNAc-6-phosphate (ManNAc-6-P) as indicated. (B) Lysates incubated with Man or Man-6-phosphate (Man-6-P) as indicated.

 
The product of the ManNAc-6-P reaction without alkaline phosphatase treatment (Figure 7) eluted very early using DMB-HPLC detection, suggesting a sialic acid phosphate product (Angata et al., 1999Go). When this product is subsequently treated with alkaline phosphatase, nonphosphorylated Neu5Ac is recovered. A KDN peak is similarly observed after alkaline phosphatase treatment (Figure 6B). However, the KDN-phosphate peak is not of sufficient magnitude to be discerned from the rapidly eluting background peaks (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7. Phosphate intermediate determination. Lysates of Sf-9 cells infected with the AcDmSAS baculovirus were incubated with ManNAc-6-phosphate, assayed in vitro for sialic acid synthetic activity, and analyzed with and without alkaline phosphatase treatment. DmSAS uses ManNAc-6-phosphate to generate phosphorylated Neu5Ac.

 
These results are in agreement with those obtained using DmSAS produced in the bacterial expression system, showing in vitro activity is signficantly enhanced in the presence of a phosphorylated sugar. It also suggests that the Sf-9 cells have the requisite activity for converting ManNAc to ManNAc-6-P, so that in vivo activity only requires ManNAc feeding.

Drosophila genome encodes other key enzymes in the sialic acid pathway
In mammals, sialic acid is typically transferred to a galactosyl, N-acetylgalactosaminyl, or sialyl residue depending on the glycoconjugate acceptor. The early steps in the N-linked glycosylation pathway are similar in mammals and insects (Williams et al., 1991Go; Seppo and Tiemeyer, 2000Go; Marchal et al., 2001Go). However, in insects the terminal N-acetylglucosamine (GlcNAc) residue of the core structure is typically removed by a Golgi-associated N-acetylglucosaminidase, which produces a paucimannose type N-glycan that lacks galactose (Altmann et al., 1995Go, 1999; Wagner et al., 1996Go; Marchal et al., 2001Go). In mammals, the substrate for the sialic acid phosphate synthase is ManNAc-6-P, which is produced by a bifunctional enzyme, UDP-GlcNAc 2-epimerase/ManNAc kinase, that converts UDP-N-acetylglucosamine to ManNAc-6-P (Stasche et al., 1997Go). For sialylation to occur, Neu5Ac is converted to the activated nucleotide sugar, cytidine monophosphate Neu5Ac (CMP-Neu5Ac) by a nuclear enzyme, CMP-Neu5Ac synthase (Kean, 1991Go; Munster et al., 1998Go). Translocation of the donor CMP-Neu5Ac to the trans-Golgi requires a CMP-Neu5Ac/CMP antiporter (Eckhardt et al., 1996Go; Hirschberg et al., 1998Go), and finally sialyltransferases located in the trans-Golgi transfer the CMP-Neu5Ac to glycoconjugates.

For Drosophila to sialylate glycoconjugates it should possess orthologues of the above-mentioned enzymes in the sialic acid pathway. A recent report (Angata and Varki, 2000Go) based on homology searches of the Drosophila genome was unable to find evidence that flies possess complete genes encoding enzymes involved in sialic acid metabolism, although several fragments of genes were identified. We carried out similar homology searches of the Drosophila database using the amino acid sequences of the bacterial and mammalian enzymes as query sequences and identified the following putative fruit fly orthologues: galactosyl transferase, AF132158 (CG8536); CMP-Neu5Ac synthase, AE003515; CMP-Neu5Ac/CMP, UDP-Gal/UMP, or UDP-GlcNAc/UMP antiporter, AL023874, AF397530 (CG2675), and AC020227 (CG14040); and sialyltransferase, AE003695, AF397532 (CG5232). In each case, the homology was deemed significant if it extended over a substantial portion of the entire coding region. The annotators of the Berkeley Drosophila Genome Project similarly identified these sequences as encoding orthologues of the mammalian enzymes (Gadfly Acc indicated in parentheses), except for the CMP-Neu5Ac synthase. However, we have found that the annotation program often does not accurately predict the protein coding region as determined by sequencing of cDNA clones. Therefore, for enzymes that had available corresponding cDNA clones in the EST database, we submitted their DNA sequences to GenBank (the accession numbers for cDNAs follow those of the genomic clones). The only sequence we could find no corresponding orthologue for was the UDP-GlcNAc 2-epimerase/ManNAc kinase. Similar to the previous report (Angata and Varki, 2000Go), we obtained a hit to AE003811, but the homology was restricted only to the kinase domain, which is shared by other kinases, including hexokinase. Therefore, we do not believe this homology to be meaningful. One possible reason for the difference between our results and that of Angata and Varki (2000)Go may be that we typically used only short conserved domains of the query sequences rather than the entire coding region. Although it remains to be shown that the orthologues we identified are functional, we think the results suggest that the sialic acid phosphate synthase gene identified in this study is part of a complete pathway that may result in the sialylation of glycoconjugates in Drosophila.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
We identified the genomic sequence of a D. melanogaster sialic acid phosphate synthase gene, DmSAS, using homology searches of the recently released Drosophila genome (Adams et al., 2000Go). A corresponding cDNA was obtained by RT-PCR of 0–16-h embryonic RNA and subsequently shown to encode a functional enzyme by expression using both bacterial and baculoviral systems. This is the first report of the cloning of a gene encoding an enzyme involved in sialic acid metabolism from an organism in the protostome lineage. Our genomic and enzyme study expands on the previous analytical efforts of others (Roth et al., 1992Go; D'Amico and Jacob, 1995Go; Malykh et al., 1999Go) who detected sialic acids in insects using lectin and monoclonal antibody staining of tissue sections and biochemically using GLC-MS. Roth et al. (1992)Go observed {alpha} 2,8-linked PSA at 14–18 h of Drosophila embryonic development, so it seems unlikely that PSA could have been introduced into an egg (which is enclosed by a vitelline membrane and chorion) at that developmental time but not have been present in the egg at earlier developmental times. Similarly, the report by Malykh et al. (1999)Go showed that circada feed on plants that do not contain sialic acid, and microscopically they saw no evidence of viral or bacterial contamination. Unfortunately, analytical methods are incapable of completely eliminating the possibility, however, remote, that the sialic acid was taken in from the environment either by pathogens or dietary sources. Such a limitation is especially problematic given the extremely low levels of sialic acid detected in these reports. As a result, we provide the first direct evidence that Drosophila possess genes encoding biosynthetic enzymes in the sialic acid pathway, providing further evidence that insects can generate sialic acids endogenously.

Expression of DmSAS was observed at all developmental stages and in S2 cells when examined by PCR amplification of staged total RNA or cDNA (Figure 3A, B). Expression of the human SAS has also been shown to be ubiquitous in all tissues (Lawrence et al., 2000Go). The DmSAS expression pattern is consistent with the reported presence of sialic acid from blastoderm to third-instar larvae stage detected by lectin-gold histochemistry (Roth et al., 1992Go). The same report, however, showed that detection of {alpha} 2,8-linked PSA by western blot was restricted to 14–18-h embryos. Because DmSAS mRNA is present at all stages in Drosophila, the regulated expression of PSA is most likely determined by another enzyme in the pathway, such as the sialyltransferase. Control of sialylation in vertebrates is controlled by the expression of the sialyltransferase rather than the sialic acid synthase (Paulson and Colley, 1989Go; van den Eijnden and Joziasse, 1993Go). Our preliminary evidence indicates that the Drosophila sialyltransferase, which we named DmST, is also developmentally regulated (Park and Palter, unpublished data). In vertebrates the major target for PSA addition is the NCAM, a regulator of cell–cell and cell–substratum interactions that affects neurite growth, cell migration, and synaptic plasticity (reviewed in Rutishauser, 1998Go; Rutishauser and Landmesser, 1996Go). In mice, NCAM does not carry PSA during early fetal development, but the PSA-NCAM isoforms predominate at later stages, reaching a maximum in the perinatal phase. After birth, the amount of PSA declines and later appears only in restricted populations of the adult brain that are still undergoing neurogenesis, cell migration, axonal outgrowth, and synaptic plasticity (Rutishauser and Landmesser, 1996Go; Eckhardt et al., 2000Go). Two related enzymes are responsible for sialic acid polymerization in vertebrates, STX (now ST8SiaII), (Livingston and Paulson, 1993Go) and PST (now ST8SiaIV) (Eckhardt et al., 1995Go; Nakayama et al., 1995Go; Muhlenhoff et al., 1996Go; Nakayama and Fukuda, 1996Go). ST8SiaII is the predominant form in the embryo, whereas ST8SiaIV is present at high levels in the postnatal brain (Hildebrandt et al., 1998Go; Ong et al., 1998Go). Drosophila has an NCAM orthologue, fasciculin II, which plays a similar role in development of the fly nervous system (Mendoza and Faye, 1999Go) but it has not been reported to be modified by PSA. In vertebrates, constitutive expression of 2,3 and 2,6 sialyltransferases are responsible for synthesis of the complex oligosaccharide structures at the termini of glycoproteins, and distinct 2,3, 2,6, and 2,8 sialyltransferases modify glycolipids (Nagai and Iwamori, 1995Go; Schauer et al., 1995Go). It remains to be determined whether the role of sialic acid in Drosophila is a PSA addition to specific receptors or other types of modifications of glycoproteins or glycolipids.

When DmSAS was expressed using either a bacterial or a baculoviral expression system in the presence of various sugar substrates, we found that highest levels of Neu5Ac synthesis were obtained when ManNAc-6-P was the substrate. In addition, we showed that DmSAS could also use Man-6-P to produce the deaminated sialic acid KDN. These results are similar to those obtained for both the human and mouse SAS, except that the mouse enzyme was not reported to produce KDN (Lawrence et al., 2000Go; Nakata et al., 2000Go). This is in contrast to the E. coli sialic acid synthase (the product of neuB), which uses ManNAc and PEP directly to produce Neu5Ac but cannot use ManNAc-6-P or Man as substrates (Vann et al., 1997Go).

We additionally confirm that the primary product of DmSAS activity is a phosphorylated intermediate, and therefore Neu5Ac is produced from ManNAc-6-P and PEP through a three-step pathway, as it is in mammals (Lawrence et al., 2000Go; Nakata et al., 2000Go). The first and last steps involve the production of ManNAc-6-P by a specific kinase and ATP and the removal of the phosphate from Neu5Ac-9-phosphate by a specific phosphatase, respectively. Therefore, DmSAS should be considered a sialic acid phosphate synthase enzyme, with greater functional similarity to the human enzyme than the form observed in E. coli. We noted that in the bacterial expression system a minor sialic acid synthetic ability was observed when ManNAc and PEP were used as substrates. ManNAc may be a low-level substrate for the DmSAS enzyme, or the presence of high concentrations of PEP may result in ATP production by a reversible pyruvate kinase followed by ManNAc phosphorylation in the partially purified protein fraction.

The Drosophila sialic acid synthase shares 48.7% identity with the human synthase but only 35.3% identity with the bacterial synthase, consistent with the bacterial enzyme being the ancestor to both insects and mammals. PSA in bacteria is generally found in the capsular polysaccharide of pathogenic organisms, especially those that are neuroinvasive (Troy, 1995Go). PSA is therefore not present in all bacterial strains and is not essential for viability. It has been proposed that bacteria acquired this pathway by horizontal transfer from host organisms to expand the bacteria’s host range (Roggentin et al., 1993Go). Using homology searches, we did not detect genes involved in sialic acid metabolism in the completed yeast (Saccharomyces cerevisiae) or nematode (Caenorhabditis elegans) databases. Does the absence of the sialic acid biosynthetic pathway in certain bacteria and organisms believed to be ancestral to insects necessarily mean that the pathway could not have originated in bacteria? We can imagine a scenerio in which PSA was first used as a component of bacterial capsules, where it was nonessential, and later evolved uses in general cell–cell signaling or recognition when it became integral to the viability of organisms. Therefore, certain evolutionary branches could have lost the sialic acid pathway before it assumed uses that were essential for viability.

Our finding that the Drosophila genome encodes a functional sialic acid phosphate synthase enzyme suggested that other genes encoding sialic acid biosynthetic enzymes would also be present. We think it improbable that in the absence of selective pressure Drosophila would have maintained a functional synthase gene. Typically, if enzyme pathways are no longer utilized by an organism, the affected genes rapidly accumulate mutations in their coding regions or are deleted (Lynch and Conery, 2000Go). The results of our homology searches of the Drosophila genome revealed putative orthologues of galactosyl transferase, CMP-Neu5Ac synthase, CMP-Neu5Ac/CMP, UDP-Gal/UMP, or UDP-GlcNAc/UMP antiporter and sialyltransferase. The nucleotide-sugar antiporters comprise a family of related proteins. Without direct genetic evidence or reconstitution experiments using proteoliposomes, it is difficult to establish the nucleotide-sugar specificity of each member (Abeijon et al., 1997Go; Hirschberg et al., 1998Go). We note that both genomic sequences related to the CMP-Neu5Ac transporter (AL023874 and AC020227) share homology with the mammalian UDP-galactose and UDP-N-acetylglucosamine transporters as well, with the first accession number corresponding to the sequence most similar to the mouse CMP-Neu5Ac transporter. In mammals, the individual sugars each have designated transporters, however, we do not know if this is the case in Drosophila. Interestingly, investigators doing a structural analysis of transporters created a chimeric UDP-galactose and CMP-Neu5Ac transporter that had dual sugar specificity (Aoki et al., 2001Go). The Drosophila genomic sequence related to CMP-Neu5Ac synthase (AE003515) shares homology with the mammalian enzyme only in the N-terminal half, as has been previously reported (Angata and Varki, 2000Go). However, when we compared the sequence of the E. coli CMP-Neu5Ac synthase with the sequences of the mammalian enzyme or with enzymes from other bacterial species, such as Neissera meningitidis, Campylobacter jejuni, Legionella pneumophila, and Haemophilus dycreyi, we noted that only the N-terminal half was conserved, similar to the results with Drosophila. We could find no corresponding orthologue for the UDP-GlcNAc2-epimerase/ManNAc kinase, although low-level endogenous epimerase activity has been reported in an Sf-9 cell line (Effertz et al., 1999Go). A negative result of a homology search can be a consequence of the genomic sequence having numerous introns, creating gaps that depress the significance of the alignments found using the BLAST algorithms. The fly sialyltransferase, DmST (AE003695), shares highest amino acid identity with the 2,6 sialyltransferases of N-glycans. However, there were numerous residues conserved between DmST and {alpha} 2,8 sialyltransferases that were not present in the 2,6 sialyltransferases. A determination of the glycoconjugate specificity of DmST must therefore await further enzymatic studies currently in progress in our laboratories.

The expression of sialic acid–containing glycoconjugates in Drosophila may be regulated by the tissue-type and/or developmental stage (Marchal et al., 2001Go). Staining of Drosophila embryos using sialic acid–binding lectins showed staining of germ cell precursors, general ectodermal staining, and intense staining of the nervous system at a time when the nervous system was forming (Roth et al., 1992Go). The failure of many groups to obtain biochemical or enzymatic evidence of sialic acid metabolism in insects may be due to a temporally restricted pattern of glycoconjugate expression in a low percentage of cells. However, using the sophisticated molecular genetic approaches available in Drosophila one can now readily create loss-of-function mutations in specific genes in the sialic acid pathway using P-element insertion (Spradling and Rubin, 1982Go) or RNA interference (Kennerdell and Carthew, 1998Go) coupled with targeted gene expression (Brand and Perrimon, 1993Go). These techniques should allow an assessment of loss of function in specific tissues and times in development and enable us to elucidate the biological role of sialic acid glycoconjugates in Drosophila development.


    Material and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
Gene identification, isolation of a cDNA clone, and DNA sequencing
A BLAST search was performed using the tBLASTn algorithm at both FLYBASE (Flybase, 1999Go) and NCBI with the amino acid sequence of either the bacterial sialic acid synthase (GenBank Acc UO5248; Annunziato et al., 1995Go) or the human sialic acid phosphate synthase (AF257466; Lawrence et al., 2000Go) as the query sequence. Two genomic clones (AC007594 and AC017132) representing the same genomic sequence on chromosome 3R in band 87B15 had significant homology to the query sequences. Because no ESTs with significant homology were found, a cDNA clone for DmSAS was obtained by RT-PCR using primers designed from the genomic sequence. The start codon selected gave maximal alignment with the human sialic acid phosphate synthase sequence. The forward primer (SA4), 5'-CACTGGATCCGCCATCATGCTGTTAAACGATATCATAAGC, contained a BamHI site (italics), a KOZAK sequence (bold), and sequence corresponding to the first eight codons of DmSAS. The reverse strand primer (SA5), 5'AGTGGAATTCTCATCAATTGATTATACTATTCCCAAG, contained an EcoRI site (italics), two in-frame stop codons (bold), and sequences representing the last seven codons of DmSAS. Total RNA prepared by the TRIzol method (Life Technologies, Rockville, MD) from D. melanogaster (Oregon R, P2) 0–16 h dechorionated embryos treated with amplification grade DNaseI (Life Technologies) was used as the template. RT-PCR was performed as described (Kawasaki, 1990Go) using 6 µg RNA and M-MuLV reverse transcriptase (New England Biolabs, Beverly, MA) in 20 µl, which was subsequently introduced into a 100-µl PCR reaction using the following cycle settings: 94°C 5 min; 31 cycles at 94°C 1 min, 50°C 1.5 min, 72°C 2 min; 72°C 10 min; hold at 4°C. PCR reagents were purchased from Applied Biosystems (Foster City, CA) and PCR was performed using an Applied Biosystems GeneAmp 2400 thermal cycler. The 1147-bp product was subcloned into the baculovirus vector pBlueBac4.5 (Invitrogen, Carlsbad, CA). The DNA sequence of this construct, pBlueBac-DmSAS, was determined on both strands using BigDye terminators (Perkin-Elmer, CA) by the Nucleic Acid/Protein Core Research Facility of the Children’s Hospital of Philadelphia. The DNA sequence of the cDNA matched the genomic sequence except it lacked a 106-bp intron.

Amplification of staged Drosophila RNA and cDNA
Total RNA was isolated from staged Drosophila or S2 cells as described. RT-PCR was performed using the conditions described above, except that 0.6 µg of RNA was DNase I–treated and directly added to the RT reaction without prior ethanol precipitation. PCR of the Drosophila Rapid-Scan panels (Origene, Gaithersburg, MD) was performed in 25-µl reactions using the same PCR conditions already described except that 35 cycles were used. PCR in 48-well microtiter plates (panels) was performed using an Applied Biosystems GeneAmp 9600 thermal cycler.

Cloning, expression, and activity of DmSAS in bacteria
The DmSAS coding region was amplified by PCR using pBlueBac-DmSAS as the template with the following primers: The forward primer (JP1), 5'-CACTGAATTCATGCTGTTAAACGATATCATAAGC, had an EcoRI site (italics) upstream of the initiator ATG, and the reverse strand primer (JP2), 5'-AGTGAAGCTTTCAATTGATTATACT, contained a HindIII restriction site (italics). PCR reactions were performed as described except that reactions included 2.5 mM MgCl2 and only 25 cycles were used. All final constructs were sequenced to verify that no base changes had been introduced during PCR.

After appropriate enzyme digestion, the PCR product was ligated into the E. coli expression vector pTrc99a (Amersham Pharmacia, Piscataway, NJ) and the construct was introduced into E. coli TOP-10 cells. An overnight culture of TOP10:pTrc99A-DmSAS was used to inoculate 1.5 L Luria-Bertani broth, which was grown until A600 = 0.6. Expression was induced with 0.5 mM IPTG for 2 h at 37°C, after which the culture was harvested by centrifugation at 5500 x g for 10 min, resuspended in 20 ml 0.05 M Bicine, 1 mM dithiothreitol (DTT), pH 8.0, and lysed in a French pressure cell. The lysate was centrifuged at 27,000 x g for 15 min and the supernatant was brought to 60% (by weight) ammonium sulfate and centrifuged at 27,000 x g for 15 min to pellet the enzyme. The precipitate was dissolved in 0.05 M Bicine, 1 mM DTT, pH 8.0, and assayed for sialic acid synthase activity using the TBA assay (Vann et al., 1997Go). The substrates ManNAc-6-P, ManNAc, and PEP were used at a final concentration of 12.5 mM.

The DmSAS gene was also inserted into the E. coli His-tag expression vector pTrcHis2TOPO (Invitrogen) to facilitate enzyme purification. The gene was amplified by PCR with the forward primer 5'-CTGTTAAACGATATCATAAGCGGAA, the reverse strand primer 5'-ATTGATTATACTATTCCCAAGTATGGG, and the template pTrc99a-DmSAS using the following settings: 94°C 45 s; 30 cycles at 92°C 45 s, 42°C 1 min, 72°C 2 min; 72°C 10 min; hold at 4°C. The PCR product was ligated directly into pTrcHis2TOPO and the resulting plasmid was introduced into TOP-10 cells. A 1.5 L Luria-Bertani culture of TOP10:pTrcHis2TOPO-DmSAS was grown and induced with IPTG, and the cell lysate was prepared as described. The clarified cell lysate was applied to a 6 mL column packed with Ni-NTA resin (Qiagen, Valencia, CA), washed with 0.05 M Bicine, 1 mM DTT, pH 8.0, buffer and eluted with 250 mM imidazole in wash buffer. The eluent was assayed for sialic acid production over time by measuring the sialic acid content with the TBA assay (Vann et al., 1997Go).

Cloning, expression, and activity of DmSAS in insect cells
Using the Invitrogen Bac-N-BlueTM kit instructions, pBlueBac4.5-DmSAS plasmid DNA was transfected into Sf-9 cells (ATCC, Manassas, VA) and the resulting virus (AcDmSAS) was amplified. Baculovirus DNA was isolated using the Invitrogen procedure and probed for inclusion of the synthase gene by PCR with primers SA4 and SA5. Infected cell lysates were analyzed by SDS–PAGE followed by Coomassie blue staining. For N-terminal sequencing, the Pierce NE-PERTM kit was used to isolate cytoplasmic extracts that were separated by SDS–PAGE. Bands were transferred to a polyvinylidene difluoride membrane, stained with Ponceau S, and sequenced from the N-terminus with an Applied Biosystems Procise sequencer. Cells were prepared, infected, and harvested at 72 h postinfection as previously described (Lawrence et al., 2000Go). Sugar feeding supplementation was done with sterile-filtered 10 mM Man, mannosamine, and ManNAc from 1 M stocks. All cells were grown in serum-free HyClone (Logan, UT) SFX medium. The Neu5Ac and KDN content of Sf-9 cell lysates was detected using DMB labeling and normalized on a protein basis using a previously published procedure (Lawrence et al., 2000Go). For in vitro assays, cells were prepared, infected, harvested, and assayed using previously described procedures (Lawrence et al., 2000Go). ManNAc-6-phosphate was synthesized using previously published methods (Liu and Lee, 2001Go).


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
We gratefully thank Dr. Carl Wu for the staged D. melanogaster embryos and Dr. Mei-Zheng Liu for providing ManNAc-6-P. We also thank Dr. Harry Rappaport for critical review of the manuscript and Dr. Joel Sheffield and Dr. Jose Ramirez-Latorre for computer advice. Support for this research was provided by grants from the National Science Foundation Grant BES9814100 from the Metabolic Engineering Program (to M.J.B.), the National Science Foundation Grant DGE9843635 from the Graduate Research Fellowship Program (to S.M.L.), and from the Howard Hughes Medical Institute through the Undergraduate Biological Science Education Program (to J.P.).


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
DMB, 1,2-diamino-4,5-methylene dioxybenzene dihydrochloride; DTT, dithiothreitol; EST, expressed sequence tag; GLC-MS, gas-liquid chromatography–mass spectrometry; HPLC, high-performance liquid chromatography; IPTG, isopropyl-1-thio-ß-D-galactopyranoside; KDN, 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid; LFA, Limax flavus; LPA, Limulus polyphemus; NCAM, neural cell adhesion molecule; Neu5Ac, N-acetylneuraminic acid; ORF, open reading frame; PCR, polymerease chain reaction; PEP, phosphoenol pyruvate; PSA, poly {alpha} 2,8 sialic acid; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; Sf-9, Spodoptera frugiperda cell line; TBA, thiobarbituric acid; RT, reverse transcriptase.


    Footnotes
 
1 These two authors contributed equally to the work. Back

2 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Material and methods
 Acknowledgments
 Abbreviations
 References
 
Abeijon, C., Mandon, E.C., and Hirschberg, C.B. (1997) Transporters of nucleotide sugars, nucleotide sulfate and ATP in the Golgi apparatus. Trends Biochem. Sci., 22, 203–207.

Acheson, A., Sunshine, J.L., and Rutishauser, U. (1991) NCAM polysialic acid can regulate both cell-cell and cell-substrate interactions. J. Cell Biol., 114, 143–153.

Adams, M.D., Celniker, S.E., Holt, R.A., Evans, C.A., Gocayne, J.D., Amanatides, P.G., Scherer, S.E., Li, P.W., Hoskins, R.A., Galle, R.F., and others. (2000) The genome sequence of Drosophila melanogaster. Science, 287, 2185–2195.

Altmann, F., Schwihla, H., Staudacher, E., Glossl, J., and Marz, L. (1995) Insect cells contain an unusual membrane-bound beta-N-acetylglucosaminidase probably involved in the processing of protein N-glycans. J. Biol. Chem., 270, 17344–17349.

Altmann, F., Staudacher, E., Wilson, B.H., and Marz, L. (1999) Insect cells as hosts for the expression of recombinant glycoproteins. Glycoconj. J., 16, 109–123.

Angata, T. and Varki, A. (2000) Cloning, characterization, and phylogenetic analysis of Siglec-9, a new member of the CD33-related group of Siglecs. J. Biol. Chem., 275, 22127–22135.

Angata, T., Nakata, D., Masuda, T., Kitajima, K., and Troy, F.A. (1999) Biosynthesis of KDN (2-keto-3-deoxy-D-glycero-D-galacto-nononic acid) Identification and characterization of a KDN-9-phosphate synthetase activity from trout testis. J. Biol. Chem., 274, 22949–22956.

Annunziato, P.W., Wright, L.F., Vann, W.F., and Silver, R.P. (1995) Nucleotide sequence and genetic analysis of the neuD and neuB genes in region 2 of the polysialic acid gene cluster. J. Bacteriol., 177, 312–319.

Aoki, K., Ishida, N., and Kawakita, M. (2001) Substrate recognition by UDP-galactose and CMP-sialic acid transporters. J. Biol. Chem., 276, 21555–21561.

Brand, A.H. and Perrimon, N. (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development, 18, 401–415.

Corfield, A.P. and Schauer, R. (1982) Occurrence of sialic acids. In R. Schauer, ed., Sialic acids. Springer-Verlag, New York, 5–55.

Cunningham, B.A., Hoffman, S., Rutishauser, U., Hemperly, J.J., and Edelman, G.M. (1983) Molecular topography of the neural cell adhesion molecule N-CAM: surface orientation and location of sialic acid-rich and binding regions. Proc. Natl Acad. Sci. USA, 80, 3116–3120.

D’Amico, P. and Jacob, J.R. (1995) Lectin histochemistry of the Drosophila embryo. Tissue Cell, 27, 23–30.

Eckhardt, M., Bukalo, O., Chazal, G., Wang, L., Goridis, C., Schachner, M., Gerardy-Schahn, R., Cremer, H., and Dityatev, A. (2000) Mice deficient in the polysialytransferase ST8SiaIV/PST-1 allow discrimination of the roles of neural cell adhesion molecule protein and polysialic acid in neural development and synaptic plasticity. J. Neurosci., 20, 5234–5244.

Eckhardt, M., Muehlenhoff, M., Bethe, A., and Gerardy-Schahn, R. (1996) Expression cloning of the Golgi CMP-sialic acid transporter. Proc. Natl Acad. Sci. USA, 93, 7572–7576.

Eckhardt, M., Muhlenhoff, M., Bethe, A., Koopman, J., Frosch, M., and Gerardy-Schahn, R. (1995) Molecular characterization of eukaryotic polysialyltransferase-1. Nature, 373, 715–718.

Effertz, K., Hinderlich, S., and Reutter, W. (1999) Selective loss of either the epimerase or kinase activity of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase due to site directed mutagenesis based on sequence alignments. J. Biol. Chem., 274, 28771–28778.

Flybase.(1999) The Flybase database of the Drosophila genome projects and community literature. Nucleic Acids Res., 27, 85–88. Available online at http://flybase.bio.indiana.edu.

Fukuda, M. (1996) Possible roles of tumor-associated carbohydrate antigens. Cancer Res., 56, 2237–2244.

Hildebrandt, H., Becker, C., Murau, M., Gerardy-Schahn, R., and Rahmann, H. (1998) Heterogeneous expression of the polysialyltransferases ST8SiaII and ST8SiaIV during postnatal rat brain development. J. Neurochem., 71, 2339–2348.

Hirschberg, C.B., Robbins, P.W., and Abeijon, C. (1998) Transporters of nucleotide sugars, ATP, and nucleotide sulfate in the endoplasmic reticulum and Golgi apparatus. Annu. Rev. Biochem., 67, 49–69.

Hoffman, S. and Edelman, G.M. (1983) Kinetics of homophilic binding by embryonic and adult forms of the neural cell adhesion molecule. Proc. Natl Acad. Sci. USA, 80, 5762–5766.

Hooker, A.D., Green, N.H., Baines, A.J., Bull, A.T., Jenkins, N., Strange, P.G., and James, D.C. (1999) Constraints on the transport and glycosylation of recombinant IFN-gamma in Chinese hamster ovary and insect cells. Biotechnol. Bioeng., 63, 559–572.

Jourdian, G.W., Swanson, A.L., Watson, D.R., and Roseman, S. (1964) Isolation of sialic acid 9-phosphate from human erythrocytes. J. Biol. Chem., 239, 2714–2715.

Kawasaki, E. (1990) Amplification of RNA. In M. Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White, eds., PCR protocols. Academic Press, San Diego, 21–27.

Kean, E.L. (1991) Sialic acid activation. Glycobiology, 1, 441–447.

Kennerdell, J.R. and Carthew, R.W. (1998) Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell, 95, 1017–1026.

Kundig, W., Ghosh, S., and Roseman, S. (1966) The sialic acids. VII. N-acyl-D-mannosamine kinase from rat liver. J. Biol. Chem., 241, 5619–5626.

Lawrence, S.M., Huddleston, K.A., Pitts, L.R., Nguyen, N., Lee, Y.C., Vann, W.F., Coleman, T.A., and Betenbaugh, M.B. (2000) Cloning and expression of the human N-acetylneuraminic acid phosphate synthase gene with 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid biosynthetic ability. J. Biol. Chem., 275, 17869–17877.

Liu, M.-Z. and Lee, Y.C. (2001) Comparison of chemical and enzymatic synthesis of 2-acetomido-2-deoxy-D-mannose 6-Phosphate: a new approach. Carbohydr. Res., 330, 413–419.

Livingston, B.D. and Paulson, J.C. (1993) Polymerase chain reaction cloning of a developmentally regulated member of the sialyltransferase gene family. J. Biol. Chem., 268, 11504–11507.

Lynch, M. and Conery, J.S. (2000) The evolutionary fate and consequences of duplicate genes. Science, 290, 1151–1155.

Malykh, Y.N., Krisch, B., Gerardy-Schahn, R., Lapina, E.B., Shaw, L., and Schauer, R. (1999) The presence of N-acetylneuraminic acid in Malpighian tubules of larvae of the circada Philaenus spumarius. Glycoconj. J., 16, 731–739.

Marchal, I., Jarvis, D.L., Cacan, R., and Verbert, A. (2001) Glycoproteins from insect cells: sialylated or not? J. Biol. Chem., 382, 151–159.

Mendoza, H.L. and Faye, I. (1999) Physiological aspects of the immunoglobulin superfamily in invertebrates. Dev. Comp. Immunol., 23, 359–374.

Muhlenhoff, M., Eckhardt, M., Bethe, A., Frosch, M., and Gerardy-Schahn, R. (1996) Polysialylation of NCAM by a single enzyme. Curr. Biol., 6, 1188–1191.

Munster, A.-K., Eckhardt, M., Potvin, B., Muhlenhoff, M., Stanley, P., and Gerardy-Schahn, R. (1998) Mammalian cytidine 5'-monophosphate N-acetylneuraminic acid synthetase. A nuclear protein with evolutionarily conserved motifs. Proc. Natl Acad. Sci. USA, 95, 9140–9145.

Nagai, Y. and Iwamori, M. (1995) Cellular biology of gangliosides. In A. Rosenberg, ed., Biology of the sialic acids. Plenum Press, New York, 197–241.

Nakata, D., Close, B.E., Colley, K.J., Matsuda, T., and Kitajima, K. (2000) Molecular cloning and expression of mouse N-acetylneuraminic acid 9-phosphate synthase which does not have deaminoneuraminic (KDN) 9-phosphate synthase activity. Biochem. Biophys. Res. Commun., 273, 642–648.

Nakayama, J. and Fukuda, M. (1996) A human polysialyltransferase directs in vitro synthesis of polysialic acid. J. Biol. Chem., 271, 1829–1832.

Nakayama, J., Fukuda, M.N., Fredette, B., Ranscht, B., and Fukuda, M. (1995) Expression cloning of a human polysialyltransferase that forms the polysialylated neural cell adhesion molecule present in embryonic brain. Proc. Natl Acad. Sci. USA, 92, 7031–7035.

Ong, E., Nakayama, J., Angata, K., Reyes, L., Katsuyama, T., Arai, Y., and Fukuda, M. (1998) Developmental regulation of polysialic acid synthesis in mouse directed by two sialyltransferases, PST and STX. Glycobiology, 8, 415–424.

Park, Y.-I., Wood, H.A., and Lee, Y.C. (1999) Monosaccharide compositions of Danus plexippus (monarch butterfly) and Trichoplusia ni (cabbage looper) egg glycoproteins. Glycoconj. J., 16, 629–638.

Paulson, J.C. and Colley, K.J. (1989) Glycosyltransferases: structure, localization, and control of cell-type specific glycosylation. J. Biol. Chem., 264, 17615–17618.

Roggentin, P., Schauer, R., Hoyer, R.R., and Vimr, E.R. (1993) The sialidase superfamily and its spread by horizonal gene transfer. Mol. Microbiol., 9, 915–921.

Rosenberg, A. (1995) Neurite loss caused by ganglioside undersialylation. In A. Rosenberg, ed., Biology of the sialic acids. Plenum Press, New York. 363–372.

Roth, J., Kempf, A., Reuter, G., Schauer, R., and Gehring, W.J. (1992) Occurence of sialic acids in Drosophila melanogaster. Science, 256, 673–675.

Rutishauser, U. (1998) Polysialic acid at the cell surface: biophysics in service of cell interactions and tissue plasticity. J. Cell. Biochem., 70, 304–312.

Rutishauser, U. and Landmesser, L. (1996) Polysialic acid in the vertebrate nervous system: a promoter of plasticity in cell-cell interactions. Trends Neurosci., 19, 422–427.

Schauer, R. and Kammerling, J.P. (1997) Chemistry, biochemistry and biology of sialic acids. In J. Montreuil, J.F.G. Vliegenthart, and H. Schachter, eds., Glycoproteins II. Elsevier, Amsterdam, 243–402.

Schauer, R., Kelm, S., Reuter, G., Roggentin, P., and Shaw, L. (1995) Biochemistry and role of sialic acids. In A. Rosenberg, ed., Biology of sialic acids. Plenum Press, New York, 7–67.

Seppo, A. and Tiemeyer, M. (2000) Function and structure of Drosophila glycans. Glycobiology, 10, 751–760.

Seppo, A., Moreland, M., Schweingruber, H., and Tiemeyer, M. (2000) Zwitterionic and acidic glycosphingolipids of the Drosophila melanogaster embryo. Eur. J. Biochem., 267, 3549–3558.

Spradling, A.C. and Rubin, G.M. (1982) Transposon of cloned P elements into Drosophila germ line chromosomes. Science, 218, 341–347.

Stasche, R., Hinderlich, S., Weise, C., Effertz, K., Lucka, L., Moremann, P., and Reutter, W. (1997) A bifunctional enzyme catalyzes the first two steps of N-acetylneuraminic acid biosynthesis in rat liver. Molecular cloning and functional expression of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. J. Biol. Chem., 272, 24319–24324.

Takano, R., Muchmore, E., and Dennis, J.W. (1994) Sialylation and malignant potential in tumour cell glycosylation mutants. Glycobiology, 4, 665–674.

Tomiya, N., Ailor, E., Lawrence, S.M., Betenbaugh, M.J., and Lee, Y.C. (2001) Determination of nucleotides and sugar nucleotides involved in protein glycosylation by high-performance anion-exchange chromatography: sugar nucleotide contents in cultured insect cells and mammalian cells. Anal. Biochem., 293, 129–137.

Troy, F.A.I. (1995) Sialobiology and the polysialic acid glycotope. Occurrence, structure, function, synthesis, and glycopathology. In A. Rosenberg, ed., Biology of the sialic acids. Plenum Press, New York, 95–144.

van den Eijnden, D.H. and Joziasse, D.H. (1993) Enzymes associated with glycosylation. Curr. Opin. Struct. Biol., 3, 711–721.

Vann, W.F., Tavarez, J.J., Crowley, J., Vimr, E., and Silver, R.P. (1997) Purification and characterization of the Escherichia coli K1 neuB gene product. Glycobiology, 7, 697–701.

Varki, A. (1993) Biological roles of oligosaccharides: all of the theories are correct. Glycobiology, 3, 97–130.

Vimr, E.R. (1992) Selective synthesis and labeling of the polysialic acid capsule of Escherichia coli K1 strains with mutations in nanA and neuB. J. Bacteriol., 174, 6195–6197.

Wagner, R., Geyer, H., Geyer, R., and Kienk, H. D. (1996) N-acyl-beta-glucosamindase accounts for differences in glycosylation of influenza virus hemagglutinin expressed in insect cells from a baculovirus vector. J. Virol., 70, 4103–4109.

Warren, L. (1963) The distribution of sialic acids in nature. Comp. Biochem. Physiol., 10, 153–171.

Watson, D.R., Jourdian, G.W., and Roseman, S. (1966) The sialic acids. VIII. sialic acid 9-phosphate synthetase. J. Biol. Chem., 241, 5627–5636.

Williams, P.J., Wormald, M.R., Dwek, R.A., Rademacher, T.W., Parker, G.F., and Roberts, D.R. (1991) Characterization of oligosaccharides from Drosophila melanogaster glycoproteins. Biochim. Biophys. Acta, 1075, 146–153.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Aoki, M. Perlman, J.-M. Lim, R. Cantu, L. Wells, and M. Tiemeyer
Dynamic Developmental Elaboration of N-Linked Glycan Complexity in the Drosophila melanogaster Embryo
J. Biol. Chem., March 23, 2007; 282(12): 9127 - 9142.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Viswanathan, N. Tomiya, J. Park, S. Singh, Y. C. Lee, K. Palter, and M. J. Betenbaugh
Expression of a Functional Drosophila melanogaster CMP-sialic Acid Synthetase: DIFFERENTIAL LOCALIZATION OF THE DROSOPHILA AND HUMAN ENZYMES
J. Biol. Chem., June 9, 2006; 281(23): 15929 - 15940.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
P. Maliekal, D. Vertommen, G. Delpierre, and E. Van Schaftingen
Identification of the sequence encoding N-acetylneuraminate-9-phosphate phosphatase
Glycobiology, February 1, 2006; 16(2): 165 - 172.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Koles, K. D. Irvine, and V. M. Panin
Functional Characterization of Drosophila Sialyltransferase
J. Biol. Chem., February 6, 2004; 279(6): 4346 - 4357.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
J. J. Aumiller, J. R. Hollister, and D. L. Jarvis
A transgenic insect cell line engineered to produce CMP-sialic acid and sialylated glycoproteins
Glycobiology, June 1, 2003; 13(6): 497 - 507.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
J. Hollister, H. Conradt, and D. L. Jarvis
Evidence for a sialic acid salvaging pathway in lepidopteran insect cells
Glycobiology, June 1, 2003; 13(6): 487 - 495.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kim, K.
Right arrow Articles by Palter, K. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, K.
Right arrow Articles by Palter, K. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?