Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2002, Vol. 12, No. 11 729-739
© 2002 Oxford University Press

Reduction of {alpha}-Gal expression by relocalizing {alpha}-galactosidase to the trans-Golgi network and cell surface

Simon G. Taylor, Narin Osman, Ian F.C. McKenzie and Mauro S. Sandrin1

John Connell Laboratory of Glycobiology, Austin Research Institute, Austin and Repatriation Medical Centre, Heidelberg Victoria 3084, Australia

Received on March 3, 2002; revised on May 27, 2002; accepted on June 13, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Historically, the most effective means of modifying cell surface carbohydrates has required the intracellular overexpression of glycosyltransferases or glycosidases and is dependent on the enzymes occupying a cellular localization close to the carbohydrate structures they modify. We report on relocalizing the lysosomal resident glycosidase human {alpha}-galactosidase to other regions of the cell, Golgi and cell surface, where it is in closer proximity for cleaving the carbohydrate structure Gal{alpha}(1,3)Gal. Relocalization of {alpha}-galactosidase was achieved by using the transmembrane and cytoplasmic domains from the human protein furin, which is known to localize in the trans-Golgi network (TGN) and cell surface. Two chimeric forms of {alpha}-galactosidase were generated, one directing it to the TGN of the cell and the other to the cell surface, as shown by confocal microscopy. The relocalized enzymes have the ability to cleave terminal {alpha}-galactose as detected by expression on the cell surface. Furthermore, when expressed as a transgene in mice, the TGN form of {alpha}-galactosidase was more effective at decreasing cell surface terminal {alpha}-galactose than was the native lysosomal form. When expressed in conjunction with the {alpha}1,2fucosyltransferase that also decreases Gal{alpha}(1,3)Gal, the reduction was additive. The ability to relocalize enzymes that modify cell surface carbohydrate structures has far-reaching implications in biology and may be useful in such fields as xenotransplantation and treatment of glycosidase disorders.

Key words: {alpha}-galactosidase/cell surface/furin/targeting/trans-Golgi network


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Altering cell surface carbohydrates by the expression of glycosyltransferases and glycosidases is dependent on the localization of the enzyme with respect to the carbohydrate structure it is to modify. An effective approach would be to engineer the enzyme to target the cellular compartment where the glycosyltransferase or glycosidase activity is required. Here we have relocalized human {alpha}-galactosidase (galdase) to other sites in the cell where it can more effectively cleave terminal {alpha}-galactose ({alpha}-Gal) on proteins and lipids destined for the cell surface.

For pig-to-human xenotransplantation, the carbohydrate structure Gal{alpha}(1,3)Gal expressed on glycoproteins and glycolipids at the cell surface of pig endothelium causes the rapid antibody-mediated rejection process, hyperacute rejection (HAR). If Gal{alpha}(1,3)Gal is modified or cleaved, HAR can be significantly reduced if not eliminated (Sandrin and McKenzie, 1999Go). One enzyme of interest that can cleave Gal{alpha}(1,3)Gal is galdase. When this enzyme is overexpressed in the cell, it is capable of cleaving and hence reducing the amount of Gal{alpha}(1,3)Gal on the cell surface (Osman et al., 1997Go).

Galdase hydrolyses terminal {alpha}-Gal from glycoproteins and glycolipids. The enzyme is soluble, contains no transmembrane domain, and is localized to the lysosome of the cell. For galdase to hydrolyze Gal{alpha}(1,3)Gal, both the enzyme and the epitope must occupy the same cellular location. This location is almost certainly within the trans region of the Golgi, where newly synthesized galdase accumulates before its transport to the lysosome via a mannose-6-phosphate (M6P) signal at position N215 (Ioannou et al., 1998Go). Exceptions to this are when galdase is overexpressed and swamps the M6P receptor pathway in the cell or when the M6P signal is removed by mutating N215 to A215; in both cases this results in exportation of the enzyme from the cell by a secretory pathway (Ioannou et al., 1992Go, 1998). The trans region of the Golgi is also the site of Gal{alpha}(1,3)Gal synthesis as a terminal carbohydrate moiety on glycoproteins and glycolipids prior to their transport to the cell surface.

An effective reduction of Gal{alpha}(1,3)Gal, could be achieved by relocalizing galdase to be in closer proximity to newly synthesized Gal{alpha}(1,3)Gal, by targeting galdase to: (1) the trans-Golgi network (TGN), the region of the Golgi in which exportation of glycoproteins destined for the cell surface occurs and therefore where effective cleavage of Gal{alpha}(1,3)Gal is possible prior to cell surface expression; or (2) the cell surface, where cleavage may occur while galdase and Gal{alpha}(1,3)Gal are transported to the cell surface or at their final destination on the cell surface. All of the Golgi resident proteins identified to date are either integral Golgi membrane proteins (including glycosyltransferases, such as fucosyltransferases, galactosyltransferases, and sialyltransferases), endoproteases (e.g., furin), or cytosolic Golgi membrane–associated transport proteins (such as COP I and II complexes, AP1 complex, clathrin). Targeting galdase, to the TGN and cell surface could be achieved by (1) attaching a transmembrane domain to tether the enzyme to the Golgi membrane or plasma membrane, and (2) attaching a cytoplasmic domain containing a TGN localization signal.

The TGN targeting domain chosen was the transmembrane and cytoplasmic domains from the Type I TGN resident protein furin, which is a human subtilisin–like protein. Extensive studies on the cytoplasmic domain shows that the majority of furin is found in the TGN (Bosshart et al., 1994Go; Jones et al., 1995Go; Molloy et al., 1994Go; Schafer et al., 1995Go; Shapiro et al., 1997Go) with a small proportion cycling to and from the plasma membrane (Bosshart et al., 1994Go). The amino acid sequence of furin between P772 and R784 contains an acidic cluster and a casein kinase II consensus sequence that together retain furin in the TGN (Jones et al., 1995Go; Schafer et al., 1995Go). A tyrosine-based signal Y762KGL765 provides endosomal localization (Bosshart et al., 1994Go) allowing the retrieval of cell surface–expressed furin to the TGN. Complete removal of these signals causes furin to be expressed only at the cell surface (Schafer et al., 1995Go).

The use of carboxy-terminal sequences of furin has enabled the design of two chimeric galdase proteins: (1) galdase-furin(Tm+Cyto), containing the transmembrane region and cytoplasmic domains of furin, with the intention of localizing galdase to the TGN and allowing some cycling to the cell surface; (2) galdase-furin(Tm), containing the transmembrane domain of furin, with the intention of expressing galdase at the cell surface. We now show that using the transmembrane domain and localization signals of furin, galdase can indeed be localized to several sites within the cell. This relocalization of galdase resulted in a more effective decrease in terminal {alpha}-Gal at the cell surface. Such a strategy can be applied to xenotransplantation to decrease the effects of HAR. Moreover, relocalizing galdase may also be useful in enzyme replacement therapy for patients suffering from Fabry’s disease, which is caused by a deficiency in galdase activity.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Constructs targeting galdase to alternative intracellular locations
Two chimeric constructs were generated (Figure 1) to test if galdase could be relocalized to cellular destinations other than the lysosome and still remain enzymatically active. The first chimeric construct, galdase-furin(Tm+Cyto), was designed to relocalize galdase to the TGN and encodes a CD7 stalk (49 amino acids [aa], to space the enzyme from the lipid bilayer of the Golgi), and the entire furin transmembrane and cytoplasmic domain (86 aa) attached to the carboxy-terminus of galdase (Figure 1). The second chimeric construct, galdase-furin(Tm), was generated to relocalize galdase to the cell surface, as furin is not only retained in the TGN but also rapidly cycles between the TGN and the cell surface (Bosshart et al., 1994Go; Schafer et al., 1995Go). Removal of the Golgi-targeting signals from the carboxy-terminus of furin abolishes retrograde transport and retention in the TGN, leading to cell surface expression (Molloy et al., 1994Go; Schafer et al., 1995Go). The construct galdase-furin(Tm) encodes part of the luminal domain of furin (40 aa) and the entire furin transmembrane domain (23 aa) with the inclusion of a flanking basic amino acid of the cytoplasmic tail (R742) (Schafer et al., 1995Go) attached to the carboxy-terminus of galdase (Figure 1).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1. Schematic diagram of the galdase constructs designed. The full galdase coding region was engineered with the CD7 stalk region and the transmembrane and cytoplasmic tail of furin, galdase-furin(Tm + Cyto); or with the furin lumenal domain and transmembrane region with the cytoplasmic tail omitted including the localization signals except for one amino acid R742 (flanking the transmembrane region), galdase-furin(Tm).

 
Expressed chimeric constructs have galdase enzyme activity
To determine whether the chimeric galdase constructs were expressed and the encoded proteins had enzyme activity, they were expressed in COS cells. After transfection, cell lysates were prepared and galdase activity assayed. Enzyme activity was calculated as nmoles of methylumbelliferone (fluorescent cleavage product of 4-methylumbelliferyl-{alpha}-D-galactoside)/mg of total protein/h (nmoles/mg/h). Lysates of COS cells, transfected with the cDNA of the irrelevant cell surface glycoprotein, CD48 (Vaughan et al., 1991Go), contained an activity of 395 ± 41.5 nmoles/mg/h, which represents the endogenous galdase activity of the COS cells. The expression of the nonchimeric galdase increased the enzyme activity of the lysate to 991 ± 7.99 nmoles/mg/h; similarly, expression of galdase-furin(Tm+Cyto) and galdase-furin(Tm) gave enzyme activities of 1680 ± 57.1 nmoles/mg/h and 1310 ± 24.3 nmoles/mg/h, respectively. These results demonstrate that both the chimeric forms of galdase, when expressed in a cell line, retain enzyme activity even though they contain the furin transmembrane domain alone or the furin transmembrane and carboxy-terminal sequence. The reason for the observed increase in activity for galdase-furin(Tm+Cyto) and galdase-furin(Tm) compared with galdase may be explained by (1) the conformation of galdase having been altered by the addition of the transmembrane domain, causing an increase in enzymatic activity; or, more likely, (2) the transmembrane domain is causing a retention of enzyme that normally would be secreted and lost to the cell due to the nonchimeric galdase swamping the M6P receptor.

Intracellular distribution of chimeric galdases
Confocal microscopy was used to detect the intracellular localization of the chimeric enzymes and to compare this distribution with galdase. Cells expressing galdase predominantly showed a punctate intracellular distribution (Figure 2A) characteristic of lysosomal localization, which contrasted with mock-transfected cells showing weak background staining (Figure 2B). Staining for {gamma}-adaptin, a TGN-localized protein, gave perinuclear foci typical of the Golgi (Figure 2C, D). There was a small proportion of coincident perinuclear staining of galdase with {gamma}-adaptin (Figure 2E) indicating that some galdase is normally found in the Golgi. These observations may be explained by (1) galdase en route (via the M6P-mediated pathway) through the Golgi to the lysosome or (2) the overexpression of galdase, causing a swamping of the M6P pathway and is present transiently in the Golgi, while en route to the cell surface.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Internal localization of galdase in transfected COS cells. Cells were transfected with vector alone, pCDNA1 (B, D, F) or galdase (A, C, E). (A, B) Galdase staining; (C, D) {gamma}-adaptin staining; (E, F) colocalization, galdase staining (green), {gamma}-adaptin staining (red), and superimposition of galdase and {gamma}-adaptin staining (yellow). The scale bar represents 20 µm.

 
Galdase-furin(Tm+Cyto), revealed a distinct distribution difference from that observed with galdase (Figure 2A). In contrast to galdase, the distribution of galdase-furin(Tm+Cyto) was as a compact perinuclear pattern (Figure 3A). {gamma}-Adaptin staining showed a similar distribution to galdase-furin(Tm+Cyto) (Figure 3C), and the two were found to colocalize when superimposed (Figure 3E). This result was confirmed by costaining with the lectin wheat germ agglutinin (WGA). This lectin binds to sialyated glycoproteins and lipids, which are synthesized in the Golgi and occupy not only the Golgi but also the cell surface (Stanley et al., 1980Go). Galdase-furin(Tm+Cyto) (Figure 3B) and WGA (Figure 3D) demonstrated a perinuclear staining pattern characteristic of the Golgi. As expected, WGA also gave some cell surface staining (Figure 3D). Galdase-furin(Tm+Cyto) also had an overlapping distribution with the perinuclear staining pattern of WGA (Figure 3F), further confirming galdase-furin(Tm+Cyto) Golgi localization. Besides Golgi staining, galdase-furin(Tm+Cyto) showed vesicular staining that was lysosomal or endosomal in nature (Figure 3A), explained by either a proportion of the galdase-furin(Tm+Cyto) trafficking to the lysosomes or a proportion en route to or from the cell surface to the TGN by the furin cytoplasmic tail signals.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3. Internal localization of galdase-furin(Tm+Cyto) in transfected COS cells. Galdase-furin(Tm+cyto) expressing cells (AH); (A, B) galdase staining; (C) {gamma}-adaptin staining; (D) WGA staining; (E, G, H) colocalization, galdase (green), {gamma}-adaptin (red), and superimposition of galdase and {gamma}-adaptin staining (yellow); (F) colocalization, galdase (green), WGA (red), and superimposition of galdase staining and WGA staining (yellow); (G) cycloheximide-treated; and (H) BFA-treated. The scale bar represents 20 µm.

 
To determine whether the observed Golgi staining for galdase-furin(Tm+Cyto) is the cause of active localization in the Golgi and not just the result of its trafficking through the Golgi to other cellular destinations (e.g., cell surface, lysosome), cycloheximide was used to block protein synthesis. After cycloheximide treatment, the perinuclear staining pattern of galdase-furin(Tm+Cyto) and {gamma}-adaptin localization persisted (Figure 3G), demonstrating that like {gamma}-adaptin, galdase-furin(Tm+Cyto) has an active retention to the Golgi. The pattern was unlikely to be attributed to retarded clearance from the endoplasmic reticulum (ER) and Golgi because the distinct perinuclear staining pattern was observed even 6 h post–cycloheximide treatment (data not shown).

To further characterize the localization of galdase-furin(Tm+Cyto) the fungal metabolite brefeldin A (BFA) was used to treat cells. This drug causes the separation of Golgi and the TGN, with resorption of the Golgi into the ER and the cessation of vesicular transport to and from the cell surface. The TGN remains as a tight perinuclear focus close to the microtubule organizing center (Reaves and Banting, 1992Go). Following BFA treatment, galdase-furin(Tm+Cyto) was retained in the TGN (green, Figure 3H). Vesicular staining was markedly decreased, as would be the case if the staining was due to vesicular transport to or from the cell surface. This active localization of galdase-furin(Tm+Cyto) to the TGN confirms previous reports for the colocalization of furin with TGN38 (Schafer et al., 1995Go), another TGN marker. The distribution of the marker {gamma}-adaptin, however, was dispersed following treatment with BFA (red, Figure 3H) due to BFA blocking its recruitment to the Golgi’s cytosolic surface (Molloy et al., 1994Go). These results demonstrate that galdase can be relocalized in the cell to the Golgi apparatus, specifically the TGN, by attaching the TGN-targeting signals contained within the cytoplasmic domain of furin.

As expected, galdase-furin(Tm) was found to localize to the cell surface either with or without cycloheximide treatment (Figure 4A, B), which was in contrast to nonchimeric galdase and galdase-furin(Tm+Cyto), where neither enzyme was observed at the cell surface (data not shown). Permeabilized galdase-furin(Tm)–expressing cells (Figure 4C) showed a distribution pattern similar to galdase-furin(Tm+Cyto) with a small amount of perinuclear staining that colocalized with {gamma}-adaptin (Figure 4E, Figure 3C). This staining of galdase-furin(Tm) was completely abrogated by cycloheximide treatment (Figure 4D), and only the {gamma}-adaptin staining was retained (Figure 4F). Thus no superimposable staining of {gamma}-adaptin and galdase-furin(Tm) was present (Figure 4H). This was the reverse to what was observed for galdase-furin(Tm+Cyto) following the same treatment (Figure 3G). Interestingly, the small amount of vesicular staining for galdase-furin(Tm) was also reduced by cycloheximide, indicating that this was a transient state of the enzyme as it is trafficked via vesicular transport from the TGN to the cell surface. The results indicate that galdase-furin(Tm), lacking a TGN signal, contains no means of being retained in the TGN and is instead trafficked to the cell surface. This is in agreement with previous findings for furin when the cytoplasmic tail signals were deleted (Schafer et al., 1995Go).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4. Localization of galdase-furin(Tm) in transfected COS cells. Galdase-furin(Tm) expressing cells (AH). (A, B) Cell surface stained with galdase (green), then permeablized and {gamma}-adaptin stained as an internal reference marker (red). (CH) Internal cell staining; (B, D, F, H) cycloheximide-treated. (C, D) Galdase staining; (E, F) {gamma}-adaptin staining; (G, H) colocalization, galdase staining (green), {gamma}-adaptin staining (red), and superimposition of galdase staining and {gamma}-adaptin staining (yellow). The scale bar represents 20 µm.

 
Galdase-furin(Tm+Cyto) has furin-like recycling: cell surface to the TGN
Although most furin localizes to the TGN a small proportion, <7% has been shown to cycle between the TGN and the cell surface, due to the signal sequences in the cytoplasmic tail of furin (Schafer et al., 1995Go). This has been demonstrated by the ability of furin to internalize bound antibody from the cell surface to the TGN (Molloy et al., 1994Go). Similar antibody internalization experiments were performed to confirm whether the chimeric galdase constructs are also able to cycle. These experiments rely on COS cells expressing the chimeric constructs being incubated in the presence of anti-galdase antibody. If cycling occurs, the anti-galdase antibody would bind to the chimeric galdase at the cell surface and be internalized and carried to the TGN as an immune complex with the chimeric galdase. To detect internalized antibody the cells were fixed, permebilized and labeled with anti-rabbit Ig–fluorescein isothiocyanate (FITC) conjugate. Staining was not seen with mock-transfected, galdase-transfected, or galdase-transfected cells incubated with an irrelevant anti-ß-Cop monoclonal antibody (Figure 5A, B, C). However, vesicular staining within the cytoplasm and characteristic perinuclear localization to the Golgi was seen in galdase-furin(Tm+Cyto)-expressing cells (Figure 5D). As expected, only cell surface labeling was seen in galdase-furin(Tm)-expressing cells (Figure 5E). These results show that the cytoplasmic tail of furin in the galdase-furin(Tm+Cyto) chimera is necessary and sufficient to transport and retrieve galdase-furin(Tm+Cyto) to and from the cell surface in a similar manner to furin.



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 5. Internalization of anti-galdase antibody by transfected COS cells. COS cells expressing (A, B) vector alone (pCDNA1), (C) galdase, (D) galdase-furin(Cyto+Tm), and (E) galdase-furin(Tm). (A) Stained with secondary antibody, anti-rabbit Ig-FITC, only; (B) incubated for 1 h in culture with an irrelevant primary antibody (anti-ß-COP) and then fixed, permeablized, and stained with the secondary antibody,anti-mouse Ig-FITC; (CE) incubated for 1 h in culture with the anti-galdase antibody and then fixed, permeablized, and stained with the secondary antibody, anti-rabbit Ig FITC. The scale bar represents 20 µm.

 
Galdase-furin(Tm+Cyto) and galdase-furin(Tm) reduces cell surface Gal{alpha}(1,3)Gal
Galdase is known to cleave {alpha}-Gal, causing a reduction in cell surface Gal{alpha}(1,3)Gal (Osman et al., 1997Go). It is clear that galdase-furin(Tm+Cyto) and galdase-furin(Tm) have enzyme activity; to address the question as to whether these chimeras are also capable of decreasing Gal{alpha}(1,3)Gal, cotransfections of COS cells with {alpha}(1,3)GT, the transferase that synthesizes Gal{alpha}(1,3)Gal, were performed (Figure 6A). Both galdase-furin(Tm+Cyto) and galdase-furin(Tm) were able to decrease cell surface expression of Gal{alpha}(1,3)Gal by 40–45%, this being modestly more effective than galdase, ~25 % (Figure 6A). These results show that galdase-furin(Tm+Cyto) and galdase-furin(Tm) are still functional in the cell even though they have different cellular locations. Transfection with the {alpha}(1,2)FT was used as a positive control as it can efficiently compete with the {alpha}(1,3)GT (Sandrin et al., 1995Go). As expected, this reduced cell surface Gal{alpha}(1,3)Gal expression by 90% (Figure 6A).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6. (A) Cell surface expression of Gal{alpha}(1,3)Gal on cotransfected COS cells. The cells were cotransfected with {alpha}(1,3)GT and the constructs CD48 (an cell surface expressed protein, as an irrelevant expressed protein control, mock transfection), {alpha}(1,2)FT (positive control), galdase, galdase-furin(Tm+Cyto), and galdase-furin(Tm). Posttransfection, the COS cells were surface stained with IB4-FITC and the number of positively stained cells determined by immunofluorescence microscopy. The percentage of positive stained cells was calculated relative to the cotransfection of {alpha}(1,3)GT and pCDNA1 (100% positive). (B) Cell surface expression of Gal{alpha}(1,3)Gal on cotransfected CHOP cells. The cells were cotransfected with {alpha}(1,3)GT and the constructs CD48 (mock transfection), {alpha}(1,2)FT (positive control), galdase, galdase-furin(Tm+Cyto), and galdase-furin(Tm). The CHOP cells were surface stained with FITC-IB4, and the fluorescence of positively labeled cells was determined by flow cytometery. The median fluorescence of transfected cells is expressed as a percentage relative to cotransfection of {alpha}(1,3)GT and pCDNA1 (100% positive). (C) The cell surface expression of NAcLac on cotransfected CHOP cells. The CHOP cells were cotransfected with {alpha}(1,3)GT and pCDNA1 or galdase-furin (Tm+cyto). The cell surface was labeled with EcorA-FITC and fluorescence determined by flow cytometery. The resultant histogram: pCDNA1 (thick line) and galdase-furin(Tm+Cyto) (thin line) were overlaid.

 
These results were reproduced in the Chinese hamster ovary cell line transformed with the polyoma large T antigen (CHOP), which allowed a more sensitive quantitation of cell surface fluorescence by flow cytometery rather than by counting fluorescent cells by microscopy. Cells were cotransfected with {alpha}(1,3)GT, because CHOP cells lack this enzyme, then stained with Griffonia simplicifolia Isolectin IB4 (IB4)–FITC and the lectin from Erythrina corallodendron (EcorA)–FITC (which detects the precursor to Gal{alpha}(1,3)Gal, N-acetyllactosamine [NAcLac]). Coexpression of the cell surface marker CD48 with {alpha}(1,3)GT showed that protein expression alone has little influence on Gal{alpha}(1,3)Gal expression (Figure 6B). {alpha}(1,2)FT was again used as a positive control, producing an 83% decrease in Gal{alpha}(1,3)Gal (Figure 6B), similar to that shown in COS cells (Figure 6A). Galdase, galdase-furin(Tm+Cyto), and galdase-furin(Tm) caused decreases in cell surface Gal{alpha}(1,3)Gal of 20%, 30%, and 30%, respectively (Figure 6B). This shows that the two chimeric galdases caused a greater decease in Gal{alpha}(1,3)Gal than the nonchimeric form and is in agreement with the decreases observed for COS cells (Figure 6A) with both cases most probably reflecting their increased {alpha}-galactosidase activity.

To confirm that the observed decrease in Gal{alpha}(1,3)Gal was indeed the result of cleavage by the galdase chimeras, NAcLac expression was examined by EcorA-FITC binding. The cleavage of Gal{alpha}(1,3)Gal by galdase produces NAcLac. EcorA-FITC binding increased for galdase-furin(Tm+Cyto) (Figure 6C); similarly, galdase and galdase-furin(Tm) cotransfected CHOP cells showed increases (data not shown). This was not due to the transfection of {alpha}(1,3)GT alone, which gave a minor decrease in EcorA-FITC fluorescence (data not shown), nor the transfection of the galdases without {alpha}(1,3)GT, which caused neither an increase nor decrease (data not shown) confirming that in the cotransfections the decrease in Gal{alpha}(1,3)Gal on the cell surface is the sole action of the expression of galdase and its enzymatic cleavage.

Both COS and CHOP cells are transient expression systems that do not express Gal{alpha}(1,3)Gal on their cell surface. To see if a similar trend occurs in a cell line that expresses Gal{alpha}(1,3)Gal, the pig endothelial cell line (PIEC) was used. Two representative clones, one expressing galdase and one expressing galdase-furin(Tm+Cyto) were selected for further analysis. Both have comparable enzyme activities of approximately 140 nmoles/mg protein/h (Figure 7A) that are significantly elevated compared to the parental PIEC, 60 nmoles/mg protein/h (Figure 7A). Both gave a similar reduction in Gal{alpha}(1,3)Gal of ~50% compared with parental PIEC (Figure 7B, C), which was a greater reduction than was achieved in the transient expression systems (see previous discussion).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7. (A) Enzyme activity of galdase and galdase-furin(Tm+Cyto) expressing PIEC. Galdase activity was determined from PIEC lysates in terms of nmoles/mg protein/h. The enzyme activities of parental PIEC and PIECs expressing galdase and galdase-furin(Tm+Cyto) were determined. (B, C) Cell surface expression of Gal{alpha}(1,3)Gal for galdase and galdase-furin(Tm+Cyto) expressing PIEC. Cells were stained with IB4-FITC and fluorescence determined by flow cytometry. Unstained parental PIEC (dashed line), parental PIEC stained with IB4-FITC (thin line). (B) Galdase expressing PIEC (thick line); (C) galdase-furin(Tm+Cyto) expressing PIEC (thick line).

 
Galdase-furin(Tm+Cyto) is more effective in a transgenic mouse than galdase
Having shown reduction of Gal{alpha}(1,3)Gal in vitro, we examined whether relocalizing galdase in vivo was also capable of decreasing Gal{alpha}(1,3)Gal expression by the generation and characterization of a galdase-furin(Tm+Cyto)-transgenic mouse line. Enzyme activity and cell surface Gal{alpha}(1,3)Gal expression of homozygous galdase-furin(Tm+Cyto) splenocytes were compared to those of homozygous galdase splenocytes from a mouse line previously generated and described (Osman et al., 1997Go). The {alpha}-galactosidase enzyme activity of the splenocyte lysates from galdase-furin(Tm+Cyto) was185 ± 10.1 nmoles/mg protein/h, compared with 142 ± 1.94 nmoles/mg protein/h from galdase and 67 ± 3.35 nmoles/mg protein/h from nontransgenic mice. Thus the two transgenic lines had elevated levels of {alpha}-galactosidase activity, at least two- to threefold higher than nontransgenic mice. When cell surface expression of Gal{alpha}(1,3)Gal was compared, the galdase-transgenic mice were found to be no different than that of nontransgenic littermates (Figure 8A). In contrast, the galdase-furin(Tm+Cyto)-transgenic mice (Figure 8B) showed a decrease in cell surface Gal{alpha}(1,3)Gal by 25%. The small difference in enzyme activity observed between galdase-furin(Tm+Cyto)- and galdase-transgenic mice was unable to account for this decrease. One possible explanation was that a threshold level of galdase activity was required before effective removal of Gal{alpha}(1,3)Gal could occur. Galdase-furin(Tm+Cyto)-hemizygous mice showed half the enzyme activity of the homozygous mice and gave an intermediate decrease in Gal{alpha}(1,3)Gal (data not shown). Therefore the relocalization of galdase, not the level of enzyme activity, causes galdase-furin(Tm+Cyto) to be more effective at decreasing cell surface Gal{alpha}(1,3)Gal.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 8. Cell surface expression of Gal{alpha}(1,3)Gal on transgenic mouse splenocytes. Cells were stained with IB4-FITC and fluorescence determined by flow cytometry. The percentage reduction was determined by the number of cells IB4 positive gated in the M1 region, relative to the nontransgenic mouse. (Thick lines): (A) Galdase mouse, (B) galdase-furin(Tm+Cyto) mouse, (C) galdase x {alpha}(1,2)FT) F1 mouse; (D) galdase-furin(Tm+Cyto) x {alpha}(1,2)FT) F1 mouse; (E) hemizygous {alpha}(1,2)FT transgenic mouse; (F) homozygous {alpha}(1,2)FT mouse (thick lines). (Thin lines): Nontransgenic mouse (all panels).

 
To date, the most effective strategy in decreasing cell surface Gal{alpha}(1,3)Gal by enzymatic modification is by the overexpression of the {alpha}(1,2)FT (Sandrin et al., 1995Go). Unfortunately, even when expressed at high levels this enzyme is still unable to eliminate all Gal{alpha}(1,3)Gal. We previously demonstrated in cell lines that a more effective approach can be obtained by coexpressing the {alpha}(1,2)FT with galdase (Osman et al., 1997Go). Now with the relocalized galdase mice showing more effective decreases in Gal{alpha}(1,3)Gal than galdase, it follows that its coexpression with the {alpha}(1,2)FT in the same transgenic animal would be an even more effective strategy in reducing Gal{alpha}(1,3)Gal. To test this the galdase- and galdase-furin(Tm+Cyto)-transgenic mice were crossed with the {alpha}(1,2)FT-transgenic mice (Cohney et al., 1997Go), producing F1 mice that were hemizygous for each transgene, and the splenocyte cell surface Gal{alpha}(1,3)Gal expression was determined (Figure 8C, D). Homozygous {alpha}(1,2)FT-transgenic mice showed a 69% reduction of Gal{alpha}(1,3)Gal expression (Figure 8F), whereas hemizygous {alpha}(1,2)FT mice showed a 36% reduction (Figure 8E). This was similar to the reduction observed with the (galdase x {alpha}(1,2)FT) F1 mice (Figure ) (24%), showing that these two transgenes were not additive. In contrast, Gal{alpha}(1,3)Gal expression was reduced by 64% in the (galdase-furin(Tm+Cyto) x {alpha}(1,2)FT) F1 mice (Figure 8D), a reduction similar to the {alpha}(1,2)FT-homozygous mice (Figure 8F), showing the additive effect of these two trangenes. It would be expected that even higher levels of reduction could be obtain with homozygous (galdase-furin(Tm+Cyto) x {alpha}(1,2)FT) mice (currently being investigated).


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The central aim of this study was to examine whether the galdase enzyme could be modified to improve its ability to reduce cell surface Gal{alpha}(1,3)Gal by relocalizing it to other sites of the cell. The results clearly demonstrate that galdase, which is typically localized in the lysosomes, can be relocalized to two locations, the TGN and cell surface. This relocalization was achieved by the attachment of furin sequences to the carboxy-terminus of galdase. These sequences did not compromise activity of the galdase catalytic domain and, at the same expression level, can more effectively hydrolyze Gal{alpha}(1,3)Gal to reduce cell surface expression.

Galdase-furin(Tm+Cyto) localized to the TGN, as shown by colocalization studies with TGN markers {gamma}-adaptin and WGA (Figure 3), indicating that the addition of the furin cytoplasmic domain sequence is sufficient for TGN localization. The results are similar to previous studies with furin using the TGN markers {gamma}-adaptin (Molloy et al., 1994Go) and TGN38 (Molloy et al., 1994Go; Schafer et al., 1995Go; Shapiro et al., 1997Go) and to immunoelectron microscopic studies (Bosshart et al., 1994Go; Molloy et al., 1994Go; Schafer et al., 1995Go). Furthermore, findings have demonstrated a direct association of the furin cytoplasmic domain with the AP1 complex (Teuchert et al., 1999Go), of which {gamma}-adaptin is a subunit, strengthening the evidence for TGN colocalization of {gamma}-adaptin and galdase-furin(Tm+Cyto) (Figure 3). However, it cannot be discounted that galdase-furin(Tm+Cyto) may be influenced by the lysosomal M6P signal contained within its galdase domain (Ioannou et al., 1998Go), although confocal microscopy did show lower vesicular staining than that observed for galdase (Figure 2A, 3A). Also, BFA was able to reduce the vesicular staining significantly, indicating that it was probably trafficking to and from the cell surface via an endosomal pathway rather than localizing to the lysosomes. Another important observation was that the cytoplasmic domain sequence of furin was capable of cycling galdase-furin(Tm+Cyto) between the cell surface and the TGN (Figure 5D).

The CD7 stalk region was included in the galdase-furin(Tm+Cyto) construct as a spacer, spacing galdase from the lipid bilayer. The CD7 stalk is an extended structure containing four repeats with a high content of P, S, and T residues and provides a spacer between the transmembrane and Ig-like domains of CD7 (Aruffo and Seed, 1987Go). There are no localization signals in the stalk region, and even if such signals did exist they would be isolated from interacting with cytosolic transport proteins by the lipid bilayer, being positioned on the lumenal side of the bilayer. It is therefore unlikely that the CD7 stalk region included in the galdase-furin(Tm+Cyto) chimera contributed to its localization.

Deletion of the furin localization signals causes a dramatic change in its distribution in the cell such that it localizes to the plasma membrane and primary vesicles of the endosomal/lysosomal system and is unable to be retrieved from the cell surface (Bosshart et al., 1994Go; Schafer et al., 1995Go). Galdase-furin(Tm) localization is in agreement with these observations, that is, galdase-furin(Tm) was found at the plasma membrane (Figure 4A, B) and was unable to cycle from the cell surface to the TGN (Figure 5E). Cycloheximide treatment of galdase-furin(Tm) expressing COS cells (Figure 4G, H) demonstrated two interesting observations. First, any galdase-furin(Tm) localized to the Golgi was due to its trafficking to the cell surface (most cell surface proteins follow this pathway); second, the lack of lysosomal staining demonstrated an inability of galdase-furin(Tm) to localize to the lysosome. The transmembrane domain from furin is sufficient to override the M6P signal of the galdase domain and this could be caused by the transmembrane domain anchoring galdase-furin(Tm) into the lipid bilayer, stopping either the synthesis of the M6P signal via N215 or its recognition.

The enzyme activity of the chimeric galdases was not compromised by the addition of furin transmembrane or cytoplasmic domain sequences. Indeed, there was increased galdase activity, which can be explained by a greater retention of active membrane-bound enzyme within the cell. In addition, the ability of the chimeric galdases to cleave Gal{alpha}(1,3)Gal demonstrates that an increase in enzyme activity does indeed correspond to a greater decrease in cell surface Gal{alpha}(1,3)Gal (Figure 6A, B). However, relocalization of galdase gave only a modest improvement in the reduction of cell surface Gal{alpha}(1,3)Gal for transfected cell lines (Figure 6B). When expressed as a transgene in mice, a more significant reduction was observed for splenocytes, with galdase-furin(Tm+Cyto), 25%, compared to galdase, 0% (Figure 8A, D). A greater decrease in cell surface Gal{alpha}(1,3)Gal was not observed in the cell lines possibly as the overexpression of galdase caused the enzyme to follow a similar transport pathway as the chimeric galdases, from the trans region of the Golgi to the cell surface. Consequently, all three galdases (chimeric and nonchimeric) would be capable of cleaving Gal{alpha}(1,3)Gal along this pathway, masking the effectiveness observed for the chimeric galdases. Therefore when comparing chimeric and nonchimeric galdases, the expression level in the cell type concerned could dictate the degree of their effectiveness.

Targeting galdase is clearly a useful strategy to decrease cell surface Gal{alpha}(1,3)Gal for pig-to-human xenotransplantation, where this epitope is expressed on the surface of pig cells and causes HAR (Sandrin et al., 1993Go). Hence the expression of the targeted galdase in a transgenic pig could reduce cell surface expression of Gal{alpha}(1,3)Gal. We have shown here that galdase-furin(Tm+Cyto) can be effective at decreasing cell surface Gal{alpha}(1,3)Gal on PIECs (Figure 7) and also that at least at the expression levels observed, it is more effective at decreasing cell surface Gal{alpha}(1,3)Gal in a whole transgenic animal. Unfortunately, at the expression levels demonstrated in this article, the galdase-furin(Tm+Cyto), expressed by itself, would probably be insufficient in a transgenic pig at eliminating HAR. However, other refinements of the strategy could address this problem. One would be increasing the expression level of the transgene. A recently generated galdase-trangenic mouse line (Kase et al., 1998Go) with extremely high expression levels of galdase, over 10-fold higher than achieved here, has no lethal effects or abnormalities in the mouse, indicating that the potential exists for increased expression levels of the enzyme. Another possibility is the coexpression of the transgene with other Gal{alpha}(1,3)Gal-modifying enzymes. The results (Figure 8D), with galdase-furin(Cyto-Tm) expressed in conjunction with {alpha}(1,2)FT, show merit in the effectiveness of this approach because the combination had an additive effect in reducing Gal{alpha}(1,3)Gal compared with either transgene expressed in hemizygote mice.

Other factors could dictate the success or failure of using galdase chimeras, such as the microenvironment of the enzyme, particularly pH. The activity of galdase is greatest at pH 4.5 (Desnick et al., 1973Go) which is appropriate to its function as a glycosidase within lysosomes but not as a glycosidase in the TGN, which is less acidic (pH 6.0) or at the plasma membrane (pH 7.0). Thus, an important factor for further consideration is the suitability of the final destination to its enzyme activity. It remains to be determined whether mutations of the galdase catalytic domain, which can alter its activity at different pH levels (Ishii et al., 1995Go) or targeting galdase derived from a species other than humans that have greater activity at different pH will prove to be a more useful for the elimination of Gal{alpha}(1,3)Gal in combination with our targeting strategy.

Perhaps more important, the targeting of galdase could be useful in enzyme replacement therapy for patients with Fabry’s disease, an X-linked inherited disorder of glycosphingolipid metabolism that leads to the accumulation of ceramide trihexoside and other glycolipids in tissues (Brady et al., 1967Go). Enzyme replacement therapy has been used in the treatment of this disease (Medin et al., 1996Go; Schiffmann et al., 2000Go); however, the enzyme has a short half-life and is rapidly cleared from the circulation. Gene replacement therapy has also been undertaken in vitro using retroviral vectors with some limited success (Medin et al., 1996Go). It could be useful to employ gene replacement therapy based on a chimeric galdase containing endosomal targeting signals and retrieval signals of furin or other targeting signals attached to a pH-modified galdase. This could allow the degalactosylation of accumulated glycolipids by an active chimeric galdase such that the degradation of these glycolipids can resume, and the amount of intracellular deposits could be reduced.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Antibodies and cytochemical probes
The following reagents were obtained from commercial sources: monoclonal anti-{gamma}-adaptin, monoclonal anti-ß-COP, IB4, EcorA, and WGA were all purchased from Sigma (St. Louis, MO). The polyclonal rabbit anti-galdase antibody was a generous gift from R. J. Desnick (Mount Sinai School of Medicine, New York). Secondary antibodies were FITC conjugated sheep anti-rabbit Ig F(ab')2 fragments and biotin-conjugated sheep anti-mouse Ig (Silenus) and streptavidin-X–Texas red conjugate (Molecular Probes).

Generation of galdase constructs
The constructs generated are shown (Figure 1) and were made using standard DNA procedures (Ausubel et al., 1987Go; Sambrook and Maniatis, 1989Go). The human galdase cDNA in the vector pAsc.8 was a generous gift from R. J. Desnick and was subcloned into pcDNA1 (Invitrogen, Groningen, The Netherlands) to produce the plasmid p-galdase (Figure 1) as described previously (Osman et al., 1997Go). Furin sequences were generated as follows: a 597-bp fragment from exon 8 of human furin (Roebroek et al., 1986Go) was amplified by polymerase chain reaction (PCR) from human genomic DNA using oligonucleotide primer pair MO123 5'TATAGCACCGAGAATGACGTG3' (nt 2737–2757) and MO124 5'CCAAACCCAGTCCCAAGATAA3' (nt 3313–3333). A second-step PCR amplified an internal 260-bp fragment consisting of the furin transmembrane and cytoplasmic coding sequence including the stop codon using the primer pair GTM7 5'CATGAATTCGAGGTGGTGGCCGGCCTCA3'(nt 3001–3019 plus EcoRI site underscored) and GTM4 5'CATCTGCAGTCAGAGGGCGCTCTGGTCTTT3' (nt 3217–3243 plus a PstI site underscored and stop codon in italics), the fragment furin(Tm+Cyto). A second internal 211-bp fragment containing the furin transmembrane and 5' flanking region was amplified using the primer pair GTM3 (described already) and GTM8 5'CGTCTAGATCATCAGCGCAGCTGCAGGACC3' (nt 3060–3075, XbaI site underscored and stop codon in italics), the fragment furin(Tm). Both fragments, furin(Tm+Cyto) and furin(Tm), were subcloned by TA cloning (Holton and Graham, 1991Go) into the pMosblue vector (Amersham). The chimeric constructs were made as follows. The CD7 stalk sequence (147 bp) was generated by PCR from CD7 in CDM8 (Aruffo and Seed, 1987Go) using the primer pair GTM5 5'CATGGATCCCAAGGATGGCACAGATGC3' (nt 895–915 plus BamHI site underscored) and GTM6 5'CATGAATTCTCCCTCCCGTCTCCGAC3' (nt 985–1004 plus EcoRI site underscored). The PCR product was digested with BamHI/EcoRI, purified, and then ligated into BamHI/EcoRI-digested p-galdase to produce the intermediate p-galdase-CD7. p-Galdase-furin(Tm+Cyto) (Figure 1), was generated by ligating the EcoRI/XbaI-digested 260-bp furin(Tm+Cyto) fragment into EcoRI/XbaI-digested p-galdase-CD7. p-Galdase-furin(Tm) (Figure 1) was produced by ligating purified BamHI/XbaI-digested 211-bp furin(Tm) fragment into BamHI/XbaI-digested p-galdase. The sequences of all chimeric constructs were confirmed by sequencing both strands using the ABI automated sequencer 377 (Applied Biosystems). To produce a stable expressing cell line of galdase-furin(Tm+Cyto) and galdase, PIEC was used. The galdase-furin(Tm+Cyto) fragment was subcloned into pCDNA1(Neo) (Invitrogen) by the HindIII/XbaI sites, and for galdase, the pAsc.8 vector containing the galdase cDNA was used.

Transfection and immunofluorescence
COS-7 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Cytosystems) and were transfected using the DEAE-dextran transfection method as described elsewhere (Osman et al., 1997Go). PIECs were maintained in DMEM and were transfected using CaPO4 transfection as described (Wigler et al., 1979Go). The transfected cells were selected by growing in DMEM containing G418 at 2 mg/ml for 3 weeks, and a number of clones were selected based on their reduction in cell surface Gal{alpha}(1,3)Gal and galdase enzyme activity. CHOP cells (Heffernan and Dennis, 1991Go) were maintained in DMEM and transfected with Lipofectamine Plus regent (Gibco BRL Life Technologies). Briefly, 3 x 105 cells were cultured overnight, subsequently transfected using a total of 2.5 µg of plasmid DNA for 2.5 h, washed, then cultured for a further 48 h. Transfection efficiencies of each plasmid were determined by immunofluresence staining for the relevant expressed protein and counting the number of cells that were positive. All constructs were found to have equivalent transfection efficiencies at the plasmid concentration used for transfections. The cells were examined for Gal{alpha}(1,3)Gal expression by cytofluorographic analysis on a FACSCalibur flow cytometer (Becton Dickinson).

For confocal microscopy analysis, transfected cells were grown in four-well plastic Lab Tek II chamber slides (Nalge Nunc). A two-stage formaldehyde fixation method (Pawley, 1995Go) involved fixing the cells in a 2% paraformaldehyde (BDH Laboratory Supplies) solution, first at pH 6.5 and then at pH 10. In some experiments cells were treated in culture before fixation with cycloheximide and BFA (Sigma). For cycloheximide (Sigma) treatment, cells were incubated with cycloheximide (150 µg/ml) for 2 h; for BFA treatment cells were first treated with cycloheximide and then BFA (10 µg/ml) for 10 min. Fixed cells were washed with phosphate-buffered saline (PBS), pH 7.2, containing 0.5% bovine serum albumin (BSA) and permeabilized with 0.1% v/v Triton X-100 (Merck) in PBS. For indirect immunofluorescence, the cells were incubated with primary antibodies (such as anti-{gamma}-adaptin, anti-galdase, in PBS/0.5% BSA for 30 min on ice), washed twice, incubated with secondary antibody for 30 min on ice, washed, air-dried, mounted in Prolong Antifade (Molecular Probes), and visualized using an Optiscan krypton/argon laser confocal microscope (Optiscan). Excitation wavelengths of 488 nm and 568 nm were used for FITC and X-Texas red fluorescence, respectively.

Galdase assays
Lysates from transfected cells were assayed for galdase activity using 4-methylumbelliferyl-{alpha}-D-galactopyranoside (Bishop and Desnick, 1981Go), and protein concentration was estimated using a Bradford assay. The results shown are from at least three experiments.

Production of the transgenic construct, purification, and microinjection
A 1697-bp NruI/NotI DNA fragment encoding the full-length galdase-furin(Tm+Cyto) was generated utilizing PCR and the galdase-furin(Tm+Cyto) plasmid. The 5' primer homologous to the 5' untranslated region was 5'-TCGCGAatgcagctgaggaacccagaa, in which the underscored sequence contains a unique NruI site, and the 3' primer homologous to the 3' untranslated region was 5'-CcaggacgtcgacgcgactactCGCCGGCGtag (the underscored sequence contains a NotI site). The DNA was separated by electrophoresis in agarose gels, purified using QIAEX II beads (Qiagen), and subcloned into a NruI/NotI digested genomic H-2Kb-containing vector (12), resulting in the plasmid clone (pH-2Kb-galdase-furin(Tm+Cyto)) encoding the galdase-furin(Tm+Cyto) gene directionally cloned into exon 1 of the murine H-2Kb gene. The construct was engineered such that translation would begin at the initiation codon (ATG) of the galdase-furin(Tm+Cyto) cDNA and terminate at the stop codon (TGA) 1686 bp downstream. DNA was prepared for microinjection by digesting pH-2Kb-galdase-furin(Tm+Cyto) with XhoI and purification of the H-2Kb-galdase-furin(Tm+Cyto) DNA from vector by electrophoretic separation in agarose gels, and purified using QIAEX II beads. Injections were performed into the pronuclear membrane of (C57BL/6xSJL)F1 zygotes at concentrations between 2 and 5 ng/µl, and the zygotes were transferred to pseudopregnant (C57BL/6xSJL)F1 females as previously described (Cohney et al., 1997Go).

Screening for the transgene
The presence of the transgene in the live offspring was sought by a combination of Southern blotting and dot blotting. (1) For Southern blotting, genomic DNA (~10 µg) was isolated from the tail and digested to completion with BamHI; the DNA was separated by electrophoresis on a 0.8% agarose gel, transferred to nylon filters, Hybond N+ (Amersham), and hybridized with the furin(Tm+Cyto) portion from p-galdase-furin(Tm+Cyto), using a final wash at 68°C in 0.1x 3M sodium chloride 0.3M trisodium citrate pH 7.0/1% sodium dodecyl sulfate. (2) For dot blots, 2 µg and 5 µg of genomic DNA was transferred to nylon filters Hybond (Amersham), hybridized, and washed as described. Homozygous and hemizygous transgenic mice were distinguished by comparing the density of galdase probed autoradiographs obtained from Southern blots and standardizing the probing with the murine {alpha}(1,3)GT gene (Larsen et al., 1989Go) to determine relative copy number.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
This work was supported in part by funds from the National Health and Medical Research Council of Australia.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
aa, amino acids; BFA, brefeldin A; BSA, bovine serum albumin; CHOP, Chinese hamster ovary cells transformed with the polyoma large T antigen; DMEM, Dulbecco’s modified Eagle’s medium; EcorA, lectin from Erythrina corallodendron; ER, endoplasmic reticulum; FITC, fluorescein isothiocyanate; HAR, hyperacute reaction; IB4, isolectin IB4 from Griffonia simplicifolia; M6P, mannose-6-phosphate; PBS, phosphate buffered saline; PIEC, pig endothelial cell line, PCR, polymerase chain reaction; TGN, trans-Golgi network; WGA, wheat germ agglutinin lectin from Triticum vulgaris.


    Footnotes
 
1 To whom correspondence should be addressed; E-mail: m.sandrin@ari.unimelb.edu.au Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Aruffo, A. and Seed, B. (1987) Molecular cloning of two CD7 (T-cell leukemia antigen) cDNAs by a COS cell expression system. EMBO J., 6, 3313–3316.[Web of Science][Medline]

Ausubel, F.M.B., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (1987) Current protocols in molecular biology. Wiley, New York.

Bishop, D.F. and Desnick, R.J. (1981) Affinity purification of alpha-galactosidase A from human spleen, placenta, and plasma with elimination of pyrogen contamination. Properties of the purified splenic enzyme compared to other forms. J. Biol. Chem., 256, 1307–1316.[Abstract/Free Full Text]

Bosshart, H., Humphrey, J., Deignan, E., Davidson, J., Drazba, J., Yuan, L., Oorschot, V., Peters, P.I., and Bonifacino, J.S. (1994) The cytoplasmic domain mediates localization of furin to the trans-Golgi network en route to the endosomal/lysosomal system. J. Cell Biol., 126, 1157–1172.[Abstract/Free Full Text]

Brady, R.O., Gal, A.E., Bradley, R.M., and Martensson, E. (1967) The metabolism of ceramide trihexosides. I. Purification and properties of an enzyme that cleaves the terminal galactose molecule of galactosylgalactosylglucosylceramide. J. Biol. Chem., 242, 1021–1026.[Abstract/Free Full Text]

Cohney, S., McKenzie, I.F., Patton, K., Prenzoska, J., Ostenreid, K., Fodor, W.L., and Sandrin, M.S. (1997) Down-regulation of Gal alpha(1, 3)Gal expression by alpha1, 2-fucosyltransferase: further characterization of alpha1, 2-fucosyltransferase transgenic mice. Transplantation, 64, 495–500.[CrossRef][Web of Science][Medline]

Desnick, R.J., Allen, K.Y., Desnick, S.J., Raman, M.K., Bernlohr, R.W., and Krivit, W. (1973) Fabry’s disease: enzymatic diagnosis of hemizygotes and heterozygotes. Alpha-galactosidase activities in plasma, serum, urine, and leukocytes. J. Lab. Clin. Med., 81, 157–171.[Web of Science][Medline]

Heffernan, M. and Dennis, J.W. (1991) Polyoma and hamster papovavirus large T antigen-mediated replication of expression shuttle vectors in Chinese hamster ovary cells. Nucleic Acids Res., 19, 85–92.[Abstract/Free Full Text]

Holton, T.A. and Graham, M.W. (1991) A simple and efficient method for direct cloning of PCR products using ddT-tailed vectors. Nucleic Acids Res., 19, 1156.[Free Full Text]

Ioannou, Y.A., Bishop, D.F., and Desnick, R.J. (1992) Overexpression of human alpha-galactosidase A results in its intracellular aggregation, crystallization in lysosomes, and selective secretion. J. Cell Biol., 119, 1137–1150.[Abstract/Free Full Text]

Ioannou, Y.A., Zeidner, K.M., Grace, M.E., and Desnick, R.J. (1998) Human alpha-galactosidase A: glycosylation site 3 is essential for enzyme solubility. Biochem. J., 332, 789–797.[Medline]

Ishii, S., Kase, R., Sakuraba, H., and Suzuki, Y. (1995) The functional role of glutamine-280 and threonine-282 in human alpha-galactosidase. Biochim. Biophys. Acta, 1270, 163–167.[Medline]

Jones, B.G., Thomas, L., Molloy, S.S., Thulin, C.D., Fry, M.D., Walsh, K.A., and Thomas, G. (1995) Intracellular trafficking of furin is modulated by the phosphorylation state of a casein kinase II site in its cytoplasmic tail. EMBO J., 14, 5869–5883.[Web of Science][Medline]

Kase, R., Shimmoto, M., Itoh, K., Utsumi, K., Kotani, M., Taya, C., Yonekawa, H., and Sakuraba, H. (1998) Immunohistochemical characterization of transgenic mice highly expressing human lysosomal alpha-galactosidase. Biochim. Biophys. Acta, 1406, 260–266.[Medline]

Larsen, R.D., Rajan, V.P., Ruff, M.M., Kukowska-Latallo, J., Cummings, R.D., and Lowe, J.B. (1989) Isolation of a cDNA encoding a murine UDPgalactose:beta-D-galactosyl-1, 4-N-acetyl-D-glucosaminide alpha-1, 3-galactosyltransferase: expression cloning by gene transfer. Proc. Natl Acad. Sci. USA, 86, 8227–8231.[Abstract/Free Full Text]

Medin, J.A., Tudor, M., Simovich, R., Quirk, J.M., Jacobsen, S., Murray, G.J., and Brady, R.O. (1996) Correction in trans for Fabry disease: expression, secretion and uptake of alpha-galactosidase A in patient-derived cells driven by a high- titer recombinant retroviral vector. Proc. Natl Acad. Sci. USA, 93, 7917–7922.[Abstract/Free Full Text]

Molloy, S.S., Thomas, L., VanSlyke, J.K., Stenberg, P.E., and Thomas, G. (1994) Intracellular trafficking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface. EMBO J., 13, 18–33.[Web of Science][Medline]

Osman, N., McKenzie, I.F., Ostenreid, K., Ioannou, Y.A., Desnick, R.J., and Sandrin, M.S. (1997) Combined transgenic expression of alpha-galactosidase and alpha1, 2- fucosyltransferase leads to optimal reduction in the major xenoepitope Galalpha(1, 3)Gal. Proc. Natl Acad. Sci. USA, 94, 14677–14682.[Abstract/Free Full Text]

Pawley, J.B. (1995) Handbook of biological confocal microscopy. Plenum, New York.

Reaves, B. and Banting, G. (1992) Perturbation of the morphology of the trans-Golgi network following brefeldin A treatment: redistribution of a TGN-specific integral membrane protein, TGN38. J. Cell Biol., 116, 85–94.[Abstract/Free Full Text]

Roebroek, A.J., Schalken, J.A., Leunissen, J.A., Onnekink, C., Bloemers, H.P., and Van den Ven, W.J. (1986) Evolutionary conserved close linkage of the c-fes/fps proto-oncogene and genetic sequences encoding a receptor-like protein. EMBO J., 5, 2197–2202.[Web of Science][Medline]

Sambrook, J.F. and Maniatis, E.F. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sandrin, M.S. and McKenzie, I.F. (1999) Recent advances in xenotransplantation. Curr. Opin. Immunol., 11, 527–531.[CrossRef][Web of Science][Medline]

Sandrin, M.S., Fodor, W.L., Mouhtouris, E., Osman, N., Cohney, S., Rollins, S.A., Guilmette, E.R., Setter, E., Squinto, S.P., and McKenzie, I.F. (1995) Enzymatic remodelling of the carbohydrate surface of a xenogenic cell substantially reduces human antibody binding and complement-mediated cytolysis. Nat. Med., 1, 1261–1267.[CrossRef][Web of Science][Medline]

Sandrin, M.S., Vaughan, H.A., Dabkowski, P.L., and McKenzie, I.F. (1993) Anti-pig IgM antibodies in human serum react predominantly with Gal(alpha 1-3)Gal epitopes. Proc. Natl Acad. Sci. USA, 90, 11391–11395.[Abstract/Free Full Text]

Schafer, W., Stroh, A., Berghofer, S., Seiler, J., Vey, M., Kruse, M.L., Kern, H.F., Klenk, H.D., and Garten, W. (1995) Two independent targeting signals in the cytoplasmic domain determine trans-Golgi network localization and endosomal trafficking of the proprotein convertase furin. EMBO J., 14, 2424–2435.[Web of Science][Medline]

Schiffmann, R., Murray, G.J., Treco, D., Daniel, P., Sellos-Moura, M., Myers, M., Quirk, J.M., Zirzow, G.C., Borowski, M., Loveday, K., and others. (2000) Infusion of alpha-galactosidase A reduces tissue globotriaosylceramide storage in patients with Fabry disease. Proc. Natl Acad. Sci. USA, 97, 365–370.[Abstract/Free Full Text]

Shapiro, J., Sciaky, N., Lee, J., Bosshart, H., Angeletti, R.H., and Bonifacino, J.S. (1997) Localization of endogenous furin in cultured cell lines. J. Histochem. Cytochem., 45, 3–12.[Abstract/Free Full Text]

Stanley, P., Sudo, T., and Carver, J.P. (1980) Differential involvement of cell surface sialic acid residues in wheat germ agglutinin binding to parental and wheat germ agglutinin-resistant Chinese hamster ovary cells. J. Cell Biol., 85, 60–69.[Abstract/Free Full Text]

Teuchert, M., Schafer, W., Berghofer, S., Hoflack, B., Klenk, H.D., and Garten, W. (1999) Sorting of furin at the trans-Golgi network. Interaction of the cytoplasmic tail sorting signals with AP-1 Golgi-specific assembly proteins. J. Biol. Chem., 274, 8199–8207.[Abstract/Free Full Text]

Vaughan, H.A., Henning, M.M., Purcell, D.F., McKenzie, I.F., and Sandrin, M.S. (1991) The isolation of cDNA clones for CD48. Immunogenetics, 33, 113–117[Web of Science][Medline]

Wigler, M., Sweet, R., Sim, G.K., Wold, B., Pellicer, A., Lacy, E., Maniatis, T., Silverstein, S., and Axel, R. (1979) Transformation of mammalian cells with genes from procaryotes and eucaryotes. Cell, 16, 777–785.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
A. El-Battari, M. Prorok, K. Angata, S. Mathieu, M. Zerfaoui, E. Ong, M. Suzuki, D. Lombardo, and M. Fukuda
Different glycosyltransferases are differentially processed for secretion, dimerization, and autoglycosylation
Glycobiology, December 1, 2003; 13(12): 941 - 953.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, S. G.
Right arrow Articles by Sandrin, M. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?