Glycobiology, 2001, Vol. 11, No. 9 711-717
© 2001 Oxford University Press
Production of soluble human
3-fucosyltransferase (FucT VII) by membrane targeting and in vivo proteolysis
2Department of Medical Chemistry, Vrije Universiteit Amsterdam, Van der Boechorststraat 7, 1081 BT Amsterdam, the Netherlands, and 3Research and Development Group, N.V. Organon, Oss, the Netherlands
Received on January 30, 2001; revised on April 23, 2001; accepted on April 23, 2001.
| Abstract |
|---|
|
|
|---|
The rational design of fucosyltransferase (FucT VII) inhibitors as potential medication in the treatment of rheumatoid arthritis requires the three-dimensional structure of this member of the glycosyltransferase family. Structure determination by X-ray diffraction analysis needs purified, soluble enzyme protein. For this purpose we developed a novel method for the high-yield production of soluble FucT VII by in vivo proteolysis. To obtain a soluble form of FucT VII a mammalian expression construct was made encoding an N-terminal portion of FucT VI (amino acids 163) fused with the stem region and catalytic domain of FucT VII (amino acids 39342). Chinese hamster ovary cells stably transfected with this construct produced FucT activity in the supernatant, which has the same catalytic properties as wild-type FucT VII. This soluble form of FucT VII can be obtained in high amounts (1 mg/L) and can be efficiently purified by GDP-hexanolamine affinity chromatography. In conclusion, it was demonstrated that the intrinsic properties of FucT VII could be transferred to secreted FucT VII constructs, which may open possibilities for production of soluble forms of other members of the glycosyltransferase family as well.
Key words: CHO cells/fucosyltransferase/secretion
| Introduction |
|---|
|
|
|---|
The
3-fucosyltransferases (FucTs) belong to a group of 100 or more membrane-bound glycosyltransferases, mostly located in the Golgi apparatus, that are collectively responsible for the synthesis of the sugar chains of soluble and cell-surface glycoconjugates (Kukuruzinska and Lennon, 1998
4GlcNAc-R
GDP + Galß1
4[Fuc
1
3]GlcNAc-R.
The human FucT family consists of six members, of which the cDNAs have been cloned. Their protein products show a high degree of sequence similarity and have been named FucT III (Kukowska-Latallo et al., 1990
), FucT IV (Goelz et al., 1990
; Lowe et al., 1991
; Kumar et al., 1991
), FucT V (Weston et al., 1992a
), FucT VI (Weston et al., 1992b
; Koszdin and Bowen, 1992
), FucT VII (Sasaki et al., 1994
; Natsuka et al., 1994
), and FucT IX (Kaneko et al., 1999
). Some of these cloned FucTs have been related with enzyme activities detected in human tissues. Based on expression pattern and substrate specificity, FucT VII is the likely candidate responsible for the synthesis of functional selectin ligands on the cell surface of leukocytes (Austrup et al., 1997
). These ligands, which are 3'-sialylated- and/or sulfated-LewisX structures, are essential in the recruitment of leukocytes to the site of an inflammation by mediating adhesion to the vascular endothelium via the endothelial receptors E- and P-selectin. Previously, the relevance of the FucT VII enzyme for migration of T cells to inflammatory sites has been confirmed by targeted mutation ("knock-out") of the FucT VII gene in mice (Maly et al., 1996
).
Because inhibitors specific for FucT VII may have potential as anti-inflammatory drugs, for example in rheumatoid arthritis, where leukocytes extravasate from the circulation to the synovia of the joints leading to cartilage destruction (Cush et al., 1992
), FucT VII is our target molecule for the design of inhibitors. Up to now, no inhibitors specific for any FucT have been described other than guanosine diphosphate (GDP) or derivatives thereof (Murray et al., 1996
). For the rational design of inhibitors the 3D structure of FucT VII will be necessary. One way of obtaining a 3D structure is through X-ray analysis of protein crystals, in which case large quantities of soluble, pure enzyme have to be produced.
Generally, FucTs are membrane-bound and reside on the luminal side of the Golgi vesicles (Paulson and Colley, 1989
). However, soluble forms have been demonstrated in such body fluids as milk, serum, amniotic fluid, seminal plasma, and saliva (Mollicone et al., 1990
; De Vries et al., 1997
and references therein). Production methods for FucT VII have been published, but involve either full-length enzyme (Natsuka et al., 1994
; Britten et al., 1998
) or truncated protein A fusion proteins (Sasaki et al., 1994
; Smithers et al., 1997
). Ideally, for successful crystallization both the transmembrane region and the protein A portion should be absent.
Previous reports have suggested that the expression level of FucT VII is low relative to other FucTs (Britten et al., 1998
and references therein). In contrast, FucT VI has a relatively high expression level. Furthermore, expression of FucT VI in Chinese hamster ovary (CHO) or BHK-21 cells yields a truncated protein, which is efficiently secreted in the medium (Borsig et al., 1998
; Grabenhorst et al., 1998
). Interestingly, Sasaki et al. (1994)
reported that enzymatic activity of a truncated form of FucT VII could only be achieved by incorporating a portion of the FucT VI sequence (amino acids 4054) between the FucT VII catalytic domain (amino acids 39342) and the protein A part. In the present report we utilized those properties of FucT VI to create a soluble form of FucT VII with high specific activity. For this purpose we fused the cytoplasmic, transmembrane, and stem (CTS) regions of FucT VI (amino acids 163) with the catalytic domain of FucT VII (amino acids 39342). CHO cells stably transfected with this construct indeed produced a soluble FucT activity in the supernatant. The enzymatic properties of this enzyme were characterized and compared to the enzymatic properties of cell homogenates of CHO cells stably transfected with full-length, wild-type FucTVII cDNA. Indeed, the characteristics of our soluble enzyme were demonstrated to match those of wild-type FucT VII. This soluble form of FucT VII can be obtained in high amounts and is easy to purify. Furthermore, our procedure yields a concentrated enzyme solution that seems suitable for crystallization studies and might be more generally applicable for other members of the FucT family as well as other glycosyltransferases.
| Results |
|---|
|
|
|---|
Expression and purification of soluble FucT VII
To construct a hybrid FucT VIVII gene, first the coding sequences for both genes have to be cloned. The absence of intronic sequences allowed direct polymerase chain reaction (PCR) amplification of the FucT VI gene. Due to the existence of an intron in the FucT VII gene (Britten et al., 1998
|
|
Optimal reaction conditions
To determine the optimal pH for FucT VII, the activity of the soluble enzyme was measured in six different buffers in the standard activity assay. As is shown in Figure 3 the enzyme was active at a broad pH range. Only at low pH the FucT VII activity was decreased. In contrast, enzyme activity was not affected by higher pH values. Divalent cations were tested for their ability to activate the enzyme (Figure 4). The activity was stimulated by the presence of Mn2+ and Mg2+, and to a lesser extent by Ca2+ and Co2+. Cu2+, Fe2+, and Zn2+ had an inhibitory effect on the activity of FucT VII. Mn2+ enhanced the activity best and was tested at a concentration range of 045 mM. At 15 mM the enhancing effect was optimal. Because FucTs generally are assayed in the presence of 100 mM NaCl, the effect of increasing amounts of NaCl in the reaction mixture was tested. At 250 mM the activity was inhibited by 50% and at concentrations higher than 500 mM the enzyme activity was absent.
|
|
Acceptor substrate specificity of soluble FucT VII
The acceptor substrate specificity of soluble FucT VII toward a variety of type 1 (Galß1
3GlcNAc-R) and type 2 (Galß1
4GlcNAc-R) chain-based oligosaccharide and glycoprotein substrates is shown in Table I. FucT VII preferentially acted on sialylated type 2 chain structures. FucT VII failed to act on any other substrate, only sialylated type 1 was used with poor efficiency. The apparent V and Km values for sialyl-N-acetyllactosamine (sialyl-lacNAc), fetuin, and GDP-fucose are listed in Table II. The affinity for glycoprotein substrates (fetuin) was 10 times higher than for oligosaccharide substrates (sialyl lacNAc), yet the maximum velocities were in the same range. The Km for GDP-fucose was in the same range (69 µM) as the Km from FucTs IIIVI (De Vries et al., 1997
|
|
Inhibition by nucleotides
Measuring the activity in the presence of various nucleotide diphosphates (Figure 5, top), determined the specificity of FucT VII for the nucleotide portion of the donor sugar. FucT VII was only inhibited by GDP, indicating that there is a strict preference for guanosine. The number of phosphate groups seemed less critical because FucT VII was also inhibited by guanosine triphosphate and guanosine monophosphate, but to a lesser extent than by GDP (Figure 5, bottom).
|
Inhibition by NEM
Fucosyltransferases have been classified by their sensitivity to inhibition by N-ethylmaleimide (NEM), a cysteine modifying reagent (Mollicone et al., 1990
| Discussion |
|---|
|
|
|---|
Structural studies on glycosyltransferases require purified, soluble enzyme protein. However, most glycosyltransferases are type II membrane proteins residing in the endoplasmic reticulum and the vesicles of the Golgi apparatus, where they glycosylate newly formed proteins in an ordered manner. Yet some of these enzymes appear in soluble forms in serum and in secretions such as milk, saliva, and other body fluids (Beyer et al., 1981
2,6-sialyltransferase starting at residue 63 (Weinstein et al., 1987
Soluble forms of glycosyltransferases have also been detected in vitro in cell culture supernatants: For instance, glycosyltransferases are secreted from cell lines transfected with cDNA coding for full-length enzymes. Borsig et al. (1998)
demonstrated secretion of recombinant FucT VI from CHO cells. The same group reported the presence of FucT VI in the hepatoma cell line HepG2, which was partially released into the medium by proteolytic cleavage (Borsig et al., 1999
). Grabenhorst and Conradt (1999)
studied the targeting signals in the CTS region of several glycosyltransferases in BHK-21 cells. Apparently, there are at least three different signals contained in the CTS region mediating Golgi retention, targeting to specific functional areas, and susceptibility toward intracellular proteolysis. Previously, the same group (Grabenhorst et al., 1998
) reported that when each of the five FucTs (III to VII) is expressed in BHK-21 cells, FucT III, IV, and VI were proteolytically cleaved and released into the medium in significant amounts, whereas FucT V and VII were found to be largely resistant toward proteolysis. The function of these soluble versions of glycosyltransferases remains unknown. It is questionable whether they can exert a functional role, because the proper nucleotide donor sugars and acceptor substrates are not necessarily present in the same surroundings.
Although at present much effort is being put into resolving the 3D structure of FucT VII by X-ray analysis on protein crystals, studies on large-scale production of soluble FucT VII are limited. So far, all recent studies involve protein A chimeric molecules. Shinoda et al. (1997)
expressed FucT VII as a soluble protein A chimeric form in a human cell line (Namalwa KJM-1), producing 0.6 mg/L. Smithers et al. (1997)
replaced the cytoplasmic and transmembrane domains of FucT VII by a single protein A domain and used the baculovirus system to express the protein to a level of 2 mg/L. To obtain free, or "nonchimeric" FucT VII molecules, it might be possible to release protein A by proteolysis, when a cleavage site is added between the two fusion partners. However, contaminating proteins will have to be removed.
In this study we used the targeting signals in the CTS region of FucT VI for the large-scale production of soluble, recombinant FucT VII. By genetically engineering the CTS region of FucT VI to the catalytic domain of FucT VII, the new chimeric molecule is released into the culture medium. Interestingly, release appeared to be increased when CHO cells were grown under stress circumstances, such as medium depleted from glucose or (fetal calf) serum or at fluctuating temperatures (data not shown). N-terminal sequencing demonstrated that cleavage occurred at the C-terminus of the transmembrane domain (Tyr33 or Val36). This site was identical to the cleavage site found for recombinant, full-length FucT VI, expressed in BHK-21 cells (Grabenhorst and Conradt, 1999
).
The influence of the CTS region of FucT VI on the catalytic activity of FucT VII was tested because the resulting soluble FucT VII molecule still contains amino acids 3363 of FucT VI. Interestingly, this includes amino acids 4054 (of FucT VI), reported by Sasaki et al. (1994)
to be necessary for enzymatic activity of protein A fused, truncated FucT VII. Out of a panel of type 1 and type 2 chaincontaining structures, our chimeric FucT VII enzyme appeared to strictly prefer sialylated type 2 structures as substrate. This is similar to the acceptor specificity of the protein A fused, truncated FucT VII (Shinoda et al., 1997
), full-length FucT VII expressed in insect cells (Britten et al., 1998
), and full-length FucT VII expressed in CHO cells (this study, data not shown). In conclusion, our results demonstrate that the chimeric enzyme has catalytic properties very similar to wild-type FucT VII. A FucT VI acceptor specificity pattern (action on nonsialylated lacNAc) was not introduced by the addition of the FucT VI stem region.
We present here a novel methodology for the high-yield production of soluble FucT VII by in vivo proteolysis. We developed this technique by making use of the relatively higher expression levels of FucT VI and the secretion signals that are contained in the CTS region of FucT VI, thereby adding only 30 amino acids to the FucT VII catalytic domain. The advantage is that no additional proteins or fusion partners (protein A) are required for secretion and solubility, an essential condition for protein crystallography. We anticipate that this production method will be applicable not only for other FucTs but also for nearly all glycosyltransferases.
| Materials and methods |
|---|
|
|
|---|
Materials
Human placental DNA was obtained from Clontech. The mammalian expression vector pNGV1 was constructed as described (EMBL/Genbank, acc. no. X99274). N-terminal sequencing (by Edman degradation) was performed by Eurosequence (Groningen). Unlabeled GDP-fucose was purchased from Boehringer Mannheim. GDP-[14C]Fuc (250 Ci/mol) was purchased from New England Nuclear Corp. (Boston, MA) and diluted with the unlabeled nucleotide sugar to obtain a specific radioactivity of 5 Ci/mol. Calf fetuin was obtained from Gibco. The 8-methoxycarbonyloctyl glycoside acceptors were kindly provided by Dr. Ole Hindsgaul (University of Alberta, Edmonton, Alberta). LacNAc was purchased from Sigma and 3'-sialyl-lacNAc from Oxford GlycoSystems. All other chemicals were obtained from commercial sources and were of the highest purity available.
Oligonucleotides
Oligonucleotides 2026, CCAGAATTCGCCACCATGGATCCCCTGGGCCCG, and 2027, CGCGAATTCCATGCCGGCCTCTCAGGTGAA, were used for amplification of FucT VI. Oligonucleotides 2617, CCAGAATTCGCCACCATGAATAATGCTGGGCACGG, and 2660, CACCCAGCCCTTCCACCCACAC, were used for amplification of FucT VII. Oligonucleotides 2934, CTCGGTACCCTCGAATTCGCACCATGGATCC, and 2935, CTCGGTACCCAGGGGGATGGAGTGGGCGG, were used for amplification of the FucT VI N-terminal fragment.
DNA constructs
U937 cells were washed in phosphate buffered saline (PBS) and the cell pellet was stored at 70°C. Poly(A)+ RNA was prepared from 107 cells using the "quick prep mRNA isolation kit" from Pharmacia. cDNA synthesis was performed on 100 ng of poly(A)+ RNA with 1 µg random hexanucleotides and 100 U Superscript reverse transcriptase (BRL). cDNA corresponding to 10 ng of mRNA was used for PCR. PCR reactions were performed in a final volume of 100 µl containing 250 ng of pooled human placental DNA (FucT VI) or 10 µl of the supernatant of the cDNA synthesis (FucT VII); 40 pmol of each primer; 100 µM dNTPs (Pharmacia); 100 mM TrisHCl, pH 8.8; 25 mM KCl; 1.5 mM MgCl2; 5 µg/ml gelatin; 15% glycerol (FucT VII); and 0.5 µl Taq polymerase (5 U/µl, Perkin Elmer). The reaction mixture was overlaid with mineral oil and subjected to 30 cycles of amplification in a 480 Perkin Elmer thermocycler using the following conditions: 1 min 94°C, 1 min 60°C, 1 min 72°C. The PCR products were digested with 20 U EcoRI for 3 h and analyzed on a 1% agarose gel. Agarose containing the DNA was cut into pieces, and DNA was retrieved using spin columns (Millipore). Two hundred nanograms of FucT fragment was mixed with 100 ng EcoRI digested, alkaline phosphatasetreated pNGV1 and ligated overnight, prior to amplification in the DH5
strain of Escherichia coli. Nucleotide sequencing was performed by the dideoxy chain termination method (Sanger et al., 1977
) to check for PCR-induced mutations. The T7 sequencing kit (Pharmacia), and several sequence-specific synthetic oligonucleotide primers were used. The FucT VI and VII constructs (pNGV1.FTVI, pNGV1.FTVII) appeared to have a sequence identical to the published sequences. These two constructs were used to prepare the soluble form of FucT VII as follows: PNGV1.FTVII was digested with KpnI and BamHI, and a FucT VII fragment of 992 bp was isolated. A second fragment from pNGV1.FTVI was synthesized by PCR using oligonucleotides 2934 and 2935 as described above. 2935 introduced a KpnI site at the 3' site of the fragment. The PCR product was digested with EcoRI and KpnI and isolated. EcoRI/BamHI-digested pNGV1 (7197 bp) was ligated with the 992-bp KpnI/BamHI FucT VII fragment and the 202-bp EcoRI/KpnI FucT VI PCR fragment. After amplification in DH5
, the clones carrying plasmid DNA of correct size and orientation were sequenced and the correct one (pNGV1.FTVII.pepVI) was used for transfection in CHO cells.
Transfection of CHO cells and functional FucT expression
Tissue culture dishes containing 5 x 105 CHO cells were cotransfected as follows. Ten micrograms pNGV1.FTVII.pepVI and 2 µg pGEM.MTIIA DNA (possibility for Cd selection) were dissolved in 0.5 ml transfection buffer (192 mM HEPES, 55 mM glucose, 1.37 M NaCl, 50 mM KCl, 70 mM Na2PO4, pH 7.05) and carefully mixed with 31 µl 2 M CaCl2. After precipitation the DNA was spread over CHO cells and incubated for 15 min. 10 ml M505 (Dulbeccos modified Eagle medium/F12 [Gibco] with L-glutamine, antibiotics, and mercaptoethanol) containing 10% fetal calf serum (FCS) ,was added and the dishes were incubated for 4 h. Glycerol shock was performed by incubating the dishes with 15% glycerol in PBS for 90 s at 37°C. Finally, after washing two times with PBS, the dishes were incubated for 24 h in M505 containing 10% FCS. Subsequently, selection was performed by adding 0.8 mg/ml G418. After selection, neopools were tested for FucT activity and for the expression of sLex by fluorescence-assisted cell sorting analysis. The neopool showing the highest FucT activity was used for single cell cloning.
Cell culture procedures
To obtain large quantities of soluble FucT VII, transfected CHO cells were cultured in 250 ml spinner flasks in M505 containing 5% FCS in the presence of microcarriers (Cultisphere S, 2.5 g/L). Culture medium was replaced by medium with 1% FCS after 2 days, and by serum-free medium supplemented with insulin and transferrin after 5 days. After 7 days FucT containing supernatant was harvested by leaving the cells to settle, decanting the supernatant, and replacing with fresh medium. This way, FucT VII containing supernatant could be harvested for several months and was stored at 4°C until use. Larger production was obtained in a 3.6-L continuous flow fermentor system, which was kept at essentially the same culture conditions as above.
Activity assay of soluble FucT VII
The standard reaction mixture contained in 50 µl: 5 nmol GDP-[14C]Fuc (45 Ci/mol); 2.5 µmol TrisHCl pH 8.0; 0.75 µmol MnCl2; 0.2 µmol ATP; 0.5 mg fetuin (110 nmol acceptor sites calculated from galactose content of the protein); and an amount of enzyme preparation that did not convert more than 10% of the substrate during the assay period. Reactions were incubated for 1 h at 37°C. Incorporation of fucose was determined as described (De Vries et al., 1997
). Values were corrected for incorporation into endogenous acceptors. Three replicates were used per data point. One unit of activity was defined as the amount of enzyme catalyzing the transfer of 1 µmol of fucose min1.
Purification of soluble FucT VII
One liter of CHO culture supernatant was stirred with 1 ml GDP-hexanolamine-Sepharose beads (6 µmol/ml) overnight at 4°C. After adsorption of the FucT to the beads, the beads were allowed to settle, supernatant was decanted, and the enzyme containing beads were collected. The resin was washed with 25 mM cacodylate buffer, pH 6.8; containing 2 M NaCl; 25 % glycerol; and 0.05 % Na-azide. At this stage, the enzyme-on-beads can be stored in 25 mM cacodylate, pH 6.8; 25 % glycerol; 0.05 % Na-azide at 4°C for many months without loss of activity. Elution was performed by head-over-head rotation for 2 h, at RT, in 10 volumes of 25 mM cacodylate, pH 6.8; 0.2 M NaCl; 10 mM GDP; 1 mM MnCl2; 15 % glycerol; and 0.05 % Na-azide. The supernatant was collected by centrifugation (5', 1500 r.p.m.) and stored at 4°C, or concentrated on centricon cartridges (Amicon) to a desired protein concentration.
| Acknowledgments |
|---|
|
|
|---|
We thank Antoon van Doornmalen, Han Kok, and Wim Koot for cell and fermentor cultures, and Dr. Ole Hindsgaul for providing us with the 8-methoxycarbonyloctyl glycoside acceptors. This research was supported by the Technology Foundation STW, applied science division of NWO, and the technology program of the Ministry of Economic Affairs (Grant #349-4211).
| Abbreviations |
|---|
|
|
|---|
BSA, bovine serum albumin; CHO, Chinese hamster ovary; CTS, cytoplasmic, transmembrane, and stem; FCS, fetal calf serum; FucT, fucosyltransferase; GalT, galactosyltransferase; GDP, guanosine diphosphate; lacNAc, N-acetyllactosamine; NEM, N-ethylmaleimide; PBS, phosphate buffered saline; PCR, polymerase chain reaction; RT, reverse transcription; SDSPAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis.
| Footnotes |
|---|
1 To whom correspondence should be addressed
| References |
|---|
|
|
|---|
Austrup, F., Vestweber, D., Borges, E., Lohning, M., Brauer, R., Herz, U., Renz, H., Hallmann, R., Scheffold, A., Radbruch, A., and Hamann, A. (1997) P- and E-selectin mediate recruitment of T-helper-1 but not T-helper-2 cells into inflammed tissues. Nature, 385, 8183.[Medline]
Beyer, T.A., Sadler, J.E., Rearick, J.I., Paulson, J.C., and Hill, R.L. (1981) Glycosyltransferases and their use in assessing oligosaccharide structure and structure-function relationships. Adv. Enzymol., 52, 23175.
Borsig, L., Katopodis, A.G., Bowen, B.R., and Berger, E.G. (1998) Trafficking and localization studies of recombinant
1, 3-fucosyltransferase VI stably expressed in CHO cells. Glycobiology, 8, 259268.
Borsig, L., Imbach, T., Hochli, M., and Berger, E.G. (1999)
1, 3 fucosyltransferase VI is expressed in HepG2 cells and codistributed with ß1, 4 galactosyltransferase I in the Golgi apparatus and monensin-induced swollen vesicles. Glycobiology, 9, 12731280.
Bradford, M. (1976) A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248254.[ISI][Medline]
Brinkman-Van der Linden, E.C.M., Mollicone, R., Oriol, R., Larson, G., Van den Eijnden, D.H., and Van Dijk, W. (1996) A missense mutation in the FUT6 gene results in total absence of
3-fucosylation of human
1-acid glycoprotein. J. Biol. Chem., 271, 1449214495.
Britten, C.J., van den Eijnden, D.H., McDowell, W., Kelly, V.A., Witham, S.J., Edbrooke, M.R., Bird, M.I., de Vries, T., and Smithers, N. (1998) Acceptor specificity of the human leukocyte
3-fucosyltransferase: role of FucT VII in the generation of selectin ligands. Glycobiology, 8, 321327.
Cush, J.J., Pietschmann, P., Oppenheimer-Marks, N., and Lipsky, P.E. (1992) The intrinsic migratory capacity of memory T cells contributes to their accumulation in rheumatoid synovium. Arthritis Rheum., 35, 14341444.
DAgostaro, G., Bendiak, B., and Tropak, M. (1989) Cloning of cDNA encoding the membrane-bound form of bovine ß4-galactosyltransferase. Eur. J. Biochem., 183, 211217.[ISI][Medline]
De Vries, T., Palcic, M.P., Schoenmakers, P.S. van den Eijnden, D.H., and Joziasse, D.H. (1997) Acceptor specificity of GDP-Fuc: Galß1-4GlcNAc-R
3-fucosyltransferase VI (FucT VI) expressed in insect cells as soluble, secreted enzyme. Glycobiology, 7, 921927.
Goelz, S.E., Hession, C., Goff, D., Giffiths, B., Tizard, R., Newman, B., Chi-Rosso, G., and Lobb, R. (1990) ELFT: a gene that directs the expression of an ELAM-1 ligand. Cell, 63, 13491356.[ISI][Medline]
Grabenhorst, E. and Conradt, H.S. (1999) The cytoplasmic, transmembrane, and stem regions of glycosyltransferases specify their in vivo functional sublocalization and stability in the golgi. J. Biol. Chem., 274, 3610736116.
Grabenhorst, E., Nimtz, M., Costa, J., and Conradt, H.S. (1998) In vivo specificity of human
1, 3/4-fucosyltransferases IIIVII in the biosynthesis of LewisX and Sialyl LewisX motifs on complex-type N-glycans. Coexpression studies from BHK-21 cells together with human ß-trace protein. J. Biol. Chem., 273, 3098530994.
Holmes, E.H., Xu, Z., Sherwood, A.L., and Macher, B.A. (1995) Structure-function analysis of human
1
3fucosyltransferases. A GDP-fucose-protected, N-ethylmaleimide-sensitive site in FucT-III and FucT-V corresponds to Ser178 in FucT-IV. J. Biol. Chem., 270, 81458151.
Kaneko, M., Kudo, T., Iwasaki, H., Ikehara, Y., Nishihara, S., Nakagawa, S., Sasaki, K., Shiina, T., Inoko, H., Saitou, N., and Narimatsu, H. (1999)
3-Fucosyltransferase IX (Fuc-TIX) is very highly conserved between human and mouse; molecular cloning, characterization and tissue distribution of human Fuc-TIX. FEBS Lett., 452, 237242.[ISI][Medline]
Koszdin, K.L. and Bowen, B.R. (1992) The cloning and expression of a human
1, 3fucosyltransferase capable of forming the E-selectin ligand. Biochem. Biophys. Res. Commun., 187, 152157.[ISI][Medline]
Kukowska-Latallo, J.F., Larsen, R.D., Nair, R.P., and Lowe, J.B. (1990) A cloned human cDNA determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group
(1
3/4)FT. Genes Dev., 4, 12881303.
Kukuruzinska, M.A. and Lennon, K. (1998) Protein N-glycosylation: molecular genetics and functional significance. Crit. Rev. Oral. Biol. Med., 9, 415448.
Kumar, R., Potvin, B., Muller, W.A., and Stanley, P. (1991) Cloning of a human
3-fucosyltransferase gene that encodes ELFT but does not confer ELAM-1 recognition on Chinese hamster ovary cell transfectants. J. Biol. Chem., 266, 2177721783.
Lammers, G. and Jamieson, J.C. (1989) Studies on the effect of lysosomotropic agents on the release of Gal ß1-4GlcNAc
-2, 6-sialytransferase from rat liver slices during the acute-phase response. Biochem. J., 261, 389393.[ISI][Medline]
Lowe, J.B., Kukowska-Latallo, J.F., Nair, R.P., Larsen, R.D., Marks, R.M., Macher, B.A., Kelly, R.J., and Ernst, L.K. (1991) Molecular cloning of a human fucosyltransferase gene that determines expression of the LewisX and VIM-2 epitopes but not ELAM-1 dependent cell adhesion. J. Biol. Chem., 266, 1746717477.
Maly, P., Thall, A., Petryniak, B., Rogers, C.E., Smith, P.L., Marks, R.M., Kelly, R.J., Gersten, K.M., Cheng, G., Saunders, T.L., and others (1996) The
(1, 3)fucosyltransferase Fuc-TVII controls leukocyte trafficking through an essential role in L-, E-, and P-selectin ligand biosynthesis. Cell, 86, 643653.[ISI][Medline]
Mitsakos, A. and Hanisch, F.G. (1989) One-step purification of an
(1, 3) fucosyltransferase from human amniotic fluid by fetuin-agarose affinity chromatography. Biol. Chem. Hoppe Seyler, 370, 239243.
Mollicone, R., Gibaud, A., Francois, A., Ratcliffe, M., amd Oriol, R. (1990) Acceptor specificity and tissue distribution of three human
3-fucosyltransferases. Eur. J. Biochem., 191, 169176.[ISI][Medline]
Murray, B.W., Takayama, S., Schultz, J., and Wong, C.H. (1996) Mechanism and specificity of human
1, 3-fucosyltransferase V. Biochemistry, 35, 1118311195.[Medline]
Natsuka, S., Gersten, K.M., Zenita, K., Kannagi, R., and Lowe, J.B. (1994) Molecular cloning of a cDNA encoding a novel human leukocyte
3-fucosyltransferase capable of synthesizing the sialyl LewisX determinant. J. Biol. Chem., 269, 1678916794.
Paulson, J.C. and Colley, K.J. (1989) Glycosyltransferases. Structure, localization, and control of cell type-specific glycosylation. J. Biol. Chem., 264, 1761517618.
Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 54635467.
Sarnesto, A., Kohlin, T., Hindsgaul, O., Vogele, K., Blaszczyk-Thurin, M., and Thurin, J. (1992) Purification of the ß-N-acetylglucosaminide
1, 3-fucosyltransferase from human serum. J. Biol. Chem., 267, 27452752.
Sasaki, K., Kurata, K., Funayama, K., Nagata, M., Watanabe, E., Ohta, S., Hanai, N., and Nishi, T. (1994) Expression cloning of a novel
1, 3-fucosyltransferase that is involved in biosynthesis of the sialyl LewisX carbohydrate determinants in leukocytes. J. Biol. Chem., 269, 1473014737.
Shinoda, K., Morishita, Y., Sasaki, K., Matsuda, Y., Takahashi, I., and Nishi, T. (1997) Enzymatic characterization of human
1, 3-fucosyltransferase FucT VII synthesized in a B cell lymphoma cell line. J. Biol. Chem., 272, 3199231997.
Smithers, N., Britten, C.J., Witham, S.J., Kelly, V.A.M., and Edbrooke, M.R. (1997) Recombinant expression of a secreted form of human
(1, 3) fucosyltransferase VII. Biochem. Soc. Trans, 25, 426S.[Medline]
Weinstein, J., Lee, E.U., McEntee, K., Lai, P.H., and Paulson, J.C. (1987) Primary structure of ß-galactoside
2, 6-sialyltransferase. Conversion of membrane-bound enzyme to soluble forms by cleavage of the NH2-terminal signal anchor. J. Biol. Chem., 262, 1773517743.
Weston, B.W., Nair, R.P., Larsen, R.D., and Lowe, J.B. (1992a) Isolation of a novel human
(1, 3)fucosyltransferase gene and molecular comparison to the human Lewis blood group
(1, 3/1, 4)fucosyltransferase gene. Syntenic, homologous, nonallelic genes encoding enzymes with distinct substrate specificities. J. Biol. Chem., 267, 41524160.
Weston, B.W., Smith, P.L., Kelly, R.J., and Lowe, J.B. (1992b) Molecular cloning of a fourth member of a human
(1, 3)fucosyltransferase gene family. Multiple homologous sequences that determine expression of the LewisX, sialyl LewisX, and difucosyl sialyl LewisX epitopes. J. Biol. Chem., 267, 2457524584.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
B. Ma, G. F. Audette, S. Lin, M. M. Palcic, B. Hazes, and D. E. Taylor Purification, Kinetic Characterization, and Mapping of the Minimal Catalytic Domain and the Key Polar Groups of Helicobacter pylori {alpha}-(1,3/1,4)-Fucosyltransferases J. Biol. Chem., March 10, 2006; 281(10): 6385 - 6394. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rabbani, V. Miksa, B. Wipf, and B. Ernst Molecular cloning and functional expression of a novel Helicobacter pylori {alpha}-1,4 fucosyltransferase Glycobiology, November 1, 2005; 15(11): 1076 - 1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. El-Battari, M. Prorok, K. Angata, S. Mathieu, M. Zerfaoui, E. Ong, M. Suzuki, D. Lombardo, and M. Fukuda Different glycosyltransferases are differentially processed for secretion, dimerization, and autoglycosylation Glycobiology, December 1, 2003; 13(12): 941 - 953. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







