Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cao, Y.
Right arrow Articles by Schwartz-Albiez, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, Y.
Right arrow Articles by Schwartz-Albiez, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2001, Vol. 11, No. 8 677-683
© 2001 Oxford University Press

The fucosylated histo-blood group antigens H type 2 (blood group O, CD173) and Lewis Y (CD174) are expressed on CD34+ hematopoietic progenitors but absent on mature lymphocytes

Yi Cao2, Anette Merling2, Uwe Karsten3 and Reinhard Schwartz-Albiez1,2

2Division of Cellular Immunology, German Cancer Research Centre, Im Neuenheimer Feld 280, 69120 Heidelberg, Germany, and 3Max Delbrück Centre for Molecular Medicine, 13125 Berlin-Buch, Germany

Received on January 16, 2001; revised on February 21, 2001; accepted on February 22, 2001.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The expression of LeY, H2, H3, and H4 on a broad variety of human leukemia cell lines and native lymphocytes as well as on CD34+ hematopoietic progenitor cells was examined by flow cytometry and immunocytochemistry. CD34+ leukemia cell lines (KG1, KG1a, and TF1) and native CD34+ hematopoietic progenitor cells expressed H2 (CD173) and LeY (CD174). In contrast, CD34 cell lines (HL-60, U937, JOK-1, Raji, Molt-3, Jurkat, and CEM-C7) and mature lymphocytes from peripheral blood and tonsils lacked CD173 and CD174. All cell lines and native lymphocytes as well as CD34+ precursor cells were negative for H3 and H4. Immunoprecipitation and consecutive Western blotting revealed a 170-kDa glycoprotein as the carrier molecule for the CD173 and CD174 oligosaccharide sequences on CD34+ hematopoietic precursors. The key enzyme for generating CD173 is the ß-D-galactoside 2-{alpha}-L-fucosyltransferase (FUT1). As shown by RT-PCR, FUT1 was expressed in immature hematopoietic cells but absent in mature lymphocytes, which indicates that expression of CD173 within the hematopoietic system is regulated at the transcriptional level by FUT1. Due to their exclusive presence on CD34+ hematopoietic progenitor cells, CD173 and CD174 represent novel markers of early hematopoiesis. The expression of the fucosylated histo-blood group antigens CD173 and CD174 in CD34+ hematopoietic progenitor cells and down-regulation of FUT1 in mature lymphocytes may be important factors influencing the homing process of hematopoietic stem cells to the bone marrow.

Key words: fucosylated glycan/histo-blood group antigens/H type 2/Lewis Y/hematopoietic progenitor cells/leukemia/CD173/CD174


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Fucose is an important terminal residue occurring on oligosaccharide chains of cell surface–expressed glycoconjugates. Fucosylated glycans are involved in cell–cell and cell–matrix interactions, differentiation, proliferation, and apoptosis (Varki, 1993Go). In hematopoietic cells, these glycans play an important role in the recirculation of lymphocytes from the bloodstream into lymphatic organs (Stoolman and Rosen, 1983Go; Gallatin et al., 1983Go) and in permitting adhesive contacts between hematopoietic progenitor cells and bone marrow stromal cells (Schmitz et al., 1996Go; Le Marer and Skacel, 1999Go). The expression of some fucosylated antigens such as LeX (CD15, Galß1-4[Fuc-{alpha}1-3]GlcNAc-) and sialosyl-LeX (CD15s, NeuAc{alpha}2-3Gal-ß1-4[Fuc{alpha}1-3]GlcNAc-) on hematopoietic cells has been studied (Terstappen et al., 1990Go; Kannagi, 1997Go). However, a systematic and comprehensive analysis of the fucosylated histo-blood group antigens LewisY (LeY, CD174 [Histo-blood group antigens H2 and LeY were assigned as CD173 and CD174, respectively, during the Seventh Workshop and Conference on Human Leucocyte Differentiation Antigens in Harrogate in June 2000; Schwartz-Albiez, 2001Go. In this study we use the new designations for these oligosaccharide structures. For new CD designations please refer to http://gryphon.jr2.ox.ac.uk/.], Fuc{alpha}1-2Galß1-4(Fuc{alpha}1-3)GlcNAcß1-), H2 (CD173, Fuc{alpha}1-2Gal-ß1-4GlcNAcß-), H3 (Fuc{alpha}1-2Gal-ß1-3GalNAc-), and H4 (Fuc{alpha}1-2Galß1-3GlcNAcß1-3Gal-{alpha}1-4Galß1-4Glc-) with regard to their expression on human hematopoietic cells has not yet been done. We have now examined the expression of LeY (CD174), H2 (CD173), H3, and H4 on a broad variety of human leukemia cell lines, isolated lymphocytes from tonsils and peripheral blood, and CD34+ hematopoietic precursors derived from peripheral blood. CD34+ leukemia cell lines such as KG1, KG1a (immature myeloid cell lines), TF1 (immature erythroblastoid cell line), and native CD34+ hematopoietic precursor cells were found to express the CD173 and CD174 antigens. Furthermore, possible carrier molecules of CD173 and CD174 in CD34+ hematopoietic progenitor cells were analyzed. Because the expression of the CD173 antigen is regulated by the ß-D-galactoside 2-{alpha}-L-fucosyltransferase gene (FUT1), we also tested the presence of FUT1 mRNA by reverse transcription polymerase chain reaction (RT-PCR) in lymphocytes of early and late stages of hematopoietic development.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
We observed that CD34+ hematopoietic cell lines such as KG1, KG1a, and TF1 expressed the CD173 and CD174 antigens as demonstrated by flow cytometric analysis and immunohistological staining (Figures 1 and 2, Table I). Consequently, native CD34+ hematopoietic precursor cells enriched from peripheral blood were analyzed for the expression of CD173 and CD174. CD34+ cells from peripheral blood as used here represented an advanced stage of hematopoietic precursor cells comparable to the colony forming unit–granulocyte-erythrocyte-macrophage megacaryocyte stage because over 95% of the CD34+ cells also expressed the CD38 antigen as shown by dual color analysis in flow cytometry. Moreover, 79% of the CD34+ cells were also positive for CD33, a marker for the myeloid-monocytic lineage (data not shown). Over 90% of CD34+ cells expressed the CD173 and CD174 antigens with varying intensity (Figure 1A). In more detail, as determined by three-color flow cytometry, the CD34+/CD38+ subset was positive for CD173 and CD174 to 96%, whereas the CD34+/CD33+ subset was positive for both CD173 and CD174 to 77% (Figure 1B). Therefore, due to their almost identical expression pattern on CD34+ precursor cells, both carbohydrate structures seem to be simultaneously up-regulated during hematopoesis and are present on CD34+ hematopoietic precursor cells committed to the myeloid lineage.




View larger version (60K):
[in this window]
[in a new window]
 
Fig. 1. (A, B) Multicolor flow cytometric analysis of H2 and LeY on CD34+ hematopoietic precursor cells from human peripheral blood. Cells were stained with mAbs specific for H2 (A46-B/B10, IgM) and LeY (A70-C/C8, IgM) followed by incubation with anti-mouse IgM (µ-chain) conjugated to FITC (fluorescence 1), anti-CD34 (IgG) conjugated to PE (fluorescence 2) or Cy5 (fluorescence 3), anti-CD33 (IgG), or anti-CD38 (IgG) conjugated to PE (fluorescence 2). For three-color cytometry anti-CD34 conjugated to Cy5 (fluorescence 3) was used. For (B), CD34+ cells were gated and presented for their expression of CD33, CD38, and anti-H2 and anti-LeY.

 


View larger version (122K):
[in this window]
[in a new window]
 
Fig. 2. Immunocytochemical results demonstrating that CD34+ leukemia cell line KG1 (A and B) expresses CD173 (A, A46-B/B10) and CD174 (B, A70-C/C8) predominantly at the cellular surface, but in some cells also in the cytoplasma; native CD34+ hematopoietic precursor cells (C and D) express CD173 (D, A46-B/B10) and CD174 (D, A70-C/C8) at the cellular surface.

 

View this table:
[in this window]
[in a new window]
 
Table I. Flow-cytometric and immunocytochemical analysis of H2 (CD173) and LeY (CD174) expression on various hematopoietic cells
 
Some CD34 cell lines, namely, K562 (pre-erythroblastic cell line) and Nalm6 (pre–B cell line), were weakly positive for CD173 and CD174. In contrast, CD34 myeloid cell lines HL-60 and U937; B-cell lines JOK-1, Raji, and U266; T-cell lines Molt-3, Jurkat, and CEM-C7; and isolated normal lymphocytes from tonsils and peripheral blood did not express CD173 and CD174. The results of immunocytochemistry and flow cytometry are summarized in Table I.

CD173 and CD174 are located at the cellular surface as demonstrated by flow cytometry and immunohistological staining (Figures 1, 2). Immunohistology of KG1 and native CD34+ precursor cells with CD173- and CD174-specific monoclonal antibodies (mAbs) resulted in a very strong staining of single cells, which was in contrast to the flow cytometry results where all CD34+ cells were found to be positive to varying degrees. It may be that the acetone fixation and staining procedure for immunohistology results in loss of surface-expressed antigens in contrast to the staining of fresh cells for flow cytometry.

All cell lines and native lymphocytes were negative for H3 and H4. Also, cryostat sections of tonsils were negative for CD173, CD174, H3, and H4 (data not shown).

Staining of KG1 and CD34+ hematopoietic precursor cells with anti-CD173 and anti-CD174 was not abolished after methanol extraction, indicating that CD173 and CD174 are not components of glycosphingolipids.

Immunoprecipitation with CD173- and CD174-specific mAbs and consecutive Western blotting of biotinylated proteins precipitated from the CD34+ cell line KG1 and from native CD34+ hematopoietic precursor cells resulted in a strongly stained band of approximately 170 kDa (Figure 3). Therefore it seems that both oligosaccharide structures are expressed on the same glycoprotein.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. Immunoprecipitation with anti-H2 (CD173) and anti-LeY (CD174) mAbs and consecutive Western blotting of precipitated biotinylated proteins of native CD34+ hematopoietic precursor cells resulting in a strongly stained band of approximately 170 kDa. As positive control an anti–major histocompatibility complex class I (W6/32) was used, resulting in a 46-kDa stained band.

 
Because FUT1 has been implicated with the synthesis of H histo-blood group antigens (Larsen et al., 1990Go), we followed its transcription in CD34+ and CD34hematopoetic cells by RT-PCR. We used three different primer pairs (Figure 4): primers 1 and 2 (#2) span an 890-bp region within exon 4 encoding the FUT1 protein (Larsen et al., 1990Go; Koda et al., 1997Go), primers 3 and 2 (#3) represent a transcript starting at exon 1, and primers 4 and 2 (#4) yield in a transcript starting at exon 2. Exon 1 had been identified as start site in epithelial cells, whereas the start site at exon 2 was identified in the erythroid cell line HEL and bone marrow cells (Koda et al., 1997Go). As depicted in Figure 5 the CD34+ erythroblastoid cell line TF1 revealed transcripts of #2 and #4, whereas the mature B cell line JOK-1 was deficient in any FUT1-specific transcript. Our results corroborate earlier findings that within hematopoiesis only cells of bone marrow differentiation stages express FUT1 and that only the start site at exon 2 but not the one at start site 1 is used.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 4. The structure of genomic DNA of the FUT1 according to Koda et al. (1997). The protein coding region is indicated by the hatched box in exon 4. The approximate annealing sites for the primers applied for RT-PCR amplification are indicated (primer 1 [p1] and primer 2 [p2] for the FUT1 encoding region in exon 4; primer 3 [p3] and primer 2 [p2] from 5'-exon 1 to exon 4; primer 4 [p4] and primer 2 [p2] from 5'-exon 2 to exon 4).

 


View larger version (64K):
[in this window]
[in a new window]
 
Fig. 5. RT-PCR analysis of FUT1 mRNA expression and the FUT1 starting exon in the CD34+ erythroblastoid cell line TF1 and in the mature B cell line JOK-1. Total RNA was subjected to RT-PCR using FUT1-specific primers (#2: primer 1 and 2) and a set of each starting exon-specific primer (#3, primer 3 and 2 for FUT1 5'-exon 1; #4: primer 4 and 2 for FUT1 5'-exon 2). TF1 expressed transcripts of #2 and #4, JOK-1 was deficient of any FUT1-specific transcript. Human ß-actin was used as internal control.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The ABH and Lewis blood group antigens are fucosylated glycan structures. A, B, and H antigens are oligosaccharides based on the type 1 (Galß1-3GlcNAcß-), type 2 (Galß1-4GlcNAcß-), type 3 (Galß1-3GalNAc-), or type 4 (Galß1-3GlcNAcß1-3Gal-{alpha}1-4Galß1-4Glc-) core structures (Lowe and Marth, 1999Go). Each of these precursor structures can be transformed into an H antigen by the addition of Fuc in {alpha}1,2-linkage to the terminal Gal by {alpha}(1,2)-fucosyltransferase. H antigen is the precursor of A and B antigens. The expression of ABH antigens is not confined to erythrocytes, as they are also present on the cell surfaces of endothelial and some epithelial cells and in body fluids or secretions. Type 2 and type 4 H antigens are expressed on red cells and vascular endothelium, and type 1 and type 3 H antigens are found in glycoconjugates of epithelial tissues of the gut, lungs, and submaxillary gland.

The Lewis system is structurally related to the ABH system. These structures are formed by {alpha}1-3,4 fucosyltransferases adding fucose to GlcNAc in the type 1 and 2 chain precursors. Lewis antigens are detectable on red cells and some epithelia. Lewis X (LeX, Galß1-4[Fuc{alpha}1-3]GlcNAc-) and Lewis Y (LeY, Fuc{alpha}1-2Galß1-4(Fuc{alpha}1-3)GlcNAcß1-) were originally detected and characterized on epithelial cells or in body fluids and secretions (Lloyd et al., 1966Go). They were first termed "X-antigen" and "Y-antigen." Because these terms invited confusion with the antigens associated with X and Y chromosomes, and because the X and Y structures were closely related to Lewis (Le) antigens, the terms LeX and LeY were adopted (Nudelman et al., 1986Go).

The expression of LeX and sialosyl-LeX on hematopoietic cells has been studied in more detail, and both antigens have been included into the CD marker series (CD15 and CD15s). The monofucosylated H2 (CD173) and LeX (CD15) as well as the difucosylated LeY (CD174) are structurally related and they have the type 2 precursor chains (Galß1-4GlcNAc-) in common. CD173 is synthesized through a fucose added on type 2 precursor chains by the {alpha}1-2 fucosyltransferases encoded by the H gene (FUT1). The difucosylated CD174 results from the epistatic interaction, on type 2 precursor chains, of the products of the {alpha}1-2 fucosyltransferases encoded by the H gene, and the {alpha}1-3 fucosyltransferases encoded by a LeX gene (Oriol et al., 1992Go). Ulex europaeus lectin I and many mAbs cross-react with both structures H2 (CD 173) and LeY (CD174) (Hindsgaul et al., 1982Go; Imberty et al., 1996Go; Mollicone et al., 1996Go).

In this study we observed that CD34+ leukemia cell lines (KG1, KG1a, and TF1) and native CD34+ hematopoietic precursor cells expressed H2 (CD173) and LeY (CD174). In contrast, CD34 HL60 and U937 cell lines representing early myelomonocytic stages were negative, and cell line K562 representing pre-erythroid cells and the pre–B cell line Nalm-6 were only weakly positive for both antigens. Cell lines JOK-1, Raji, Molt-3, Jurkat, and CEM-C7 (equivalent to mature B- and T-cell stages) and mature resting lymphocytes of peripheral blood and in vivo activated tonsillar lymphocytes lacked CD173 and CD174. A previous work has indicated that a mAb against H2/LeY does not react with myeloid or lymphoid cell lines, platelets, macrophages, or lymphocytes (Koch et al., 1994Go). In summary, it seems that CD173 and CD174 are simultaneously expressed during early hematopoietic multilineage differentiation and are lost concomitantly with the decline of the CD34 antigen within mature hematopoietic cells of myeloid and lymphoid lineage. Due to their exclusive presence on CD34+ progenitor cells within hematopoiesis, CD173 and CD174 are new markers of early hematopoietic differentiation stages. It is interesting to note that H2 (CD173) was found to be a marker of stem cell–like cells in the breast (Karsten et al., 1993Go) and the expression of LeY (CD174) shows negative correlation with the differentiation degree of the embryonal carcinoma cells (Blaineau et al., 1983Go).

All cell lines and native lymphocytes as well as CD34+ hematopoietic precursors were negative for H3 and H4. We have noticed that mAbs with overlapping reactivities against CD173 and CD174 (A51-B/A6 and Bric 231) showed stronger reactions than mono-specific mAbs against CD173 (A46-B/B10, A63-D/B12, and BE2) or CD174 (A70-C/C8) in all positive cell lines. A possible explanation is that the density or cluster of the antigens affect binding. K562, which was negative for mono-specific mAbs against CD173 (A46-B/B10, A63-D/B12, and BE2) and CD174 (A70-C/C8), reacted with A51-B/A6 and Bric 231. Because A51-B/A6 recognizes the disaccharide Fuc{alpha}1-2Galß1- only (Christensen, Karsten, Goletz, unpublished data), the most likely explanation is that K562 carries type 1 antigens. Unlike another fucosylated structure, LeX (CD15), which first appears on promyelocytes and remains well expressed thereafter (Terstappen et al., 1990Go), CD173 and CD174 are strongly expressed in promyeloid CD34+ hematopoietic progenitor cells but are absent in more mature hematopoietic cells of myeloid and lymphoid lineage. The carrier molecule of CD173 and CD174 in the CD34+ leukemia cell line KG1 and native CD34+ hematopoietic progenitor cells is a glycoprotein of approximately 170 kDa. It remains to be clarified whether this is a de novo expressed glycoprotein at these differentiation stages or whether a glycoprotein expressed at a longer time span during hematopoiesis is differentially glycosylated during early stages. The differential expression of FUT1 during hematopoiesis may speak in favor of the latter possibility. We found that FUT1 mRNA was detected in CD173+ TF1 but not in CD173 JOK-1, and exon 2 but not exon 1 was used as a transcription start site in TF1 as described earlier for HEL (erythroleukemia) and normal bone marrow cells (Koda et al., 1997Go). This indicates that the presence of CD173/CD174 in immature hematopoietic cells is regulated by FUT1. From our immunoprecipitation data it seems unlikely that CD34 itself is a carrier molecule for CD173/CD174.

Because fucose is involved in the adhesion of hematopoietic progenitor cells and bone marrow stromal cells (Konno et al., 1990Go; Kamenov and Longenecker, 1990Go; Gabius et al., 1994Go; Schmitz et al., 1996Go), the expression of the fucosylated histo-blood group antigens CD173 and CD174 in CD34+ hematopoietic stem cells and their absence in mature lymphocytes may play a functional role in the homing process of hematopoietic stem cells to the bone marrow. Thus, the differential regulation of cell surface sialylation and fucosylation during myeloid maturation may mutually govern the trafficking of CD34+ hematopoietic progenitor cells from and to the bone marrow (Le Marer and Skacel, 1999Go).


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Monoclonal antibodies
This study was performed with a panel of well-characterized mAbs. Several of the mouse mAbs employed were generated by one of us (Karsten), and their specificity determined with over 60 synthetic, polyacrylamide-coupled oligosaccharides (Syntesome, Munich/Moscow) (Christensen, Karsten, Goletz, unpublished data). These are:

• A70-C/C8 (IgM, {kappa}), specific for the LeY tetrasaccharide (CD174)

• A51-B/A6 (IgA, {kappa}), specific for the disaccharide Fuc{alpha}1-2Galß1-, which is part of both LeY and H2

• A63-D/B12 (IgM, {kappa}), specific for the trisaccharide Fuc{alpha}1-2Gal-ß1-4GlcNAcß1- (H2, CD173), but to some extent cross-reacting with the tetrasaccharide, LeY, of which it is the terminal part

• A46-B/B10 (IgM, {kappa}), specific for the trisaccharide Fuc{alpha}1-2Gal-ß1-4GlcNAcß- (H2, CD173, Karsten et al., 1988Go), but to some extent cross-reacting with the tetrasaccharide, LeY, of which it is the terminal part.

In addition, the following mabs were used:

• BE2, specific for the H2 trisaccharide (CD173, gift of Dr. H. Clausen, Copenhagen, Denmark) (Young et al., 1981Go)

• HH14, specific for the H3/H4 (Jeppe-Jensen et al., 1993Go, gift of Dr. H. Clausen)

• Bric 231, specific for H2/LeY (CD173/CD174, provided by Dr. F. Spring, International Blood Group Reference Laboratory, Bristol, UK)

• CD34, coupled to PE or Cy5 (Immunotech, Marseille, France)

• CD38, coupled to PE (Immunotech)

• CD33, coupled to PE (Pharmingen, Hamburg, Germany)

Cell lines and cell culture
A broad variety of human leukemia cell lines, including pro-myeloid cell leukemia (KG1 and KG1a), pro-erythroblastic cell leukemia (TF1), pre-erythroblastic cell leukemia (K562), pro-monocyte leukemia (U937), pre–B cell leukemia (Nalm-6), B cell leukemia (JOK-1), Burkitt-lymphoma (Raji), plasmocytoma (U266), and T-cell leukemia (Molt-3, Jurkat, and CEM-C7), were used in this study. All cell lines except TF1 were maintained in RPMI 1640 medium (Sigma) supplemented with 5% fetal calf serum. TF1 was cultured in RPMI 1640 medium with 10% fetal calf serum and 10 ng/ml interleukin 3.

CD34+ hematopoietic precursor cells from human peripheral blood were selected from leukapheresis products by incubation with anti-CD34 mAb 9C5 (Baxter, Irvine, CA), followed by incubation with sheep anti-mouse IgG1 (Fc) ST-coated paramagnetic beads (Dynabeads M450, Dynal, Oslo), and separated by using a magnetic cell separation system (Baxter Isolex 300 SA, Baxter) as described in detail by Hohaus et al. (1997)Go. After this purification the cells obtained consisted to over 95% of CD34+ cells. Normal peripheral blood lymphocytes were prepared from heparinized blood of healthy donors by Ficoll density gradient centrifugation. Tonsillar lymphocytes were isolated from minced tonsils by centrifugation on Ficoll-Hypaque (Amersham Pharmacia Biotech AB, Uppsala, Sweden) after depleting monocytes with leucine methylester (Sigma, St. Louis, MO) as described elsewhere (Schwartz-Albiez et al., 1990Go). The study was conducted under the guidelines of the local ethical committee. Biopsies were taken after patients’ informed consent.

For immunocytochemistry, target cells were grown on sterile adhesion microscope slides for 1 day. At that time the medium was carefully aspirated, and the slides were air-dried. Wrapped slides could be stored at –80°C until use.

Immunocytochemistry
Cells were fixed with cold (–20°C) acetone for 20 min. Then the slides were treated with 3% H2O2 in phosphate buffered saline (PBS) for 30 min to block endogenous peroxidase and incubated with normal goat serum for 30 min at room temperature to reduce nonspecific binding. After washing with PBS, the slides were incubated with mAbs at appropriate dilutions for 1 h at room temperature. The thoroughly washed slides were treated with peroxidase-labeled goat anti-mouse immunoglobulin antiserum (Dako, Copenhagen, Denmark) for 30 min at room temperature. Color development during incubation with the peroxidase substrate (diaminobenzidine) was controlled under a microscope. Counterstaining was performed with hematoxylin. Negative controls were incubated with a comparable dilution of an isotype control (IgM or IgG) of irrelevant specificity (Sigma) instead of the mAb. In some experiments, the possible glycolipid nature of carrier molecules was tested. To this end slides were fixed with 4% formalin for 5 min and immersed in methanol for 30 min at room temperature. Then the immunostaining was done as described above.

Cryostat sections of tonsils were fixed with cold (–20°C) acetone for 20 min and stained immunohistologically with the same mAbs as described above.

Flow cytometry
Culture cells were stained at densities of 106 cell per 100 µl at 4°C for 15 min. Cells were first incubated with the appropriate primary mAb, followed by goat anti-mouse IgG and IgM (Fab)2 conjugated to fluorescein isothiocyanate (FITC) (Dianova, Hamburg, Germany). After each incubation the cells were washed twice with PBS containing 1% bovine serum albumin. Controls (mAb W6/32 for positive control and mAb HD20 for negative control) were treated in the same way. Cells were analyzed for immunofluorescence on a FACScan flow cytometer (Becton Dickinson, Mountain View, CA), collecting data for 10,000 cells for each histogram. Dead cells were excluded by staining with VIA-PROBE (Pharmingen, San Diego, USA).

With native CD34+ hematopoietic precursor cells, multicolour immunofluorescence analysis was done as previously described (Vater et al., 1997Go). The primary antibodies (A46-B/B10 and A70-C/C8) and the second antibody, anti-mouse IgM (µ-chain) conjugated to FITC (Dianova), were used at fluorescence 1 (green fluorescence), the primary antibodies (anti-CD34, anti-CD33, anti-CD38, all of IgG isotype) conjugated to PE at fluorescence 2 (orange fluorescence). In some experiments for three-color analysis anti-CD34 conjugated to Cy5 (red fluorescence) was additionally applied.

Immunoprecipitation
Biotinylation of surface proteins of KG1 cells and native CD34+ hematopoietic precursor cells was performed using sulfosuccinimidobiotin (Pierce, Rockford, USA) as described (Meier et al., 1992Go). Biotinylated surface proteins were immunoprecipitated using anti-CD173 (A46-B/B10) and anti-CD 174 (A70-C/C8) and Protein A Sepharose coupled with rabbit anti-mouse immunoglobulin antiserum. Precipitated biotinylated proteins were subsequently separated by polyacrylamide gel electrophoresis using 8% acrylamide gels and detected by peroxidase-conjugated streptavidin in Western blotting.

RT-PCR analysis
Total cytoplasmic RNA was isolated from cell lines TF1 and JOK-1 using the High Pure RNA Isolation Kit (Boehringer Mannheim, Mannheim, Germany). Synthesis of single-strand cDNA was performed on total RNA (2 µg) using the SUPERSCRIPT system (Life Technologies, Karlsruhe, Germany) according to the manufacturer’s instructions. The resultant single-strand cDNA (20 µl) was used as the template for PCR. The following primers were used for the amplification of the FUT1 gene and the starting exons of the FUT1 as indicated in Figure 4 (Koda et al., 1997Go): primer 1 (5'-FUT1 TGCCATGCATGCCGCCCTGGCCCCG) and primer 2 (3'-FUT1 GGGCACCCATTTGCTTCAGGAACAC) for FUT1 (#2); primer 3 (5'-Ex1 GAAAGTCCCTGACTGGAGTTGGCAG) and primer 2 for 5'-exon 1 (#3); primer 4 (5'-Ex 2 ACTACCGGTCTCTGCGTCTTGATG) and primer 2 for 5'-exon 2 (#4). The amplification protocol of FUT1 was as follows: denaturing at 94°C for 20 s, annealing at 65°C for 1 min, extension at 72°C for 1 min, and 30 cycles. The temperature profile of the exon-specific RT-PCR was as follows: denaturing at 98°C for 10 s, annealing at 68°C for 1 min, extension at 72°C for 2 min, and 30 cycles. The products were analyzed by 1.0% agarose gel electrophoresis and stained with ethidium bromide. The positive control was performed using human ß-actin-specific primers for parallel RT-PCR amplifications. The product is a fragment of about 200 bp.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
This study was supported by a grant from the Tumorzentrum Heidelberg/Mannheim to R.S.-A.

We thank Drs. H. Clausen (Copenhagen) and F. Spring (Bristol) for providing monoclonal antibodies.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
FUT1, ß-D-galactoside 2-{alpha}-L-fucosyltransferase (accession number: M35531); FITC, fluorescein isothiocyanate; H2, blood group antigen H type 2; H3, blood group antigen H type 3; H4, blood group antigen H type 4; LeX, Lewis blood group antigen X; LeY, Lewis blood group antigen Y; mAb, monoclonal antibody; PBS, phosphate buffered saline; RT-PCR, reverse transcription-polymerase chain reaction.


    Footnotes
 
1 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Blaineau, C., Le Pendu, J., Arnaud, D., Connan, F., and Avner, P. (1983) The glycosidic antigen recognised by a novel monoclonal antibody, 75.12, is developmentally regulated on mouse embryonal carcinoma cells. EMBO J., 2, 2217–2222.[Web of Science][Medline]

Gabius, S., Wawotzny, R., Martin, U., Wilholm, S., and Gabius, H.J. (1994) Carbohydrate-dependent binding of human myeloid leukemia cell lines to neoglycoenzymes, matrix-immobilized neoglycoproteins, and bone marrow stromal cell layers. Ann. Hematol., 68, 125–132.[Web of Science][Medline]

Gallatin, W.M., Weissman, I.L., and Butcher, E.C. (1983) A cell-surface molecule involved in organ-specific homing of lymphocytes. Nature, 304, 30–34.[Medline]

Hindsgaul, O., Norberg, T., LePendu, J., and Lemieux, R.U. (1982) Synthesis of type 2 human blood-group antigenic determinants. The H, X, and Y haptens and variations of the H type 2 determinant as probes for the combining site of the lectin I of Ulex europeus. Carbohydr. Res., 109, 109–142.[Web of Science][Medline]

Hohaus, S., Pförsich, M., Murea, S., Abdallah, A., Lin, Y.-S., Funk, L., Voso, M.T., Kaul, S., Schmid, H., Wallwiener, D., and Haas, R. (1997) Immunomagnetic selection of CD34+ peripheral blood stem cells for autografting in patients with breast cancer. Br. J. Haematol., 97, 881–888.[Web of Science][Medline]

Imberty, A., Mollicone, R., Mikros E., Carrupt, P.A., Perez, S., and Oriol, R. (1996) How do antibodies and lectins recognize histo-blood group antigens? A 3D-QSAR study by comparative molecular field analysis (CoMFA). Bioorg. Med. Chem., 11, 1979–1988.

Jeppe-Jensen, D., Clausen, H., Leigh, I.M., Lane, E.B., and Dabelsteen, E. (1993) Three monoclonal antibodies differentiate human from murine epidermis. Epithelial Cell Biol., 2, 100–106.[Web of Science][Medline]

Kamenov, B., and Longenecker, B.M. (1990) Significance of acute leukemia-bone marrow stromal cells adherence and its molecular nature. Period. Biol., 92, 94–95.

Kannagi, R. (1997) CD15s workshop panel report. In Kishimoto, T., Kikutani, H., von dem Borne, A.E.G.Kr., Goyert, S.M., Mason, D.Y., Miyasaka, M., Moretta, L., Okumura, K., Shaw, S., Springer, T.A., and others, eds., Leucocyte Typing VI. White Cell Differentiation Antigens. Garland Publishing, New York, pp. 352–355.

Karsten, U., Pilgrim, G., Hanisch, F-G., Uhlenbruck, G., Kasper, M., Stosiek, P., Papsdorf, G., and Pasternak, G. (1988) A new monoclonal antibody (A46-B/B10) highly specific for the blood group H type 2 epitope: generation, epitope analysis, serological and histological evaluation. Br. J. Cancer, 58, 176–181.[Web of Science][Medline]

Karsten, U., Papsdorf, G., Pauly, A., Vojtesek, B., Moll, R., Lane, E.B., Clausen, H., Stosiek, P., and Kasper, S. (1993) Subtypes of non-transformed human mammary epithelial cells cultured in vitro: Histo-blood group antigen H type 2 defines basal cell-derived cells. Differentiation, 54, 55–66.[Web of Science][Medline]

Koch, A.E., Nickoloff, B.J., Holgersson, J., Seed, B., Haines, G.K., Burrows, J.C., and Leibovich, S.J. (1994) 4A11, a monoclonal antibody recognizing a novel antigen expressed on aberrant vascular endothelium: upregulation in an in vivo model of contact dermatitis. Am. J. Pathol., 144, 244–259.[Abstract]

Koda, Y., Soejima, M., and Kimura, H. (1997) Structure and expression of H-type GDP-L-fucose:ß-D-galactoside 2-{alpha}-L-fucosyltransferase Gene (FUT1). Two transcription start stites and alternative splicing generate several forms fo FUT1 mRNA. J. Biol. Chem., 272, 7501–7505.[Abstract/Free Full Text]

Konno, M., Hardy, C., and Tavassoli, M. (1990) Interaction of late murine erythroid progenitors and stroma involves a recognition mechanism with fucosyl specificity. Exp. Hematol., 18, 185–189.[Web of Science][Medline]

Larsen, R.D., Ernst, L.K., Nair, R.P., and Lowe, J.B. (1990) Molecular cloning, sequence, and expression of a human GDP-L-fucose: ß-D-galactoside 2-{alpha}-L-fucosyltransferase cDNA that can form the H blood group antigen. Proc. Natl Acad. Sci. USA, 87, 6674–6678.[Abstract/Free Full Text]

Le Marer, N., and Skacel, P.O. (1999) Up-regulation of {alpha}2, 6 sialylation during myeloid maturation: a potential role in myeloid cell release from the bone marrow. J. Cell Physiol., 179, 315–324.[Web of Science][Medline]

Lloyd, K.O., Kabat, E.A., Layug, E.J., and Gruezo, F. (1966) Immunochemical studies on blood groups: XXXIV. Structures of some oligosaccharides produced by alkaline degradation of blood group A, B, and H substances. Biochemistry, 5, 1489–1501.[Medline]

Lowe, J.B., and Marth, J.D. (1999) Structures common to different types of glycans. In Varki, A., Cummings, R., Esko, J., Freeze, H., Hart, G., and Marth, J., eds., Essentials of Glycobiology. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp. 211–252.

Meier, T., Arni, S., Malarkannan, S., Poincelet, M., and Hoessli, D. (1992) Immunodetection of biotinylated lymphocyte-surface proteins by enhanced chemiluminescence: A nonradioactive method for cell-surface protein analysis. Anal. Biochem., 204, 220–226.[Web of Science][Medline]

Mollicone, R., Cailleau, A., Imberty, A., Gane, R., Peren, S., and Oriol, R. (1996) Recognition of the blood group H type 2 trisaccharide epitope by 28 monoclonal antibodies and their lectins. Glycoconj. J., 13, 263–271.[Web of Science][Medline]

Nudelman, E.D., Levery, S.B., Kaizu, T., and Hakomori, S. (1986) Novel fucolipids of human adenocarcinoma: Characterization of the major LeY antigen of human adenocarcinoma as trifucosylnonaosyl LeY glycolipid (III3FucV3FucVI3FucnLc6). J. Biol. Chem., 261, 11247–11253.[Abstract/Free Full Text]

Oriol, R., Mollicone, R., Coullin, P., Dalix, A., and Candelier J-J. (1992) Genetic regulation of the expression of ABH and Lewis antigens in tissues. APMIS Suppl., 100, 28–38.

Schmitz, B., Thiele, J., Otto, F., Theile-Ochel, S., Heedt, T., Zensen, U., Baldus, S.E., Wickenhauser, C., and Fischer, R. (1996) Interactions between endogeneous lectins and fucosylated oligosaccharides in megakaryocyte-dependent fibroblast growth of the normal bone marrow. Leukemia, 10, 1604–1614.[Web of Science][Medline]

Schwartz-Albiez, R. (2001) Section report: Carbohydrate and lectin section. In Mason, D., and others, eds., Leucocyte Typing VII, White Cell Differentiation Antigens. Oxford University Press, Oxford, in press.

Schwartz-Albiez, R., Dörken, B., Möller, P., Brodin, N.T., Monner, D.A., and Kniep, B. (1990) Neutral glycosphingolipids of the globo-series characterize activation stages corresponding to germinal center B cells. Int. Immunol., 2, 929–936.[Abstract/Free Full Text]

Stoolman, L.M., and Rosen, S.D. (1983) Possible role for cell-surface carbohydrate-binding molecules in lymphocyte recirculation. J. Cell Biol., 96, 722–729.[Abstract/Free Full Text]

Terstappen, L., Safford, M., and Loken, M. (1990) Flow cytometric analysis of human bone marrow III. Neutrophil maturation. Leukemia, 4, 657–663.[Web of Science][Medline]

Varki, A. (1993) Biological roles of oligosaccharides: all of the theories are correct. Glycobiology, 3, 97–130.[Abstract/Free Full Text]

Vater, M., Kniep, B., Groß, H.-J., Claus, C., Dippold, W., and Schwartz-Albiez, R. (1997) The 9-O-acetylated disialosyl carbohydrate sequence of CDw60 is a marker on activated human B lymphocytes. Immunol. Lett., 59, 151–157.[Web of Science][Medline]

Young, W.W., Portoukalian, J., and Hakomori, S. (1981) Two monoclonal anticarbohydrate antibodies directed to glycosphingolipids with a lacto-N-glycosyl type II chain. J. Biol. Chem., 256, 10967–10972.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
J. C Manimala, T. A Roach, Z. Li, and J. C Gildersleeve
High-throughput carbohydrate microarray profiling of 27 antibodies demonstrates widespread specificity problems
Glycobiology, August 1, 2007; 17(8): 17C - 23C.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. A. Westwood, M. J. Smyth, M. W. L. Teng, M. Moeller, J. A. Trapani, A. M. Scott, F. E. Smyth, G. A. Cartwright, B. E. Power, D. Honemann, et al.
Adoptive transfer of T cells modified with a humanized chimeric receptor gene inhibits growth of Lewis-Y-expressing tumors in mice
PNAS, December 27, 2005; 102(52): 19051 - 19056.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Fritzsching, B. Schwer, J. Kartenbeck, A. Pedal, V. Horejsi, and M. Ott
Release and Intercellular Transfer of Cell Surface CD81 Via Microparticles
J. Immunol., November 15, 2002; 169(10): 5531 - 5537.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cao, Y.
Right arrow Articles by Schwartz-Albiez, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, Y.
Right arrow Articles by Schwartz-Albiez, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?