Glycobiology, 2001, Vol. 11, No. 8 645-653
© 2001 Oxford University Press
1,3 galactosyltransferase: new sequences and characterization of conserved cysteine residues
3ORSP, Department of Chemistry and Biochemistry, San Francisco State University, 1600 Holloway Ave., San Francisco, CA 94132, USA, and 4Department of Chemistry, Wayne State University, Detroit, MI, USA
Received on December 29, 2000; revised on March 15, 2001; accepted on March 20, 2001.
| Abstract |
|---|
|
|
|---|
Nucleotide sequences were determined for
1,3 galactosyltransferases (
1,3 GalTs) from several species (bat, mink, dog, sheep, and dolphin) and compared with those previously determined for this enzyme and members of the
1,3 galactosyl/N-acetylgalactosyltransferase (
1,3 Gal(NAc)Ts) family of enzymes. Sequence comparison of the newly characterized
1,3 GalT nucleotide and predicted amino acid sequences with those previously characterized for other
1,3GalT enzymes demonstrated a remarkable level of sequence identity at the nucleotide and amino acid level. The identity of each sequence as an
1,3 GalT was confirmed by expressing the encoded protein and characterizing the resulting enzyme.
The
1,3 GalTs have a significant degree of sequence homology with A and B transferases, the
1,3 GalNAcT that catalyzes the synthesis of Forssman antigen, and the recently cloned iso-globotriaosylceramide synthase. Among the conserved residues, there are two Cys residues. To determine if these conserved residues are free or involved in the formation of a disulfide bond, bovine
1,3 GalT was characterized by chemical modification and mass spectrometry. Each peptide containing a Cys residue was chemically labeled with an alkylating reagent demonstrating that these enzymes do not contain disulfide bonds. Similar results have recently been reported for A and B transferases (Yen et al., 2000
, J. Mass. Spectrom., 35, 9901002). Thus, the highly conserved Cys residues found in these members of the
1,3 Gal(NAc)Ts family of enzymes are likely involved in other important aspects of enzyme structure/function within this enzyme family.
Key words:
-galactosyltransferase/cysteine residues/amino acid sequence/disulfide bonds
| Introduction |
|---|
|
|
|---|
1,3 galactosyl/N-acetylgalactosyltransferase (
1,3 Gal(NAc)Ts) are a family of enzymes that catalyze the synthesis of a range of blood group antigens from different acceptor substrates and either uridine diphosphate (UDP)-Gal or UDP-GalNAc. Two members of this family, the A and B transferases, utilize H-type acceptors, and UDP-GalNAc or UDP-Gal to produce the A and B human blood group antigens, respectively. These enzymes have highly conserved predicted amino acid sequences, differing at only four of their amino acid residues (Yamamoto and Hakomori, 1990
1,3 galactosyltransferase (
1,3 GalT) that is not expressed in human tissues utilizes the N-acetyllactosamine (LacNAc) acceptor substrate and UDP-Gal to produce the alpha Gal epitope that is a critical barrier in xenotransplantation.
1,3 GalTs share a significant level of sequence homology with the A and B transferases, especially in the C-terminal region of their catalytic domains. In contrast to the A, B, and
1,3 GalTs, the Forssman synthetase does not utilize type 1 or 2 substrates, but rather the glycosphingolipid globotetraosylceramide and UDP-GalNAc to produce Forssman antigen (Haslam and Baenziger, 1996
1,3 GalTs. Finally, Keusch et al. (2000)
1,3 Gal(NAc)Ts family of proteins. Thus, this family has members with significant sequence homology, but distinct acceptor substrate specificity and different species expression patterns.
Predicted amino acid sequences for A and B transferases have been determined for human and primate forms of the enzymes. Nucleotide sequences have been determined for pseudogenes of the
1,3 GalT in the human and Old World monkey genome (Joziasse et al., 1989
; Galili, 1988
), and the predicted amino acid sequences have been determined for the active enzyme in New World monkeys, pig, mouse, and cow. A predicted amino acid sequence for the Forssman synthetase has been determined for the enzyme expressed in dog (Haslam and Baenziger, 1996
), and for the iGb3Cer synthase from rat (Keusch et al., 2000
). Each of the active forms of the enzymes has a type II membrane protein domain structure, and, in the case of the
1,3 GalT enzyme from mouse and a New World primate, the catalytic domain has been mapped (Henion et al., 1994
).
Structure/function studies of the A and B transferases have provided some useful information on the importance of a limited number of amino acids residues in terms of substrate specificity and kinetic properties (Yamamoto and Hakomori, 1990
; Yamamoto and McNeill, 1996
; Seto et al., 1997
, 1999). However, little else is known regarding the function of the amino acids of each enzyme. We have taken two approaches to gain further insights into these enzymes. Coding sequences for the
1,3 GalT present in a range of animal species (bat, mink, dog, sheep, and dolphin) were determined and compared with those previously reported. These studies demonstrated that there is a remarkable level of sequence conservation, including the conservation of all three predicted Cys residues. Labeling with an iodoacetimide derivative and analysis of proteolytically generated peptides by mass spectrometry (MS), demonstrated that these Cys residues are not conserved because they are involved in important disulfide bonds, since no disulfide bonded Cys residues were found. These results are compared to those for other characterized glycosyltransferases.
| Results and discussion |
|---|
|
|
|---|
Nucleotide sequences of
1,3 GalT from various animal speciescDNAs were prepared (see "Materials and methods") from the total mRNA of cell lines derived from animal species that we (Gastinel et al., 2001
1,3 GalT activity. In one case (bat), a sequence representing the full-length coding sequence was obtained, whereas shorter nucleotide sequences (representing the catalytic domain) were obtained for the other species (not shown). Comparison of these sequences with those of previously reported
1,3 Gal(NAc)T sequences demonstrated that the new sequences were most closely related to coding sequences for
1,3 GalTs (not shown). The new sequences have an especially high degree of sequence identity (
90%) in the 3' region (beginning around nucleotide base #320 of the full-length sequence). This comparison also illustrates some interesting patterns in the nucleotide sequences. For example, cow and sheep are missing a nine-nucleotide base sequence present in all of the other sequences (see next section).
Predicted amino acid sequences
The predicted amino acids sequences of the new
1,3 Gal(NAc)Ts are highly homologous to those reported for
1,3 GalTs from mouse, bovine, pig, and New World Monkeys. For example, the predicted amino acid sequence for the full-length, bat cell line protein (Figure 1) has remarkable identity (Table I) with the sequences from the other known
1,3 GalTs. A comparison of the predicted amino acids sequences of the other proteins with known
1,3 GalT activity demonstrates that there is a remarkable degree of sequence identity for all species, ranging from 73% for mouse to 86% for marmoset.
|
|
Enzyme activity and western blot analyses
The sequences obtained by polymerase chain reaction (PCR) were inserted into expression vectors and the plasmids transfected into COS cells. Cells transfected with plasmids containing predicted full-length coding sequences were assayed after cell lysis, whereas soluble proteins were obtained from COS cell medium when plasmids containing sequences predicted to code for the catalytic domain were transfected. In the latter case, the predicted catalytic domain sequences were fused to a signal sequence and the IgG binding domain of protein A. The secreted proteins were purified by binding them to IgG-agarose beads, then they were assayed for enzyme activity.
Each protein or cell extract was tested for enzyme activity with a type 2 (Table II) and an H type 2 (not shown) acceptor to determine substrate specificity. None of the proteins had activity with the H type 2 acceptor, whereas each catalyzed the transfer of Gal to the type 2 acceptor (Table II). This result is consistent with the expectation that the sequences obtained encode
1,3 GalTs and not B transferases.
|
Western blot analyses (not shown) of the protein A fusion products demonstrated that a protein of approximately 60 kDa was obtained for each construct. Each band was broad, suggesting that the proteins are glycosylated, which is consistent with the results previously obtained for
1,3 GalTs from mouse and marmoset constructed in the same manner (i.e., protein A fusion proteins) and expressed in COS cells (Henion et al., 1994
Sequence comparison
In addition to the full-length bat sequence (Figure 1), we obtained two new sequences (sheep and dolphin) starting at the equivalent of amino acid 23 and two new sequences (dog and mink) starting at the equivalent of amino acid 38 in the marmoset sequence (Figures 2 and 3). The cytoplasmic and transmembrane region of the bat sequence has a very high level of sequence homology when compared to other
1,3 GalTs. Full-length sequences for the other species were not amplified with the primers used to obtain that for bat and, therefore, may vary to a greater degree from the other species. However, sequences containing amino acids representing the catalytic domain were obtained for each and are compared with the sequences of other
1,3 GalTs.
|
|
Alignment of these sequences (Figures 23) shows that the section containing amino acids from 23 (or 38) through approximately the first 100 amino acid residues (92 for bat to 101 for marmoset) has an overall sequence identity of about 5065% (Figure 1), whereas the sequence that follows from approximately 100 to the C-terminus has an overall sequence identity of about 90% (except mouse with an 80% idenitity) with no deletions (Figure 2).
The segment containing amino acids 23100 has areas of high sequence homology interspersed with short sections of very low sequence homology (Figure 2). Within this segment, the marmoset and mouse sequences have a short, four-amino-acid (GRXX) sequence near the middle that is missing in the
1,3 GalTs from others species. Some of the species (i.e., bat, mink and dog) are missing additional amino acids in this area. Interestingly, this area is characterized by a concentration of charged amino acids (E, D, K, Q, and R). Some of the sequences have additional deletions. For example, cow and sheep are missing a tripeptide segment (THX) found in all other sequences, a sequence that occurs just before the charge amino acid residue area. This segment also contains a region of aromatic amino acids (residues 5258) WWFxxWF, and four conserved Pro (28, 41, 55, 99 in the marmoset sequence).
The remaining amino acid sequence (from approximately amino acid 100 to the C-terminus) is highly conserved among the
1,3 GalTs, with a few amino acids residues spread throughout that are not conserved (Figure 3). As shown in Table I, the percent identity in this region ranges from 80% to 92% for mouse to mink compared with the marmoset sequence.
When this portion of the GalT sequence is compared to that for the A transferase, one finds areas in which there are intervals with four or five conserved residues (Figure 2). Longer segments of sequence homology can be identified when conservative substitutions are allowed. Beginning at the residue labeled 221 (equivalent to amino acid 322 in the marmoset sequence), there is a long stretch (22/27 residues) of identical residues between the
1,3 GalT and A transferase sequence, whereas the remainder of the sequence (i.e., from amino acid labeled 247 to the C-terminus) contains few matches.
As shown in Figure 3, the
1,3 GalT sequences all contain three conserved Cys residues. Two of these conserved Cys residues are also found in the A transferase sequence (B transferase and Forssman synthetase also contain these conserved Cys residues, not shown). The first of the conserved Cys residues occurs near the sequence DVD, a sequence (DXD) that has been found to occur in numerous glycosyltransferases and was shown to lie in the UDP-Gal binding site of ß1,4GalT (Gastinel et al., 1999
and references therein). There are very few other conserved amino acid residue clusters (EVD and GVE) between the
1,3 GalTs and A transferase sequence in this region. The second conserved Cys residue is found 75 amino acids away (residue 306 in the marmoset sequence) and is one of the few conserved residues in this region. This Cys residue is also conserved in B transferase and Forssman synthetase (not shown). The other Cys residue that is found in all of the
1,3 GalT sequences is not conserved in A transferase, although it lies in the area with the highest sequence homology between the GalTs and A transferase (B transferase and Forssman sythetase both contain a Leu residue at this location). Interestingly, the recently cloned iGb3 synthase contains all three of the Cys residues conserved among the
1,3 GalTs (Keusch et al., 2000
). The presence of these highly conserved Cys residues suggests that they may have a significant function in these transferases. One possibility is that the residues that are conserved among the
1,3 GalTs, Forssman sythetase, and the A and B transferases are involved in the formation of disulfide bonds. To evaluate whether two of the three conserved Cys residues in the GalT sequences are involved in a disulfide linkage, a recombinant, truncated form of bovine
1,3 GalT expressed in Escherichia coli was analyzed for disulfide bonds. In addition, the amino acid sequence of this protein was evaluated. This form of the enzyme has been shown to be the most active form of
1,3 GalT characterized to date (Galili and Swanson , 1991
).
Verification of amino acid sequence by MS
The peptide sequence of purified (see Materials and methods) bovine
1,3 GalT was analyzed using liquid chromatographyelectrospray ionizationtandem mass spectrometry (LC/ESI-MS/MS), which involves chromatographically resolving digested peptides by capillary-LC and detecting and selecting peptide ions produced by ESI/MS. Subsequently each selected peptide ion is fragmented by collisionally induced dissociation and analyzed by MS/MS. The sequence of each peptide is verified by the fragments generated by cleavage at the amide bond along the backbone of the peptide in which the charge is retained on the N-terminus (b-type ions) or the C-terminus (y-type ions). Using the MS/MS spectrum in conjunction with the database searching program Sequest, the amino acid sequence of each peptide is identified by correlating the observed fragmentation pattern from the MS/MS spectrum with a predicted fragmentation pattern in the protein database. With a combination of two proteolytic enzymes, trypsin and chymotrypsin, more than 97.6% of amino acid sequence of bovine
1,3 GalT (amino acids 80368) was confirmed (results summarized in Figure 4). The remaining 2.4% represented mainly small molecular weight (e.g., dipeptides) peptides generated by proteolytic digestion that were eluted in the void volume and thus undetected. Although the
1,3 GalT sequence contains an N-linked consensus sequence, the peptide containing this consensus sequence was identified as the unmodified peptide. This is consistent with the fact that the protein was expressed in E. coli, an organism that lacks the machinery for N-linked glycosylation.
|
Identification of free Cys residues and disulfide bonds
1,3 GalTs have a total of three Cys residues (see Figure 3). Potentially free Cys residues were modified with a biotinylated form of iodoacetamide, whereas those involved in disulfide bonds were reduced with dithiothreitol (DTT) and alkylated with iodoacetimide. Peptide were generated with trypsin or chymotrypsin, separated by high-performance LC (HPLC), and characterized by ESI-MS/MS analysis. All three Cys-containing peptides were found to be labeled with the biotin-alkylating reagent. Figure 5 shows the reconstructed ion chromatograms of three biotin labeled, Cys-containing, tryptic peptides (amino acids 332350, 263300, and 203233) with observed ions at m/z 1309.0 (the doubly charged ion), 1552.1 (the triply charged ion), and 1353.3 (the triply charged ion), respectively. Figure 6 shows a representative full scan mass spectrum from the peptide (amino acids 332350) containing Cys338 modified by the biotinylated alkylating reagent, with the most intense ion observed at m/z 1308.5. The inset zoom scan mass spectrum clearly shows that this corresponds to a doubly charged (M+2H)2+ ion with a mono-isotopic peak at m/z 1308.1. This corresponds to a molecular ion (M+H)+ with a mass of 2615.2, matching the calculated value of the (M+H)+ ion of m/z 2615.3. The MS/MS spectrum of the precursor ion at m/z 1308.5 (shown in Figure 7) provides sufficient information to unequivocally confirm the sequence of the peptide containing the biotinylated Cys338. Each fragment (y13, and bn, N = 813) that contains the biotinylated Cys338 residue has a mass that is increased by 382.2 Da (mass of biotin) compared to the mass expected for the unmodified peptide. To further confirm whether the Cys residues are involved in disulfide bonds, a fraction of tryptic or chymotryptic digest of
1,3 GalT was reduced with DTT and alkylated with iodoacetamide followed by the LC/ESI-MS/MS analysis. No carbamidomethylated Cys containing peptides for tryptic or chymotryptic peptides were detected from biotin-treated
1,3 GalT (data not shown), demonstrating that all three Cys residues were modified with biotin. These results demonstrate that all three Cys are free and are not involved in disulfide bonds. In a recent study of the three-dimensional structure the bovine
1,3 GalT expressed in E. coli, all of the Cys residues in the catalytic domain were identified as free Cys residues (Gastinel et al., 2001
|
|
|
We (Yen et al., 2000
1,3 GalT, the A and B tranferases contained only free Cys residues. It is currently unknown whether the Forssman and iGb3 synthetases contain free Cys residues or disulfides, but one can predict that these proteins will also contain only free Cys residues given the results obtained for
1,3 GalT and the A and B transferases. The functional importance of these highly conserved Cys residues may be forthcoming from an evaluation of the crystal structure and will likely require further evaluation by site-directed mutagenesis. | Materials and methods |
|---|
|
|
|---|
Materials
Cell lines (Gastinel et al., 2001
1,3 GalTwas expressed in E. coli BL21(DE3) cells using the bacterial vector pET15b as previously described (Galili and Swanson , 1991
RNA isolation
Cells lines were grown to confluency, trypsinized, washed with phosphate buffered saline, and pelleted by centrifugation. Total RNA was obtained from the cells by resuspending the cell pellet in 0.2 ml RNAzol/1 x 106 cells, extracting with 0.1 ml chloroform/ml of solution, and precipitating with isopropanol. First strand synthesis was carried out using the GeneAmp RNA PCR Kit obtained from Perkin Elmer (Norwalk, CT) in the following reaction mixture: 5 mM MgCl2, 1x buffer II, 1 mM of each dNTP, 1 U RNase inhibitor, 2.5 U reverse transcriptase, and either 2.5 µM random hexamers (dog and sheep) or oligo dTs (bat, mink, and dolphin) in a total volume of 20 µl. Reaction conditions were as follows: 42°C for 15 min, 99°C for 5 min, and 5°C for 5 min. Second strand synthesis was carried out in the following reaction mixture: 2 mM MgCl2, 1x buffer II, 2.5 U Taq polymerase, and upper and lower primer at 150 µM. Reactions conditions were as follows: initial heat step of 95°C for 2 min, 35 cycles of 95°C for 1 min, 53°C for 1 min, 72°C for 3 min, and a final step of 60°C for 7 min.
Second strand primers.
PCR primers were designed using one or more of the nucleotide base sequences of the
1,3 GalT sequences from cow, marmoset, mouse, and pig.
Upstream primers.
EcoUp: GGG GAA TTC GAT GAA TGT CAA AGG AAG AGT- (corresponding to beginning of
1,3 GalT sequence)
R1: GGG GAA TTC GAA AAA CCC AGA AGT TGG C- (starting at nucleotide 130 of pig
1,3 GalT sequence with an EcoR1 site)
XbaTm: GGG TCT AGA GGA ATA TAT CAA CAG CCC AG- (based on a portion of the mouse
1,3 GalT sequence just after the transmembrane region and containing an Xba I site)
XbaUp: CCG TCT AGA GTC AAA AAA CCC AGA AGT TG- (starting at the same site as R1, but based on a consensus of the four
1,3 GalT sequences and containing an Xba I site)
Downstream primers.
Ecolo: GGG GAA TTC AGT CAG ATG TTA TTT CTA ACC- (containing an EcoRI site)
Kpnlo: GGC GGT ACC TCA GAT GTT ATT TCT AAC CA- (containing a Kpn I site)
The following primer combinations were used to obtain cDNAs from each species: dog, XbaUp/Kpnlo; bat, EcoUp/Ecolo (full length), XbaTm/Kpnlo (truncated); sheep, XbaTm/Kpnlo; mink, Xbaup/Kpnlo; and dolphin, XbaUp/Kpnlo. PCR products were gel purified (Qiaex DNA gel extraction kit) and ligated into pcDNA 3.1 (full length) or pPROTA at a 5:1 insert to vector molar ratio as previously described (Henion et al., 1994
). The resulting plasmids were transformed into JM109. Both strands of each insert were sequenced (San Diego State University sequencing facility) using the primers listed below. The average read length was approximately 400 bases, with an average overlap of 100 bases. Two to six clones were sequenced for each species.
Sequencing primers.
GAL-XBA-UP, CCGTCTAGAGTCAAAAAACCCAGAAGTTG
GAL-KPN-LO, GGCGGTACCTCAGATGTTATTTCTAACCA
GAL-XBA-TM, GGGTCTAGAGGAATATATCAACAGCCCAG
GAL-UP1-SEQ, GCTTCAGCTATGGGACTGG
GAL-UP2-SEQ, CAAGTCTGAGAAGAGGTGGC
GAL-LO1-SEQ, CCACTCGGCTTCTATGTC
GAL-LO2-SEQ, CCTGATCCACGTCCATGCAG
GAL-LO3-SEQ, CCTCCAAGTAATGCTCAAT
GAL-UP3-SEQ, CCACGCAGCCATTTTTGG
PROTA-FOR, CATTTACCTAACTTAACTG
PROTA-REV, CATCTCTGAGCAGCGGGG
Purification of the bacterial expressed
1,3 GalT
All purification steps were carried out at 4°C. All buffers contained 50 mM morpholinopane sulphonic acid (MOPS), pH 7.0, 1 mM DTT (buffer A). The other buffers contained in addition: buffer B, 0.5 M NaCl; buffer C, 5 mM MnCl2, 0.5 M NaCl; buffer D, 5 mM MnCl2, 1.0 M NaCl; buffer E, 5 mM MnCl2, 0.5 M NaCl, 5 mM UDP. The cell lysate was applied to a column (3.0 x 19.0 cm) of SP Sepharose FF equilibrated with buffer A at a flow rate of 5 ml/min. The column was washed with buffer A. Elution was performed with 500 ml of buffer B. Fractions of 5 ml were collected and assayed for total protein content and
1,3 GalT activity. The fractions containing
1,3 GalT activity were pooled. MnCl2 was added to a final concentration of 5 mM. The sample was applied to a column (2.0 x 2.54 cm) of UDP affinity gel, equilibrated in buffer C at a flow rate of 0.2 ml/min. The column was successively washed with 50 ml buffer C, 50 ml buffer D, and 50 ml buffer C. Elution was performed with 50 ml of buffer E. Fractions of 2.5 ml were assayed for total protein content and
1,3 GalT activity.
Active fractions of purified enzyme were analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE). Protein estimations were made according to the micro-assay protocol (< 25 µg/ml) (Bio-Rad protein assay reagent). All samples were analyzed on a 420% TrisHCL gradient SDSpolyacrylamide gel to assess the purity of the enzyme preparation. The gels were run at 160V for 1 h, and protein bands were visualized using Gel Code Blue stain.
Enzyme activity assays
1,3 GalT activity assays were used throughout the purification procedure to follow activity by measuring the amount of incorporated [3H]-galactose in the formation of the carbohydrate product [3H]-Gal
1,3Galß1,4GlcNAc. The following components were contained in a final reaction volume of 50 µl: 15 µl enzyme preparation, 100 mM cacodylate, pH 6.0, 20 mM MnCl2, 1 mM UDP-gal, 0.2 µCi UDP-[3H]-gal, 500 µM LacNAc. The reaction mixtures were incubated for 30 min at 37°C and terminated with 400 µl of MilliQ water. The mixtures were applied to columns of 1 ml Dowex anion exchange resin 1 x 2, 200400 mesh, Cl form prewashed with 10 ml of MilliQ water twice. An additional 200 µl of MilliQ water was used to rinse the reaction tubes and applied to the column. The column was washed with 1 ml MilliQ water and allowed to completely pass through the column. Unreacted donor, UDP-[3H]galactose, which is negatively charged, bound to the positively charged Dowex resin while the carbohydrate product was in the effluent. The incorporation of [3H]-galactose in the effluent was counted in a liquid scintillation counter (Beckman LS 3801).
Enzyme assays were also carried out to test the full length and truncated forms of the newly cloned enzymes for
1,3 GalT and B transferase activity as previously described (Henion et al., 1994
; Seto et al., 1999
) using O-(CH2)8COOCH3 (C8)-oligosaccharides (LacNAc-C8 and H-type 2-C8).
In-gel and in-solution proteolysis
To verify that the single, 36-kDa band observed on the SDSPAGE gel was
1,3 GalT, an in-gel digest protocol was carried out using trypsin. The band of interest at approximately 36 kDa was excised and diced into small pieces using a razor blade. The gel pieces were transferred into a microcentrifuge tube and washed twice with 200 µl of 50% MeOH/H2O for 15 min to destain the gel pieces. The gel pieces were washed with 200 µl of 50% acetonitrile (ACN)/0.2M NH4HCO3 for 30 min at 30°C twice. The gel pieces were dried using a speed vac. Trypsin dissolved in water at a concentration 1:15 w/w ratio of trypsin to protein was added to the dried gel pieces. The gel pieces were allowed to completely rehydrate by addition of 35 µl of 0.2 M NH4HCO3 at a time, not exceeding 15 µl total. Samples were allowed to digest at 37°C overnight. On the following day, the gel pieces were centrifuged and the supernatant collected into a new tube. The tryptic peptides from the digested protein band were eluted from the gel by vortexing briefly and heating at 30°C with 100 µl of 80% ACN/0.1% trifluoracetic acid (TFA). After a 30-min incubation, the supernatant was collected by centrifugation and added to the previous supernatant. The remaining gel pieces were vortexed and heated at 30°C for 30 min with 50100 µl of HPLC water, and the supernatant was added to the previous supernatants. The process of elution of the tryptic peptides was repeated. The supernatants (350400 µl) were dried using a speed vac and resuspended to 15 µl with HPLC water for MS analysis. Once the band was demonstrated to represent
1,3 GalT protein, digestion of the purified protein preparation (i.e., in solution) was carried out with trypsin or chymotrypsin and the products analyzed by LC-MS/MS (details are described in the following section).
Modification of cysteine residues
The active fractions of
1,3 GalT eluted from the UDP column were concentrated on an amicon centricon with a molecular weight cut-off of 10 kDa (YM10) to a final concentration of 1 µg/µl. The fractions (500 µl) were loaded into an amicon centricon reservoir and centrifuged at 14,000 x g for 20 min. The effluent was collected in a microcentrifuge tube and subsequently discarded. The concentrate (10 µl) was resuspended in 500 µl of 0.1 M TrisHCl, 5 mM (ethylenedioxy) diethylenedinitrilo tetraacetic acid (EDTA), pH 8.3, buffer by vortexing briefly and pipetting up and down. The resuspension was concentrated 50x to a final volume of 10 µl by centrifugation at 14,000 x g for 20 min. The effluent was collected in a new tube and subsequently discarded. The concentrate was collected into a new microcentrifuge tube by inverting the amicon concentrator reservoir and centrifuging at 3,000 x g for 1 min. The protein content of the concentrate was determined to be 1 µg/µl.
A 10-µl sample of concentrated
1,3 GalT was incubated with a 10x molar excess of idodoacetyl-LC-biotin for 30 min in the dark at room temperature to label any free cysteine residues. Urea was added to a final concentration of 6 M to denature the biotin labeled
1,3GalT. After incubation for 1 h, the urea was diluted to 2 M urea with water (final volume of 99 µl). The mixture was divided into two aliquots for trypsin and chymotrypsin digestions. Trypsin or chymotrypsin was added at a 1:25 w/w ratio of trypsin or chymotrypsin to protein and incubated at 37°C overnight. The digest reaction was stopped by adding TFA to a final concentration of 0.1%. TFA lowers the pH to
3.0, rendering the trypsin or chymotrypsin inactive. Nonlabeled cysteine residues (those involved in disulfide bonds) were reduced by incubation with a 100x molar excess of DTT at 65°C for 30 min and alkylated with a 200x molar excess of iodacetamide at room temperature for 30 min. The peptides were analyzed by LC-MS/MS analysis as previously described (Yen et al., 2000
).
| Acknowledgments |
|---|
|
|
|---|
This work was supported by grants to B.A.M. from the National Institutes of General Medicine (GM40205), and National Center for Research Resources (Research Infrastructure in Minority Institutions (P20 RR11805) with funding from the Office of Research on Minority Health), National Institutes of Health. P.G.W. was supported by a grant (AI44040) from NIH.
| Abbreviations |
|---|
|
|
|---|
1,3 Gal(NAc)T,
1,3 galactosyl/N-acetylgalactosyltransferase;
1,3 GalT,
1,3 galactosyltransferase; ACN, acetonitrile; C8, O-(CH2)8COOCH3; DTT, dithiothreitol; ESI, electrospray ionization; HPLC, high-performance liquid chromatography; iGb3Cer, isoglobotriaosylceramide; LacNAc, N-acetyllactosamine; LC, liquid chromatography; MS, mass spectrometry; MS/MS, tandem mass spectrometry; PCR, polymerase chain reaction; SDSPAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis; TFA, trifluroacetic acid; UDP, uridine diphosphate.
| Footnotes |
|---|
1 These authors contributed equally to this work.
2 To whom correspondence should be addressed ![]()
| References |
|---|
|
|
|---|
Fang, J.L.J., Chen, X., Zhang, Y., Wang, J., Guo, Z., Zhang, W., Yu, L., Brew, K., and Wang, P.G. (1998) Highly efficient chemoenzymatic synthesis of alpha-galactosyl epitopes with a recombinant alpha (1
3)-galactosyltransferase. J. Amer. Chem. Soc., 120, 66356638.
Galili, U., and Swanson, K. (1991) Gene sequences suggest inactivation of
-1, 3-galactosyltransferase in catarrhines after the divergence of apes from monkeys. Proc. Natl. Sci., 88, 74017404.
Galili, U., Kobrin, E., Shohet, S.B., Stults, C.L.M., and Macher, B.A. (1988) Man, apes, and Old World monkeys differ from other mammals in the expression of
-galactosyl epitopes on nucleated cells. J. Biol. Chem., 263, 1775517762.
Gastinel, L.N., Bignon, C., Misra, A.K., Hindsgaul, O., Shaper, J.H., and Joziasse, D.H. (2001) Bovine
1,3-galactosyltransferase catalytic domain structure and its relationship with ABO histo-blood group and glycosphingolipid glycotransferases. EMBO J., 20, 638649.[Web of Science][Medline]
Gastinel, L.N., Cambillau, C., and Bourne, Y. (1999) Crystal structures of bovine ß4galactosyltransferase catalytic domain and its complex with uridine diphosphogalactose. EMBO J., 18, 35463557.[Web of Science][Medline]
Haslam, D.B. and Baenziger, J.U. (1996) Expression cloning of Forssman glycolipid synthetase: A novel member of the histo-blood group ABO gene family. Proc. Natl. Acad. Sci., 93, 1069710702.
Henion, T.R., Macher, B.A., Anaraki, F., and Galili, U. (1994) Defining the minimal size of catalytically active primate
1, 3 galactosyltransferase: structure-function studies on the recombinant truncated enzyme. Glycobiology, 4, 193201.
Joziasse, D.H., Shaper, J.H., Van den Eijnden, D.H., Van Tunen, A.H., and Shaper, N.L. (1989) Bovine
1-3 galactosyltransferase: isolation and characterization of cDNA clone. Identification of homologous sequences in human genomic DNA. J. Biol. Chem., 264, 1429014297.
Keusch, J.J, Manzella, S.M., Nyame, K.A., Cummings, R.D., and Baenziger, J.U. (2000) Expression cloning of a new member of the ABO blood group glycosyltransferases, iGb3 synthase, that directs the synthesis of isoglobo-glycosphingolipids. J. Biol. Chem., 275, 2530825314.
Seto, N.O.L., Palcic, M.M., Compston, C.A., Li, H., Bundle, D.R., and Narang, S.A. (1997) Sequential interchange of four amino acids from blood group B to blood group A glycosyltransferases boosts catalytic activity and progressively modifies substrate recognition in human recombinant enzymes. J. Biol. Chem., 272, 1413314138.
Seto, N.O.L., Compston, C.A., Evans, S.V., Bundle, D.R., Narang, S.A., and Palcic, M.M. (1999) Donor substrate specificity of recombinant human blood group A, B and hybrid A/B glycosyltransferases expressed in Escherichia coli. Eur. J. Biochem., 259, 770775.[Web of Science][Medline]
Yamamoto, F. and Hakomori, S. (1990) Sugar-nucleotide donor specificity of histo-blood group A and B transferases is based on amino acid substitutions. J. Biol. Chem., 265, 1925719262.
Yamamoto, F. and McNeill, P.D. (1996) Amino acid residue at condon 268 determines both activity and nucleotide-sugar donar substrate specificity of human histo-blood group A and B transferases. J. Biol. Chem., 271, 1051510520.
Yen, T-Y., Joshi, R.K., Yan, H., Nina, O.L., Seto, N.O.L, Palcic, M.M., and Macher, B.A. (2000) Characterization of cysteine residues and disulfide bonds in proteins by liquid chromatography/electrospray ionization-tandem mass spectrometry. J. Mass Spectrom., 35: 9901002.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A.-L. Turcot-Dubois, B. Le Moullac-Vaidye, S. Despiau, F. Roubinet, N. Bovin, J. Le Pendu, and A. Blancher Long-term evolution of the CAZY glycosyltransferase 6 (ABO) gene family from fishes to mammals--a birth-and-death evolution model Glycobiology, May 1, 2007; 17(5): 516 - 528. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Lazarus, J. Milland, P. A. Ramsland, E. Mouhtouris, and M. S. Sandrin Histidine 271 has a functional role in pig {alpha}-1,3galactosyltransferase enzyme activity Glycobiology, December 1, 2002; 12(12): 793 - 802. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Boix, G. J. Swaminathan, Y. Zhang, R. Natesh, K. Brew, and K. R. Acharya Structure of UDP Complex of UDP-galactose:beta -Galactoside-alpha -1,3-galactosyltransferase at 1.53-A Resolution Reveals a Conformational Change in the Catalytically Important C Terminus J. Biol. Chem., December 14, 2001; 276(51): 48608 - 48614. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








