Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (24)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ermonval, M.
Right arrow Articles by Ivessa, N. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ermonval, M.
Right arrow Articles by Ivessa, N. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Glycobiology, 2001, Vol. 11, No. 7 565-576
© 2001 Oxford University Press

N-glycan structure of a short-lived variant of ribophorin I expressed in the MadIA214 glycosylation-defective cell line reveals the role of a mannosidase that is not ER mannosidase I in the process of glycoprotein degradation

Myriam Ermonval1,2,3, Claudia Kitzmüller4, Anne Marie Mir5, René Cacan5 and N. Erwin Ivessa5

3URA CNRS 1960, Département d’Immunologie Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France, 4Institute of Medical Biochemistry, Department of Molecular Genetics, University and Biocenter Vienna, Dr. Bohr-Gasse 9/2, A-1030 Vienna, Austria, and 5Laboratoire de Chimie Biologique, UMR CNRS 111, Université des Sciences et Technologies de Lille, 59655 Villeneuve d’Ascq Cedex, France

Received on November 30, 2000; revised on February 1, 2001; accepted on February 6, 2001.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
A soluble form of ribophorin I (RI332) is rapidly degraded in Hela and Chinese hamster ovary (CHO) cells by a cytosolic proteasomal pathway, and the N-linked glycan present on the protein may play an important role in this process. Specifically, it has been suggested that endoplasmic reticulum (ER) mannosidase I could trigger the targeting of improperly folded glycoproteins to degradation. We used a CHO-derived glycosylation-defective cell line, MadIA214, for investigating the role of mannosidase(s) as a signal for glycoprotein degradation. Glycoproteins in MadIA214 cells carry truncated Glc1Man5GlcNAc2 N-glycans. This oligomannoside structure interferes with protein maturation and folding, leading to an alteration of the ER morphology and the detection of high levels of soluble oligomannoside species caused by glycoprotein degradation. An HA-epitope-tagged soluble variant of ribophorin I (RI332-3HA) expressed in MadIA214 cells was rapidly degraded, comparable to control cells with the complete Glc3Man9GlcNAc2 N-glycan. ER-associated degradation (ERAD) of RI332-3HA was also proteasome-mediated in MadIA214 cells, as demonstrated by inhibition of RI332-3HA degradation with agents specifically blocking proteasomal activities. Two inhibitors of {alpha}1,2-mannosidase activity also stabilized RI332-3HA in the glycosylation-defective cell line. This is striking, because the major mannosidase activity in the ER is the one of mannosidase I, specific for a mannose {alpha}1,2-linkage that is absent from the truncated Man5 structure. Interestingly, though the Man5 derivative was present in large amounts in the total protein pool, the two major species linked to RI332-3HA shortly after synthesis consisted of Glc1Man5 and Man4, being replaced by Man4 and Man3 when proteasomal degradation was inhibited. In contrast, the untrimmed intermediate of RI332-3HA was detected in mutant cells treated with mannosidase inhibitors. Our results unambiguously demonstrate that an {alpha}1,2-mannosidase that is not ER mannosidase I is involved in ERAD of RI332–3HA in the glycosylation-defective cell line, MadIA214.

Key words: {alpha}1,2-mannosidase/CHO glycosylation-defective cell line/ERAD/oligomannoside structure/proteasome


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
N-linked oligosaccharides attached to membrane-bound and secretory glycoproteins are known to be involved in various biological processes (Varki, 1993Go). Only recently have N-glycans been uncovered to play an important role in glycoprotein transport and sorting (Fiedler and Simons, 1995Go), in particular at the initial step of the secretory pathway taking place in the endoplasmic reticulum (ER) compartment (Helenius, 1994Go; Liu et al., 1999Go; Moussalli et al., 1999Go).

Newly synthesized polypeptides enter the ER of eukaryotic cells by crossing the translocon pore (Johnson and van Waes, 1999Go; Matlack et al., 1999Go). Acquisition and processing of N-glycans, particularly the oxidizing environment and folding factors characteristic of this compartment, allow further transport of proteins with a native conformation only (for review see Leitzgen and Haas, 1998Go). A quality control machinery assists protein folding (Hammond and Helenius, 1995Go; Ellgaard et al., 1999Go; Parodi, 2000Go) and facilitates elimination of improperly folded or assembled proteins by an ER-associated degradation (ERAD) process defining events that occur in (a) pre-Golgi compartment(s) (Klausner and Sitia, 1990Go). Many soluble or membrane proteins of the secretory pathway have now been shown to be substrates for ERAD (Ward et al., 1995Go; Wiertz et al., 1996Go; Qu et al., 1996Go; Hughes et al., 1997Go; Yu et al., 1997Go; de Virgilio et al., 1998Go). In many cases, this pathway results in the cytosolic degradation by the ubiquitin-proteasome system after retrotranslocation of the protein through the Sec61 pore (Sommer and Wolf, 1997Go; Bonifacino and Weissman, 1998Go; Ivessa et al., 1999Go; Plemper and Wolf, 1999Go).

The core glycan Glc3Man9GlcNAc2 transferred onto asparagine consensus sites of nascent polypeptides is thereafter subjected to trimming (Hirschberg and Snider, 1987Go). In the ER, the three glucose residues and a single mannose are removed from carbohydrate side chains by ER glucosidases I and II and ER mannosidase I before glycoproteins become competent to leave this compartment. Interestingly, although monoglucosylated N-glycans, Glc1Man7–9GlcNAc2 generated by UDP-Glc glycoprotein glucosyltransferase (UGTR), which only reglucosylates malfolded proteins (Sousa et al., 1992Go), are important during glycoprotein folding via interaction with lectin-like chaperones, such as calnexin and calreticulin (Ware et al., 1995Go; Spiro et al., 1996Go), a mannose-trimmed structure of the N-glycan, Man8GlcNAc2, has recently been proposed to play a role in glycoprotein degradation in yeast (Jakob et al., 1998Go). In mammals, (a) trimmed structure(s) of N-glycans, thought to be generated by ER mannosidase I, also relate to the degradation process as suggested from indirect studies revealing a stabilization of some ERAD substrates in the presence of mannosidase inhibitors (Yang et al., 1998Go; de Virgilio et al., 1999Go; Liu et al., 1999Go).

It has been demonstrated that monoglucosylated N-glycans interact with calnexin or calreticulin until the glycoproteins acquire their correct conformation, therefore escaping the calnexin or calreticulin/UGTR retention cycle (Ellgaard et al., 1999Go; Trombetta and Helenius, 1998Go). When proteins are unable to fold, the signal to release them from the lectin-like chaperones could then be a trimmed structure of the oligomannoside produced by the action of a mannosidase (de Virgilio et al., 1999Go; Liu et al., 1999Go; Parodi, 2000Go; Wilson et al., 2000Go). However, the molecular mechanisms that initiate this process are unknown. Moreover, proteasomal degradation is not always dependent on calnexin binding (Bennett et al., 1998Go; Ayalon-Soffer et al., 1999Go) or on mannosidase I activity (Yang et al., 1998Go; Cabral et al., 2000Go), and different interpretations on the role of mannose trimming related to degradation have been proposed.

To learn more about the role of N-glycans during proteasomal degradation we isolated stable transfectants of an HA-tagged model glycoprotein, the soluble ribophorin I variant (RI332) defined as a substrate for ERAD (de Virgilio et al., 1998Go). We investigated the oligomannoside content of RI332-3HA expressed in a glycosylation-defective cell line, MadIA214, which synthesizes truncated N-glycans, Man5GlcNAc2-P-P-Dol thereafter transferred onto asparagine consensus sequence of nascent polypeptide chains (Ermonval et al., 1997Go). Interestingly, this truncated structure is deprived of the terminal mannose {alpha}1,2-linkage that is specifically cleaved by ER mannosidase I, the more abundant mannosidase in the ER, responsible for the formation of Man8GlcNAc2 species from complete core glycans. The MadIA214 mutant has been used to demonstrate the involvement of carbohydrates in secretory processes by interfering with protein folding (Ermonval et al., 2000Go). Concomitantly, an alteration of the ER morphology and the detection of high levels of soluble oligomannoside species caused by glycoprotein degradation (Verbert and Cacan, 1999Go) were observed in this cell line (Ermonval et al., 1997Go). In the present study we show that some mannose trimming also occurs on the truncated N-glycan and plays a role in the degradation of the tagged soluble ribophorin I variant, RI332-3HA. An {alpha}1,2-mannosidase activity that is different from the one exhibited by ER mannosidase I generates Man4 (and eventually Man3) derivatives associated with RI332-3HA during its degradation in the glycosylation-defective cell line, and a model accounting for these results is proposed.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
RI332-3HA is rapidly degraded by cytosolic proteasomes in the MadIA214 glycosylation-defective cell line
To follow glycoprotein degradation in the Chinese hamster ovary (CHO)-derived glycosylation defective cell line, MadIA214 (Ermonval et al., 1997Go), we isolated stable transfectants that express RI332-3HA, an HA-epitope–tagged version of the soluble ribophorin I variant (Tsao et al., 1992Go), from both this mutant cell line (MadCl8) and its corresponding parental clone, Cl42 (Cl42Cl6).

We first studied the kinetics of degradation of RI332-3HA in our cellular model system using as control, Hela cells also transfected with the gene encoding RI332-3HA (HelaCl8). The three transfected lines Cl42Cl6, MadCl8, and HelaCl8, were metabolically labeled for 20 min with 35S-Met/Cys amino acid and the decrease of the amount of RI332-3HA was analyzed over a 240-min chase period after electrophoresis of the material immunoprecipitated using antibodies directed against the HA-epitope tag. As shown in Figure 1A, the decay of the signal associated with newly synthesized RI332-3HA was rapid in the control parental CHO transfectant, Cl42Cl6, and in the control HelaCl8 cells, both of which synthesize a complete Glc3Man9GlcNAc2 N-glycan. This conforms to the short half-life of the untagged soluble ribophorin I (RI332) in CHO and Hela cells (de Virgilio et al., 1998Go, 1999). In MadCl8 cells, where glycoproteins carry a truncated N-glycan with the structure Man5GlcNAc2 (Ermonval et al., 2000Go), the rate of degradation of RI332-3HA was quite similar. Phosphorimager analysis (Figure 1B) indicated that RI332-3HA was degraded with a t1/2 of about 1 h in all three cell lines. Because MadIA214 glycosylation defective cell line exhibits some thermosensitivity characteristics (Ermonval et al., 1997Go), the experiments were performed at the permissive temperature of 34°C. However, degradation of RI332-3HA was unaffected at the nonpermissive temperature (40°C), being only slightly accelerated (t1/2 about 45 min) as is also the case for the tagged RI332 variant in Cl42 and Hela control cells at this temperature (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1. RI332-3HA is rapidly degraded in glycosylation defective cell line as in control cells. Proteins from Cl42Cl6 parental cells and the glycosylation defective cell line MadCl8 as well as from HelaCl8 control cells, all expressing the tagged truncated ribophorin (RI332-3HA), were metabolically labelled for 20 min with a (35S)Met-(35S)Cys mixture and chased for the indicated period of time with unlabeled amino acids. (A) RI332-3HA was specifically immunoprecipitated from cell lysates in 1% Triton X-100 using rabbit anti-HA antibodies. Immunoprecipitates were analyzed using 8% SDS–PAGE, and incorporated radioactivity into newly synthesized proteins was visualized by fluorography. (B) The rate of degradation of RI332-3HA was also monitored with a phosphorimager and quantitation of the percentage of remaining protein in the different cell lines: Cl42Cl6 (filled squares), MadCl8 (open squares), and HelaCl8 (open circles) was plotted against chase time using the 5-min chase as the 100% starting point.

 
It is known from previous studies that degradation of the soluble RI332 variant depends on the activity of cytosolic proteasomes (de Virgilio et al., 1998Go). We therefore studied the effect of the proteasome inhibitor ZLLNva on the degradation of the tagged variant RI332-3HA in Cl42Cl6 control cells and in MadCl8 mutant cells, using the same anti-ribophorin I antibody and the same SDS solubilization procedure that was used to study the untagged RI332. In both cell lines, ZLLNva treatment induced an accumulation of newly synthesized RI332-3HA, as demonstrated by SDS–polyacrylamide gel electrophoresis (PAGE) analysis (Figure 2A). Quantitation of the autoradiographic images showed that the initial quantity of RI332-3HA was maintained over a 4-h chase in the presence of the proteasome inhibitor (Figure 2B). RI332-3HA was still present at 6-h chase in Cl42Cl6 and MadCl8 cells treated with ZLLNva (data not shown), though it had nearly disappeared at 2-h chase in untreated cells. It is to be noted that in MadCl8 the RI332-3HA band was large and corresponded to a doublet. A similar inhibition of RI332-3HA degradation was observed in these two transfected cell lines treated with ZLLNva or ZLLL to inhibit proteasome activity, when immunoprecipitations were performed with anti-HA antibodies on Triton X-100 extracts (data not shown).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2. Degradation of RI332-3HA utilizes the proteasome pathway both in control cells and in glycosylation mutant cells. Cl42Cl6 control cells and MadCl8 mutant cells were either treated (+) or not (–) with 40 µM of the ZLLNva proteasome inhibitor. Cells were pretreated for 1.5 h with the inhibitor prior to the 35S radiolabeling (20 min), then chased for the indicated time. ZLLNva was maintained all along the pulse chase experiments. (A) RI332-3HA was immunoprecipitated from SDS cell extracts using a rabbit anti-ribophorin antibody then its decay was analyzed on 8% SDS–PAGE. (B) The quantitation of the remaining RI332-3HA expressed as in Figure 1, in presence (open squares) or in absence (filled squares) of the inhibitor, was obtained from scanning of autoradiographic images.

 
These results show that the HA-tagged soluble variant RI332-3HA is rapidly degraded in CHO and Hela cells by a process requiring cytosolic proteasomes, as previously demonstrated for RI332 (de Virgilio et al., 1998Go). Apparently, the same pathway of degradation is used by the glycosylation-defective cell line MadIA214.

Inhibition of mannose trimming results in a stabilization of RI332-3HA in the MadCl8 glycosylation mutant cells
Recent data have pointed to the role of ER mannosidase I in the process of {alpha}1-antitrypsin degradation (Liu et al., 1997Go, 1999), and a similar observation was made with the truncated variant of ribophorin I, RI332 (de Virgilio et al., 1999Go). In a normal situation, the more abundant of two ER mannosidases, the ER mannosidase I (Moremen et al., 1994Go), removes a terminal {alpha}1,2-mannose on the middle branched arm of the high mannose core (see Figure 6). This mannosidase is sensitive to kifunensine (Kif) and deoxymannojirimycin (DMN), while the ER mannosidase II specific for the outer branched terminal {alpha}1,2-mannose is resistant to Kif (Herscovics, 1999Go). The truncated moiety synthesized in MadIA214 cells is a "linear Man5." This structure does not contain the middle and outer branched arms present on a complete core and therefore, the terminal {alpha}1,2-mannose residues cleaved by ER mannosidase I and II.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6. Model for mannosidase processing during glycoprotein degradation. (A) Different possible steps of glucose and mannose trimming in the ER of MadIA214 glycosylation-defective cell line are illustrated. Man5GlcNAc2 is transferred onto newly synthesized proteins (P) and can be reglucosylated by UGTR, then enters the CLNX/GII/UGTR cycle, which can be interrupted by castanospermine (CST), an inhibitor of glucosidases. When properly folded, glycoproteins are not reglucosylated, they escape retention and can be transported to the Golgi apparatus, then secreted (the mannose chain only has been represented and not the Golgi modifications leading to complex N-glycans on secretion-competent proteins). For those proteins that are unable to fold, at some point an {alpha}1,2-mannosidase sensitive to Kif and DMN, either from the ER (such as the Man9-mannosidase) or from the Golgi (for instance, when proteins leave the ER possibly associated to BiP and are retrieved from the Golgi), cleaves the terminal linear mannose residues, generating Man4GlcNAc2 and Man3GlcNAc2 structures that accumulate in the presence of proteasome inhibitor (ZLLL). (B) Oligomannoside trimming is shown in a wild-type situation in which a complete Glc3Man9GlcNAc2 N-glycan is transferred onto newly synthesized protein. In this case, Man8GlcNAc2 isomer B produced by ER mannosidase I could be found on properly folded proteins, which are then transported along the secretory pathway. A Man8GlcNAc2 isomer A as well as Man7GlcNAc2 and Man6GlcNAc2 structures, which lack the terminal mannose on the linear arm, are expected to be produced in such a model and act as a signal for degradation. The role of ER mannosidase II according to the model of Cabral et al. (2000)Go is also mentioned (asterisk). Processing enzymes are in italic script and underlined, and inhibitors have a border.

 
We examined the effect of mannosidase inhibitors on the degradation of RI332-3HA. As expected, pulse-chase experiments showed a stabilization of the tagged RI variant in Cl42Cl6 control cells treated either with Kif or with DMN as compared to its rapid degradation in untreated cells (Figure 3A, left panel). Surprisingly, in MadCl8 cells, where the truncated N-glycan does not possess the mannose linkages recognized by ER mannosidases I and II, Kif and DMN also stabilized RI332-3HA (Figure 3A, middle panel).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3. RI332-3HA is stabilized in MadCl8 mutant cells treated with {alpha}1,2-mannosidase inhibitors. Degradation of RI332-3HA in Cl42Cl6 control cells and MadCl8 glycosylation defective cell line as well as of its unglycosylated counterpart RI332*-3HA in Mad*Cl7 cells was followed by immunoprecipitation using anti-HA antibody as described in Figure 1. Cells were either let untreated or treated with kifunensine (Kif) at 10 µM or deoxymanojirymycin (DMN) at 1 mM, both inhibiting {alpha}1,2-mannosidase activities. The cells were pretreated with the drugs for 1 h prior to the pulse, then the chase (for the indicated period of time in h) was also performed in presence of the inhibitors. The immunoprecipitates were run on a 8% SDS–PAGE and the signal associated to RI332-3HA was quantitated from a phosphorimager. (A) The histograms show the percentage of remaining RI332-3HA at different chase times in Cl42Cl6, MadCl8, and Mad*Cl7 treated or not with the different inhibitors Kif and DMN as indicated in the legend of the left panel. The time 0 of reference used to calculate the 100% of RI332-3HA, corresponds to 5-min chase. The effect of the mannosidase inhibitors on the electrophoretic mobility of RI332-3HA in MadCl8 cells is illustrated in (B). Arrows indicate the migration of the protein stabilized with Kif or DMN and of the trimmed intermediate accumulating in presence of 100 µM ZLLL used as proteasome inhibitor (B, left panel). For comparison, the faster migration of nonglycosylated RI332*-3HA expressed in Mad*Cl7 cells is indicated by an asterisk and is insensitive to DMN both in terms of mobility and stability (B, right panel).

 
A direct rather than indirect effect of the mannosidase inhibitors on N-glycan trimming in MadCl8 cells was documented by the insensitivity to Kif of the degradation of the nonglycsosylated form of the tagged soluble variant RI332*-3HA expressed in Mad*Cl7 mutant cells (Figure 3A, right panel). This was also supported by an effect of both mannosidase inhibitors on the electrophoretic mobility of RI332-3HA in MadCl8. Indeed, an untrimmed initial precursor of RI332-3HA was stabilized, whereas in the presence of proteasome inhibitors, such as ZLLL, a trimmed intermediate of RI332-3HA accumulated (Figure 3B, left gel). During degradation of RI332-3HA this intermediate is only just visible in untreated MadCl8 cells and migrates faster than the protein stabilized by Kif or DMN and slower than the nonglycosylated variant synthesized in Mad*Cl7 (Figure 3B, right gel).

In conclusion, {alpha}1,2-mannosidase inhibitors prolong the half-life of RI332-3HA in MadCl8 glycosylation mutant cells, suggesting that some mannose residues on the "linear Man5" structure are important for targeting glycoproteins to degradation.

Specific N-glycan structures are associated with RI332-3HA destined to be degraded in MadCl8 cells
The observation of oligomannoside trimming together with the possibility to accumulate trimmed intermediates of RI332-3HA in MadCl8 cells treated with proteasome inhibitors, prompted us to determine the composition of the N-glycans bound to RI332-3HA during its degradation as compared to the N-glycans found on total proteins.

Oligomannosides associated with total glycoproteins of MadCl8 cells metabolically labeled with 3H-Man were analyzed by high-performance liquid chromatography (HPLC) after a 10-min chase (Figure 4A). As expected from our previous results, a truncated core was found in the glycoprotein fraction and consisted mainly of three different species: Glc1Man5GlcNAc2 (29%), Man5GlcNAc2 (34%), and Man4GlcNAc2 (29%), the Man5GlcNAc2 moiety being present in a larger amount. Indeed, MadIA214 mutant cells synthesize a truncated Man5GlcNAc2-P-P-Dol lipid intermediate, which is elongated neither by ER Dol-P-Man-mannosyl transferases nor by ER Dol-P-Glc-glucosyl transferases normally generating the complete Glc3Man9GlcNAc2 core, due to the mislocalization of some intermediates of the reaction. Therefore, the nonglucosylated Man5GlcNAc2 precursor is transferred onto asparagine consensus sites of newly synthesized proteins in MadIA214 cells. However, glycoproteins carry, in addition, a monoglucosylated derivative, Glc1Man5GlcNAc2, expected then to occur only from reglucosylation (Ermonval et al., 2000Go) by UGTR, an enzyme and chaperone that is specific for malfolded proteins (Sousa et al., 1992Go). In addition, proteins loaded with Man4 oligomannosides accumulate during the chase time in MadIA214 and in another glycosylation-defective cell line, B3F7 (Ermonval et al., 2000Go). This is consistent with the three major oligomannoside species found on the pool of glycoproteins of MadCl8 cells.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. The N-glycan moieties associated to RI332-3HA in MadCl8 cells are different from those found on total proteins. N-glycans of MadCl8 glycosylation mutant cells were metabolically labelled for 45 min with (2–3H)Man. After a 10-min chase, oligomannoside species were released either (A) from the glycoprotein fraction obtained by sequential extraction or (B) from RI332-3HA immunoprecipitated using anti-ribophorin antibodies on MadCl8 cell extracts prepared in 1% Triton X-100. (C) The N-glycans associated to RI332-3HA immunoprecipitated from MadCl8 cells that have been pretreated for 1 h with Kif at 10 µM before pulse-labeling and a 1-h chase also performed in presence of the inhibitor. The oligomannosides were analyzed by HPLC. The different radioactive moieties of N-glycans that eluted in an acetonitrile/water gradient were recorded as a function of time. The different peaks correspond to oligosaccharide species possessing two GlcNAc residues at their reducing end, and the number of Man (M) and Glc (G) residues is indicated on top of each peak.

 
HPLC analysis was then performed on N-glycans released from RI332-3HA purified by immunoprecipitation from detergent extracts of MadCl8 cells labeled in the same way (Figure 4B). Surprisingly, the pattern of the N-glycans associated with newly synthesized RI332-3HA after only 10 min of chase was strikingly different from the one observed on total glycoproteins. The major peak of Man5 found in the total protein fraction was absent from purified RI332-3HA, which carried only Glc1Man5 and Man4 derivatives in almost equal amounts.

Moreover, in agreement with the accumulation of an untrimmed form of RI332-3HA in the presence of {alpha}1,2-mannosidase inhibitor (Figure 3B) was the finding of Glc1Man5GlcNAc2 as the predominant moiety associated to RI332-3HA after treatment of MadCl8 cells with Kif (Figure 4C).

These data reveal that under conditions in which Man5GlcNAc2 is the major N-glycan found in the glycoprotein fraction of MadCl8 glycosylation defective cell line, this structure is not detected on the RI332-3HA glycoprotein destined to degradation. In contrast, the truncated N-glycan on RI332-3HA only appears in a reglucosylated form (Glc1Man5 GlcNAc2) or a trimmed form (Man4 GlcNAc2) generated by a mannosidase, the latter form disappearing from cells treated with mannosidase inhibitors.

A mannosidase specific for two terminal linear {alpha}1,2-mannose residues is involved in the degradation of RI332-3HA in MadCl8 cells
Because RI332-3HA was rapidly degraded in MadCl8 cells, analysis of its N-glycan structure was only possible shortly after synthesis. However, to follow the evolution of the oligomannoside composition in the course of RI332–-3HA degradation, we took advantage of the stabilization of RI332-3HA intermediates in the presence of proteasome inhibitors (Figures 2A and 3B).

HPLC analysis of the N-glycans released from purified RI332-3HA was carried out in MadCl8 cells treated with ZLLL 90 min before, then during the pulse labeling with 3H-Man, as well as during a 4-h chase. The percentage of radioactivity associated to each oligomannoside species was calculated according to the number of mannose residues in each HPLC peak (Figure 5). Compared with the equal amount of Glc1Man5 and Man4 moieties removed from RI332-3HA shortly after synthesis (Figure 5A), Man4 and Man3 N-glycans accumulated at the expense of the Glc1Man5 species no longer detected in MadCl8 cells treated with ZLLL (Figure 5B). This is in agreement with the increase in electrophoretic mobility of RI332-3HA observed under this condition, and with the stabilization of an untrimmed form in the presence of DMN and Kif, indicative of the requirement for a mannosidase to generate the trimmed species (see Figures 3 and 4). The appearance of a Man3 derivative when proteasomes were inhibited demonstrates that the mannosidase activity was able to release a second mannose residue from the truncated Man5 structure. This enzyme is expected, from its specificity to mannosidase inhibitors, to recognize mannose {alpha}1,2-linkage. To prove that Man4 and later Man3 structures were produced by cleavage of the terminal mannose on the linear arm rather than by cleavage of the last {alpha}1,6-branched mannose residue, half of the oligomannoside sample extracted from RI332-3HA after 4 h chase in presence of ZLLL was also digested by a specific mannosidase from Aspergillus saitoi that removes, on N-glycans, all mannose residues with an {alpha}1,2-linkage. As expected, after the enzymatic digestion Man4 moieties were completely converted into Man3GlcNAc2 (Figure 5C).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. RI332-3HA carrying N-glycan structures with trimmed mannose accumulates in MadCl8 cells treated with proteasome inhibitors. Oligomannosides associated to RI332-3HA in MadCl8 cells metabolically labeled with (2–3H)Man were prepared and analyzed by HPLC as in Figure 4. MadCl8 cells were either pulsed for 45 min then chased for 10 min (A) or pretreated for 1 h, labeled for 45 min, then chased for 4 h in presence of 50 µM ZLLL to inhibit proteasomes. Half of this sample was kept untreated (B), and the remaining part was digested with an {alpha}1,2-mannosidase (C) to determine the structure of the accumulating trimmed intermediate. Histograms represent the percentage of the different oligomannoside moieties: Glc1Man5 (G1M5), Man5 (M5), Man4 (M4), and Man3 (M3) associated to RI332-3HA under each labeling conditions. The percentage of each species calculated from the amount of radioactivity in each HPLC peak was corrected by taking into account the number of mannose residues in each peak. Each bar corresponds to oligosaccharide species with two GlcNAc residues at their reducing end.

 
These data demonstrate that an {alpha}1,2-mannosidase converts the truncated Man5 into Man4 derivative during the process of degradation of RI332-3HA in the MadCl8 mutant cell line. This mannosidase is also able to generate Man3GlcNAc2 oligomannosides detected only under conditions when intermediates of degradation are stabilized by inhibiting proteasome activities.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
In many instances now, cytosolic proteasomes have been shown to be a site for degradation of newly synthesized soluble and membrane proteins that were initially inserted into the ER, but did not achieve their proper folding or assembly (Ward et al., 1995Go; Wiertz et al., 1996Go; Qu et al., 1996Go; Hughes et al., 1997Go; Liu et al., 1997Go; Yu et al., 1997Go; Yang et al., 1998Go; de Virgilio et al., 1998Go). Many questions remain concerning fine molecular mechanisms involved in the targeting of a protein to proteasomal degradation that might be tightly coupled to its folding. In the case of glycoproteins, an attractive postulate based on recent data obtained in yeast and mammals (Jakob et al., 1998Go; Liu et al., 1999Go; Wilson et al., 2000Go) points to the role of mannose trimming of the N-glycans as a regulator of this process. The prevailing idea is actually that the release of a single terminal mannose by ER mannosidase I could modify the status of the interaction with lectin-like chaperones of malfolded glycoproteins retained in the ER. Indeed, in most cases, mannosidase inhibitors were shown to stabilize a glycoprotein otherwise degraded by proteasomes (Liu et al., 1997Go; Yang et al., 1998Go; Ayalon-Soffer et al., 1999Go; de Virgilio et al., 1999Go; Wilson et al., 2000Go).

To evaluate the role of mannosidases during ERAD, we used the MadIA214 glycosylation-defective cell line, which is impaired in oligomannoside elongation (Ermonval et al., 1997Go). We showed in the present study that RI332-3HA, an HA-epitope tagged version of a soluble variant of ribophorin I, is rapidly degraded in MadIA214 cells dependent on proteasomal activity. Interestingly, mannose trimming of the truncated Man5GlcNAc2 N-glycan bound to RI332-3HA in the glycosylation defective cell line is a prerequisite for its degradation. When mannosidase {alpha}1,2-activity was blocked with DMN or Kif, an untrimmed form of RI332-3HA bearing a Glc1Man5GlcNAc2 accumulated in MadCl8 transfected cells instead of being degraded. In addition, our determination of the structure of the N-glycans associated with RI332-3HA demonstrates that a Man4GlcNAc2 moiety is an intermediate of degradation that accumulates in the glycosylation-defective cell line when proteasomal activity is inhibited by ZLLL. This led us to speculate that this particular N-glycan structure could serve as a signal targeting RI332-3HA to degradation in glycosylation mutant cells. Moreover, the observation (1) that degradation was inhibited both by DMN and Kif, which stabilize the monoglucosylated Man5 derivative of RI332-3HA, (2) that Man3GlcNAc2 appeared together with Man4GlcNAc2 in the presence of ZLLL, and (3) that all the Man4GlcNAc2 can be converted to Man3GlcNAc2 by an exogenous {alpha}1,2-mannosidase, strongly support the role of a mannosidase specific for mannose {alpha}1,2-linkages but different from ER mannosidase I, in the process of glycoprotein degradation in MadIA214 mutant cells. In fact, mannose trimming was obtained although the Man5GlcNAc2 structure does not contain the branched mannose {alpha}1,2-linkage recognized by the highly specific ER mannosidase I (Tremblay and Herscovics, 1999Go). We can also exclude the involvement of the endomannosidase that generates Man8GlcNac2 isomers A in wild-type cells (Weng and Spiro, 1996bGo) and therefore could directly transform a Glc1Man5GlcNAc2 N-glycan into a Man4GlcNAc2 structure, because this enzyme is insensitive to Kif and was not detectable in CHO cells (Karaivanova et al., 1998Go; Weng and Spiro, 1996aGo).

In mammalian cells, two ER mannosidases (I and II) are able to generate Man8GlcNAc2 isomers (B and C respectively) by digesting one single terminal mannose residue present, respectively, on the inner and the outer branched arm of the high mannose N-glycan. Both are sensitive to DMN, but only mannosidase I is inhibited by Kif (Weng and Spiro, 1996aGo). In a normal situation, only the isomer B produced by ER mannosidase I is detected and is an intermediate in the processing of complex oligomannosides associated to secretory glycoproteins (Atkinson and Lee, 1984Go; Daniel et al., 1994Go). Mannosidases not only operate as processing enzymes but, as already pointed out, also operate in ERAD processes. Because glycoproteins to be degraded are initially retained in the ER by molecular chaperones and because the ER mannosidase I is the most abundant among this family of enzymes in this compartment, many studies concluded that the Man8GlcNAc2 structure generated by ER mannosidase I constitutes a signal for degradation (Liu et al., 1997Go; Jakob et al., 1998Go; Yang et al., 1998Go; de Virgilio et al., 1999Go; Parodi, 2000Go; Wilson et al., 2000Go). This was supported by results from experiments utilizing the mannosidase inhibitors DMN and Kif, but the structure of the N-glycans was not determined in these studies. One direct argument in favor of the role of a particular oligomannoside structure in ERAD comes from analysis of the degradation of misfolded mutant carboxypeptidase (CPY*) in yeast mutants blocked at different steps in their N-glycan processing. Optimal degradation of CPY* occurred with the Man8GlcNAc2 structure, but Man6, Man7, Man9 derivatives did not efficiently support degradation of this glycoprotein. Therefore, the authors (Jakob et al., 1998Go) speculated that trimming of N-glycans by the yeast ER mannosidase I could be a timer for the disposal of misfolded proteins.

In contrast to yeast, more mannosidases have been found in mammals and one or more of these could account for the particular trimmed structure of N-glycan that we detected on a glycoprotein only destined to be degraded in MadIA214 mutant cells. Of particular interest in this context is the Man9-mannosidase (Bause et al., 1992Go, 1993) which has been shown to remove three {alpha}1,2-mannosidic linkages on a Man9GlcNAc2 structure, leading to a Man6GlcNAc2 isomer. Although this enzyme has a low affinity for the terminal mannose of the inner branched arm cleaved by ER mannosidase I, it removes terminal linear mannose residues on a truncated Man5GlcNAc2 (Bause et al., 1992Go) and thus is able to generate Man4GlcNAc2 and, less efficiently, Man3GlcNAc2. This accommodates well our results revealing these two N-glycan structures on RI332-3HA in MadCl8 cells when proteasome-mediated degradation was inhibited. Man3GlcNAc2 moieties should indeed be better detectable under conditions in which glycoproteins are retained artificially in the ER (as with ZLLL), allowing for the cleavage of the {alpha}1,2-mannosidic linkage exhibiting a lower affinity for the mannosidase.

We therefore consider the possibility likely that the Man9-mannosidase could trigger the delivery of glycoproteins to degradation in our mutant cell line by generating a Man4GlcNAc2 trimmed structure (see model, Figure 6A). Shortly after biosynthesis, Man5GlcNAc2 represents the major species associated to total proteins. As expected from previous work (Ermonval et al., 2000Go) the Man5GlcNAc2 oligomannoside precursor, which is transferred on newly synthesized proteins, can be reglucosylated on improperly folded proteins in MadIA214 cells, and Glc1Man5GlcNAc2 is detected on total proteins. A considerable proportion of Man4GlcNAc2 is also present and could correspond to a pool of proteins destined to be degraded (see Figure 4). Earlier studies have shown that in MadIA214 mutant cells and in another mutant (B3F7), both synthesizing truncated N-glycans (Man5GlcNAc2 and Glc3Man5GlcNAc2, respectively) differing only at the level of glucosylation, a trimmed Man4GlcNAc2 oligomannoside is the major structure associated with total protein, at long periods of time after synthesis, while concomitantly, proteins are maintained longer in the ER of these glycosylation-defective cells (Duvet et al., 2000Go; Ermonval et al., 2000Go). In the present study we describe a remarkable selection of the population of N-glycans attached to RI332-3HA shortly after synthesis, consisting only of Glc1Man5GlcNAc2 and Man4GlcNAc2, while Man5GlcNAc2 is no longer present. We believe this difference in N-glycan structure distribution to be due to the fact that the glycoprotein pool consists of proteins that will either be degraded or follow the secretory pathway. As the truncated ribophorin I variant is unable to assemble with other partners of the oligosaccharyl transferase complex in the ER and is not secreted either (Ivessa et al., 1992Go; Tsao et al., 1992Go), its only fate is to be degraded. Our results support the idea that the major N-glycan, Man5GlcNAc2, transferred onto proteins in MadIA214 cells is very transient on a glycoprotein destined to degradation. In contrast, this structure is expected to be carried by proteins that have acquired a native conformation and would not be reglucosylated by UGTR anymore, therefore escaping from chaperone retention. The finding of a high amount of Man5GlcNAc2 on total proteins substantiates this assumption. Finally, the truncated N-glycan associated to RI332-3HA appears either as reglucosylated moieties specific for unfolded or malfolded proteins that accumulate in cells treated with Kif, or as a mannose-trimmed form that accumulates at the expense of the Glc1Man5GlcNAc2 in the presence of drugs blocking the proteasome and could signal the protein for targeting to disposal. Importantly, the RI332-3HA degradation rate and pathway in MadIA214 cells were shown to be similar to control cells, arguing that they result from the particularity of the protein rather than from the abnormal glycosylation. Altogether, the use of an ERAD substrate loaded with a truncated N-glycan made the characterization of N-glycans associated to degradation substrates easier and has revealed an alternative mannosidase activity to that of the ER mannosidase I in this system.

It is to be noted that more mannosidases are being characterized even though their role in oligomannoside processing as well as their precise subcellular locations are not always defined and can vary among cell types and species (Daniel et al., 1994Go; Tremblay et al., 1998Go; Igdoura et al., 1999Go). Therefore, we cannot eliminate the possibility that a not yet described or a mislocalized mannosidase, or the Golgi mannosidase I that exhibits common specificities with the Man9-mannosidase, could generate the trimmed Man4 derivative revealed in our mutant cells. For instance, unfolded proteins could leave the ER in association with folding factors, such as the ER chaperone BiP, and be retrieved from the Golgi apparatus, where they could have encountered other mannosidases (Figure 6). Interrestingly, RI332-3HA interacts with BiP in MadIA214 cells (data not shown). Accelerated degradation in the presence of brefeldin A (Tsao et al., 1992Go; Dusseljee et al., 1998Go), a drug blocking transport and redistributing Golgi enzymes to the ER, suggests the role of a post-ER compartment in ERAD.

Whichever is the mannosidase implicated in the production of the Man4 structure, considering the high specificity of ER mannosidase I (Tremblay and Herscovics, 1999Go), its role in the degradation of RI332-3HA in MadCl8 cells remains quite improbable. It has been recently shown that it is necessary to introduce a mutation in the active site of the ER mannosidase I to extend its specificity to other mannose {alpha}1,2-linkages (Romero et al., 2000Go). In addition, determination of the crystal structure revealed interaction between amino acid residues of the active site and some mannose residues of the Man9 chain absent from the "linear Man5" moiety (Vallee et al., 2000Go), and to our knowledge there is no evidence in the literature of ER mannosidase I specificity for such truncated N-glycans. It is thus tempting to extrapolate our data to a wild-type situation. The ER mannosidase I could produce the Man8 isomer B, an intermediate in the processing of complex type carbohydrates, while other mannosidases, namely, the Man9-mannosidase, will generate structures (Man8 isomer A, Man7 and Man6 species) for which trimming of the terminal mannose on the linear arm of the high mannose chain could be of importance for glycoprotein degradation (see model Figure 6B). In cell types other than CHO, the endomannosidase located in the intermediate compartment or the cis-Golgi could also produce a Man8 isomer A (Weng and Spiro, 1996bGo). Accounting for the various ER mannosidases that have been described so far, the possibility that they play different roles in processing and degradation has already been proposed (Daniel et al., 1994Go; Ayalon-Soffer et al., 1999Go). We think that this is consistent with the observation that Man8 isomer B is present on secretory glycoproteins (Atkinson and Lee, 1984Go) and on long-lived glycoproteins resident in the ER (Rosenfeld et al., 1984Go; Duvet et al., 1998Go). Moreover, our findings and model are in accordance with data showing that under particular conditions, such as after long-term residence in the ER (Rosenfeld et al., 1984Go) or in particular crystalloid structures detected in cells overexpressing HGM-CoA (Liscum et al., 1983Go; Bischoff et al., 1986Go), the appearance of trimmed N-glycans consisting of Man6GlcNAc2 was observed.

Once a particular structure is produced by one or more mannosidases, the mechanism of the delivery of the trimmed glycoprotein intermediate to proteasomal degradation still has to be defined and a role for a lectin recognizing such a structure has to be proposed (Jakob et al., 1998Go; Wilson et al., 2000Go). We believe that it might be possible for some mannosidases to exhibit a dual function, such as an enzyme activity and a lectin specificity for improperly folded proteins as described for UGTR (Sousa et al., 1992Go), and, by being part of a network of proteins made up of chaperones, folding factors, and the translocon, to target proteins to degradation.

It is also to be noted that for a common pathway of degradation, the intermediate reactions were shown to be variable from one protein to another, depending or not on calnexin interaction (glucose trimming), mannosidase activity, and ubiquitination of the substrate (Yang et al., 1998Go; Ayalon-Soffer et al., 1999Go; Liu et al., 1999Go). Also, ER mannosidase II has been recently proposed to act as a signal for nonproteasomal degradation (Cabral et al., 2000Go). It is probable that the precise mechanism will vary according to the substrate protein. Our present data add information on the role of a particular trimmed structure, and therefore of {alpha}1,2-mannosidase activities, in regulating the ERAD process. We think that such an approach will help determine intermediate reactions taking place in the ER and preceding proteasomal degradation in wild-type conditions.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
Construction of expression vectors
Subcloning into the mammalian expression plasmid pCI-neo (Promega) of the cDNAs encoding RI332 or RI332-Thr fragments, respectively, which correspond to the 332 N-terminal amino acids of the luminal part of mature rat ribophorin I with or without the N-glycosylation site, has been described (de Virgilio et al., 1999Go)

RI332 and RI332-Thr were tagged close to the C terminus with three repeats of the HA epitope YPYDVDYA (Field et al., 1988Go). The tag was amplified by polymerase chain reaction with the forward primer TTTTGGTGACCTTTACCCATACGATGTTCC and the reverse primer TTTTGGTCACCCTGAGCAGCGTAATCTGG using a plasmid DNA that harbored a cDNA containing three HA epitope repeats as template (provided by K. Kuchler). This way BstEII restriction sites were generated at both ends of the DNA fragment, which was cloned into pCR2.1 (Invitrogen). The 3HA-tagged fragment was excised from the resulting plasmid with BstEII and inserted at the same site in RI332 or RI332-Thr (at position 1038 bp of the cDNA, or at Gly322 of the mature protein) within pCI-neo. Clones of pCI-neo containing the tagged soluble variants of ribophorinI, designated RI332-3HA and RI332-Thr-3HA, were isolated and their identities were confirmed by sequencing. These constructs were used for expression in CHO derived cells and in Hela cells.

Cell lines
The CHO-derived hamster cells used in this study were grown at 34°C and 7% CO2 in alpha-Minimum Essential Medium (Biological Industries) supplemented with 7% fetal calf serum (FCS), 1 mM HEPES, and G418 at 1 mg/ml. Hela cells were grown at 37°C in Minimal Essential Medium (Life Technologies) supplemented with 7% FCS, 1 mM HEPES, and 2 mM glutamine. FCS and additives are from Life Technologies.

MadIA214, a glycosylation mutant line, and its Cl42 parental clone are CHO cells expressing two heterologous secretory glycoproteins and the gene encoding neomycin resistance. The mutant cell line synthesized a truncated N-glycan consisting of Man5GlcNAc2. Characteristics of these cell lines have been described (Ermonval et al., 1997Go).

Cl42 and MadIA214 cells were cotransfected by the lipofection method (according to the manufacturer, Life Technologies) with the expression vectors pCI-neo-RI332-3HA containing the RI332-3HA cDNA, or pCI-neo-RI332-Thr-3HA containing the cDNA corresponding to the nonglycosylated variant RI332-Thr-3HA. The plasmids were mixed with pZeoSV (Invitrogen) used as a selection plasmid at a ratio of 3 µg:0.3 µg in 10 µl of lipofection reagent. Cells cultured in a 6-cm dish were incubated for 24 h with the lipofection/DNA transfection reagent. Stable clones Cl42-RI332-3HA-Cl6, Mad-RI332-3HA-Cl8 and Mad-RI332-Thr-3HA-Cl7 were selected in the presence of zeocin (Invitrogen) at 0.2 mg/ml and tested for expression of the tagged soluble ribophorin I variant by pulse labeling, followed by immunoprecipitation with anti-ribophorin I antibodies and anti-HA antibodies. To facilitate the reading, transfectants’ names have been shortened as follows: Cl42Cl6, MadCl8, and Mad*Cl7 for Cl42-RI332-3HA-Cl6; Mad-RI332-3HA-Cl8 and Mad-RI332-Thr-3HA-Cl7, respectively.

Hela cells were transfected according to the same protocol with pCI-neo-RI332-3HA conferring resistance to G418 antibiotic. A stable transfectant, Hela-RI332-3HA-Cl8, expressing the tagged soluble ribophorin I variant was selected in medium supplemented with G418. This transfected clone is referred to as HelaCl8 in the present study.

Transfected cells were maintained in their corresponding selective medium containing zeocin (0.2 mg/ml) and/or G418 (1 mg/ml).

Antibodies
The polyclonal rabbit antibody against rat liver ribophorin I (Marcantonio et al., 1984Go; Yu et al., 1990Go; Tsao et al., 1992Go) was a kind gift from G. Kreibich. This antibody works on SDS-denatured cell extracts and recognizes both the endogenous ribophorin I (RI) and its soluble variant. The tagged soluble ribophorin was specifically detected using a polyclonal rabbit antibody directed against HA, purchased from BabCo. For N-glycan analysis requiring purification of big quantities of the soluble variant of RI, we employed the rabbit polyclonal RI-LB antibody reacting with the luminal domain of RI. To prepare the anti-RI-LB antiserum, the peptide CPSYEYLYNLGDQYALK corresponding to amino acids 335 to 350 of the rat RI preprotein plus a C-terminal cysteine residue was synthesized and purified by HPLC (Research Genetics). The peptide was coupled to activated KLH, and the resulting product was separated from low molecular weight compounds by chromatography on Excellulose GF-5 (Pierce). The peptide/KLH conjugate was mixed with Freund’s complete adjuvant and used to immunize an adult female New Zealand white rabbit. The anti-RI-LB antibody works with Triton X-100 extracts, but less well with SDS extracts, and therefore reacts preferentially with the soluble RI variant, because the endogenous ribophorin I is better solubilized in SDS than in Triton X-100.

Immunoprecipitations were performed by precoupling of the antibodies to Protein A-Sepharose CL-4B beads obtained from Amersham Pharmacia Biotech.

Pulse-chase analysis and immunoprecipitation
Degradation of the tagged soluble ribophorin in the different transfected lines was studied using previously described conditions (Ermonval et al., 1997Go). Cells (1.5–2.5 x 105) were cultured overnight in 24-well plates at 34°C, then pulsed for 15 min with 100 µCi of a radioactive [35S]Met-[35S]Cys amino acid mixture (TRANS35S-LABEL, ICN) in FCS-, Met-, and Cys-free medium (ICN). Radioactivity was chased for the indicated period of time.

In cells treated with proteasome inhibitors (ZLLL, 50–100 µM or ZLLNva 40 µM purchased from Peptides International) or with mannosidase inhibitors (DMN, 1 mM from Boehringer Mannheim or Kif, 10 µM from ICN); the drugs were added prior to labeling. Cultures were pretreated for 1 h with the drug, which was then kept for all the following incubation: starvation for 30 min in FCS-, Met-, and Cys-free medium, pulse for 20 min, and chased for the indicated periods of time.

For immunoprecipitation using anti-HA or RI-LB antibodies, cells were lysed with 1% Triton X-100 (Merck) in NET buffer (150 mM NaCl, 50 mM Tris, pH 7.4, 5 mM EDTA). Specific immunoprecipitations were performed overnight at 4°C with 15 µl per sample of protein-A Sepharose beads precoated with either 1 µl of anti-HA antiserum or 2.5 µl of anti-RI-LB. After washing in high salt (0.5 M NaCl) NET buffer the immunoprecipitates were eluted from the beads with reducing sample buffer containing 5% ß-mercaptoethanol. Using the polyclonal anti-RI antibody, cell lysis and immunoprecipitations were performed under stringent conditions using an SDS method, as reported elsewhere (Tsao et al., 1992Go). Samples were analyzed by SDS–PAGE on 8% gels, and the signal was amplified by fluorography and detected on Amersham’s Hyperfilm. Quantitations of immunoprecipitations were performed either by scanning densitometry or by phosphorimager using the ImageQuant software (Molecular Dynamics, Sunnyvale, CA). The relative intensities at different chase times were expressed as percentages of the 5-min value corresponding to the highest intensity of labeling of the truncated ribophorin I variants.

HPLC analysis of the oligosaccharides bound to RI332-3HA in MadCl8 cells
To determine the structure of the N-glycans associated to total proteins, MadCl8 cells (5–10 x 106) were metabolically labeled at 34°C with 200 µCi of 2-(3H)Man (42.9 Gbq/mmol) from Amersham Pharmacia Biotech as described previously (Ermonval et al., 1997Go). The protein fraction was prepared by sequential extraction of cell monolayers with organic solvents as already described (Kmiécik et al., 1995Go). Proteins were digested overnight at room temperature with 0.2 mg of TPCK-treated trypsin, and the oligosaccharides were cleaved from the peptides by incubating overnight with 5 U of Peptide N-Glycanase F (Boehringer). After separation and desalting through a biogel-P2 column, oligosaccharides were analyzed by HPLC on an ASAHIPAK-NH2-P-50 column (Asahi, Kawasaki-ku, Japan). The oligomannosides eluted over an 80-min period of time in a 70:30 to 50:50 (v/v) acetonitrile/water gradient (flow rate 1 ml/min) were monitored with a Flo-one ß detector (Flotec).

Analysis of the N-glycans specifically associated to RI332-3HA had to face the difficulty of a protein representing a small amount of total proteins and in addition being degraded. To end up with sufficient material for HPLC analysis, the number of cells normally used was doubled and the labeling conditions were changed as to increase 3H-mannose incorporation. MadCl8 cells were preincubated for 30 min at 34°C in culture medium containing 10% dialyzed FCS at 0.5 mM glucose. They were metabolically labelled for 45 min in the same medium without glucose but containing 300 µCi of 2-(3H)Man per flask (about 107 cells). After washing the cells, the radioactivity was chased in normal culture medium for 10 min only, corresponding to a time where maximum level of truncated RI is detected. RI332-3HA was purified from MadCl8 Triton X-100 extracts by immunoprecipitation with protein A-sepharose beads (500 µl) coupled to anti-RI-LB antiserum (200 µl). Oligomannosides were released from RI332-3HA by directly treating the beads in the same way as indicated above for the protein fraction, then analyzed by HPLC. The same procedure was used to prepare the N-glycans associated to RI332-3HA from MadCl8 cells treated with Kif to inhibit {alpha}1, 2-mannosidases, except that the cells were pretreated for 1 h with Kif at 10 µM and the drug was maintained during all the subsequent steps of labeling and for 1 h of chase.

HPLC analysis of the N-glycans associated to intermediate of degradation of RI332-3HA in MadCl8 cells
The same protocol as described for HPLC analysis of oligomannosides bound to RI332-3HA was used, but for this study cell cultures were treated with the proteasome inhibitor ZLLL at 50 µM. The MadCl8 culture was preincubated in normal culture medium for 1 h with the drug, which was then maintained during the starvation in 0.5 mM glycose, the pulse labeling without glucose, and the chase in normal medium, which lasted for 4 h. Extraction and HPLC analysis of N-glycans released from RI332-3HA was proceeded as above.

To determine more precisely the mannose linkages present in the oligomannoside structure associated to RI332-3HA during its degradation, half of the material obtained from MadCl8 cells treated with ZLLL was digested overnight at 37°C with 5 µU of a mannosidase from A. saitoi (Oxford Glycosystem), specific for all the {alpha}1,2-mannose linkages, then digested oligomannosides were prepared for HPLC analysis.


    Acknowledgment
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
We thank Dr. G. Buttin for continuous support of this work, Dr. K. Kuchler for providing a plasmid containing three HA epitope repeats, Dr. G. Kreibich for his generous supply of anti-ribophorin I antibodies, and Mrs. W. Houssin for careful reading of the manuscript. This work was supported by research grants from the Austrian Science Foundation (P-12562-MOB) and the Kamillo Eisner Foundation (to N.E.I.), and by an EMBO fellowship, ASTF 9163 (to M.E.).


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
CHO, Chinese hamster ovary; DMN, deoxymannojirimycin; ER, endoplasmic reticulum; ERAD, endoplasmic reticulum–associated degradation; FCS, fetal calf serum; HPLC, high-performance liquid chromatography; Kif, kifunensine; PAGE, polyacrylamide gel electrophoresis; RI, ribophorin I; UGTR, UDP-Glc:glycoprotein glucosyltransferase.


    Footnotes
 
1 To whom correspondence should be addressed Back

2 Present address: Différenciation Cellulaire et Prions, UPR 1983 CNRS, Institut André Lwoff, 7 rue Guy Moguet, BP 8, 94800 Villejuif, France Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgment
 Abbreviations
 References
 
Atkinson, P.H., and Lee, J.T. (1984) Co-translational excision of alpha-glucose and alpha-mannose in nascent vesicular stomatitis virus G protein. J. Cell Biol., 98, 2245–2249.[Abstract/Free Full Text]

Ayalon-Soffer, M., Shenkman, M., and Lederkremer, G.Z. (1999) Differential role of mannose and glucose trimming in the ER degradation of asialoglycoprotein receptor subunits. J. Cell Sci., 112, 3309–3318.[Abstract]

Bause, E., Bieberich, E., Rolfs, A., Volker, C., and Schmidt, B. (1993) Molecular cloning and primary structure of Man9-mannosidase from human kidney. Eur. J. Biochem., 217, 535–540.[ISI][Medline]

Bause, E., Breuer, W., Schweden, J., Roeser, R., and Geyer, R. (1992) Effect of substrate structure on the activity of Man9-mannosidase from pig liver involved in N-linked oligosaccharide processing. Eur. J. Biochem., 208, 451–457.[ISI][Medline]

Bennett, M.J., Van Leeuwen, J.E., and Kearse, K.P. (1998) Calnexin association is not sufficient to protect T cell receptor alpha proteins from rapid degradation in CD4+CD8+ thymocytes. J. Biol. Chem., 273, 23674–23680.[Abstract/Free Full Text]

Bischoff, J., Liscum, L., and Kornfeld, R. (1986) The use of 1-deoxymannojirimycin to evaluate the role of various alpha-mannosidases in oligosaccharide processing in intact cells. J. Biol. Chem., 261, 4766–4774.[Abstract/Free Full Text]

Bonifacino, J.S., and Weissman, A.M. (1998) Ubiquitin and the control of protein fate in the secretory and endocytic pathways. Annu. Rev. Cell. Dev. Biol., 14, 19–57.[ISI][Medline]

Cabral, C.M., Choudhury, P., Liu, Y., and Sifers, R.N. (2000) Processing by endoplasmic reticulum mannosidases partitions a secretion-impaired glycoprotein into distinct disposal pathways. J. Biol. Chem., 275, 25015–25022.[Abstract/Free Full Text]

Daniel, P.F., Winchester, B., and Warren, C.D. (1994) Mammalian alpha-mannosidases—multiple forms but a common purpose? Glycobiology, 4, 551–66.[Abstract/Free Full Text]

de Virgilio, M., Kitzmuller, C., Schwaiger, E., Klein, M., Kreibich, G., and Ivessa, N.E. (1999) Degradation of a short-lived glycoprotein from the lumen of the endoplasmic reticulum: the role of N-linked glycans and the unfolded protein response. Mol. Biol. Cell, 10, 4059–4073.[Abstract/Free Full Text]

de Virgilio, M.,